DNA aptamer for improving CRISPR / Cas9 mediated exogenous gene integration efficiency based on CtIP protein and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a DNA aptamer for improving CRISPR / Cas9 mediated exogenous gene integration efficiency based on CtIP protein and application of the DNA aptamer, and the nucleotide sequence of the DNA aptamer is as shown in at least one of SEQ ID NO.1 and SEQ ID NO.10. The invention further discloses a preparation method of the DNA aptamer for improving CRISPR / Cas9 mediated exogenous gene integration efficiency based on CtIP protein. According to the invention, the key factor CtIP protein in DNA double-strand breakage repair is taken as a target for the first time, two aptamers are screened, and the donor vector of a CRISPR / Cas9 system is optimized by utilizing the aptamers, so that the integration efficiency of exogenous genes in HEK-293T cells and Hela cells is improved. The affinity of the CtIP protein specific DNA aptamer obtained through screening reaches the nanomole level, and the Kd value ranges from 42.56 nM to 407.29 nM. An aptamer is inserted into the tail end of a homologous arm of a donor carrier, and directional enrichment of a repair template is realized by utilizing an HMEJ mechanism. The aptamer A6913 and / or A13-32 significantly improves the integration efficiency of the exogenous gene, and the integration efficiency is improved by more than 3 times compared with a control group.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a DNA aptamer based on CtIP protein for improving the efficiency of CRISPR / Cas9-mediated exogenous gene integration and its application. Background Art

[0002] CRISPR / Cas9 technology is widely used in the field of gene editing due to its high efficiency and specificity, but its application remains limited by the low efficiency of exogenous gene integration. Homologous recombination (HR) is the primary pathway for precise gene integration, but its efficiency is limited by the abundance of repair templates. CtIP, a key factor in HR repair, is a key factor in HR repair, but its direct application is plagued by low vector transfection efficiency and poor protein stability.

[0003] Existing technologies can partially improve HR efficiency by fusing CtIP protein fragments or inhibiting non-homologous end joining (NHEJ). However, these methods have drawbacks such as complex operation, low vector transfection efficiency, and limited applicability. Therefore, there is an urgent need to provide a new strategy based on the CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration. Summary of the Invention

[0004] To solve the problem of low efficiency of CRISPR / Cas9-mediated exogenous gene integration, the present invention provides a DNA aptamer based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration.

[0005] The technical solution adopted in the present invention is:

[0006] The present invention provides a DNA aptamer for improving the efficiency of CRISPR / Cas9-mediated exogenous gene integration based on the CtIP protein, wherein the nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.10.

[0007] In a second aspect, the present invention provides a donor vector for a CRISPR / Cas9 gene editing system, wherein the donor vector is constructed using pMD19-T as a starting vector, and the donor vector comprises the DNA adaptor.

[0008] The third aspect of the present invention provides a vector set for constructing a CRISPR / Cas9 gene editing system, wherein the vector set includes the donor vector and the cutting vector.

[0009] Preferably, the cutting vector is obtained by using pSpCas9(BB)-2A-Puro as the starting vector and then linking sgRNA after enzyme cutting.

[0010] The fourth aspect of the present invention provides an application of the DNA aptamer, the donor vector or the vector group, wherein the application is to improve the integration efficiency of exogenous genes mediated by CRISPR / Cas9.

[0011] Preferably, improving the integration efficiency of the exogenous gene is carried out by the following methods:

[0012] The donor vector and the cleavage vector are co-transfected into cells and cultured.

[0013] Preferably, the cells include any one of HEK-293T and Hela cells.

[0014] Preferably, the mass ratio of the donor carrier to the cutting carrier is 1 to 3:1.

[0015] Preferably, the mass ratio of the donor vector to the cutting vector is 2:1.

[0016] The fifth aspect of the present invention provides a kit for detecting the efficiency of exogenous gene integration mediated by CRISPR / Cas9, wherein the kit comprises the DNA aptamer or the donor vector

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a DNA aptamer based on the CtIP protein for improving the efficiency of CRISPR / Cas9-mediated exogenous gene integration. The nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.10. The present invention, for the first time, targets the CtIP protein, a key factor in DNA double-strand break repair, screens two aptamers, and uses them to optimize the donor vector of the CRISPR / Cas9 system, thereby improving the efficiency of exogenous gene integration in HEK-293T cells and Hela cells. The CtIP protein-specific DNA aptamers obtained by screening have nanomolar affinity and Kd values ​​of 42.56nM to 407.29nM. By inserting the aptamers into the ends of the homologous arms of the donor vector, the HMEJ mechanism is used to achieve targeted enrichment of the repair template. The aptamers A6913 and / or A13-32 significantly improve the efficiency of exogenous gene integration, which is more than 3 times higher than that of the control group. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Statistical graph of DNA recovery rate.

[0020] Figure 2 Shown are five representative candidate sequences that may have affinity for CtIP.

[0021] Figure 3Analysis of the affinity and specificity of candidate aptamer sequences for CtIP protein.

[0022] Figure 4 The dissociation constant fitting curves of the candidate aptamer sequences to CtIP are: A: A6913; B: A6-17; C: A9-2; D: A13-32.

[0023] Figure 5 This is the donor vector map in the HMEJ strategy.

[0024] Figure 6 Enzyme digestion identification results for LA-SEPPA-19T construct.

[0025] Figure 7 This is the result of enzyme digestion identification of the donor vector Rosa26-Aptamer-HMEJ-Donor.

[0026] Figure 8 Schematic diagram of positive monoclonal cell screening based on the HMEJ strategy.

[0027] Figure 9 These are the results of HMEJ-mediated junction PCR detection of mixed clone cells. A: proves that the 5' end insert of Rosa26-Aptamer-HMEJ-Donor has successfully integrated into the upstream homology arm of the Rosa26 genome; B: proves that the 3' end insert of Rosa26-Aptamer-HMEJ-Donor has successfully integrated into the downstream homology arm of the Rosa26 genome.

[0028] Figure 10 The expression of EGFP protein in HEK-293T monoclonal cells under a fluorescence microscope.

[0029] Figure 11 The expression of EGFP protein in HEK-293T cells under fluorescence microscope after culturing for 2 days, 4 days and 6 days.

[0030] Figure 12 This is the statistical analysis result of the green fluorescence area ratio of HEK-293T cells under the fluorescence microscope field using ImageJ software.

[0031] Figure 13 Flow cytometric analysis of the exogenous EGFP positive rate in HEK-293T cells. A: flow cytometric scatter plot; B: statistical analysis of the percentage of positive cells based on flow cytometric results.

[0032] Figure 14 The expression of EGFP protein in Hela cells under a fluorescence microscope. A: The result 2 days after transfection; B: The result 4 days after transfection.

[0033] Figure 15 This is the statistical analysis result of the green fluorescence area ratio of Hela cells under the fluorescence microscope field using ImageJ software.

[0034] Figure 16 Flow cytometric analysis of the exogenous EGFP positive rate in Hela cells. A: flow cytometric scatter plot; B: statistics of the percentage of positive cells based on flow cytometric results. DETAILED DESCRIPTION

[0035] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0036] The inventive concept of the present invention is as follows:

[0037] The present invention provides a DNA aptamer based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration. The scheme is as follows:

[0038] 1) DNA aptamer screening: Using DNA library immobilized magnetic bead SELEX technology, with CtIP protein as the target, high-affinity aptamers such as A6913 and A13-32 were obtained after 13 rounds of screening.

[0039] 2) Donor vector construction: Design a donor vector based on the HMEJ strategy, insert adapter sequences at the ends of the left and right homology arms, so that the repair template is enriched at the DNA break site.

[0040] 3) Application of CRISPR / Cas9 system: The donor vector and CRISPR / Cas9 cutting vector are co-transfected into target cells, such as HEK-293T or Hela, and the gene integration efficiency is detected by fluorescence reporter system and flow cytometry.

[0041] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0042] Example 1

[0043] A DNA aptamer based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration, specifically as follows:

[0044] 1. Screening of DNA aptamers for CtIP protein.

[0045] 1.1. DNA library immobilized magnetic beads SELEX screening process.

[0046] 1.1.1. Establishment of random ssDNA library.

[0047] The random ssDNA library was established by consulting relevant literature. The DNA sequences in the library all contain 80 bases, where N represents a 40-base random base sequence in the middle and a fixed sequence of 20 bases at each end, which are the binding sites of primers during PCR amplification.

[0048] The initial random ssDNA library powder and primer powder were synthesized by Shanghai Bioengineering Co., Ltd. and purified by HPLC. According to the instructions on the tube wall, the ssDNA powder was diluted to a 100 μM solution and the primer was diluted to a 10 μM solution and stored at -20°C.

[0049] 1.1.2. PCR amplification reaction.

[0050] In the process of aptamer screening, PCR amplification is the key step in preparing the secondary library. Therefore, the PCR annealing temperature and cycle number are particularly important parameters in the experimental process and need to be optimized first.

[0051] In the annealing temperature optimization experiment, when the annealing temperature was 60.4°C, the target band was bright and single, so 60.4°C was selected as the optimal annealing temperature; in the initial library expansion cycle number optimization experiment, the amplified band of the initial library gradually became brighter with the increase of the cycle number, so 32 was selected as the optimal cycle number for initial library amplification.

[0052] 1.1.3. Fixation of the library.

[0053] The library amplified by primers is labeled with biotin at the 3' end, so it can be coupled to streptavidin magnetic beads through the high binding force of biotin-streptavidin, thereby fixing the random DNA library to the streptavidin magnetic beads. The magnetic beads used to fix the library are streptavidin magnetic beads from Anhui Anpu Tuomai Biotechnology Co., Ltd.

[0054] 1.1.4. Competitive screening.

[0055] After immobilizing the PCR product onto streptavidin magnetic beads using the method described in 1.1.3, add a defined amount of target CtIP protein solution and 100 μL Binding Buffer. Incubate with rotation at room temperature for 1 hour. Sequences with high affinity for CtIP will be displaced to form single strands. After 5 minutes of magnetic separation, remove the supernatant to obtain the CtIP-ssDNA complex. Measure the DNA concentration of the complex solution and record it. This complex will serve as a template for preparing the secondary library for the next round of screening.

[0056] 1.1.5 Anti-screening.

[0057] During the SELEX process, counter-selection is often used to improve the specificity of ssDNA in the library. This is done after the DNA recovery rate from the positive selection gradually increases and stabilizes.

[0058] 1.2. Monitoring of the aptamer screening process.

[0059] During the aptamer screening process, the total amount of DNA input in each round of screening, the total amount of DNA not fixed to the magnetic beads, and the total amount of DNA recovered in the supernatant were measured and recorded, and the DNA recovery rate was calculated. The trend of the DNA recovery rate can be used to determine whether the aptamer is enriched. When the DNA recovery rate reaches a peak or shows a downward trend, the screening can be terminated. The DNA recovery rate statistics are shown in Figure 1 .

[0060] Due to the high protein input in the first round of screening, DNA recovery decreased slightly after reducing the protein input in the second and third rounds. However, as screening progressed, DNA recovery gradually increased starting in the fourth round and stabilized by the ninth round. To improve the specificity of the ssDNA library, a counter-screening round was introduced in the 10th round using the binding buffer as a counter-screening target. Results showed a significant decrease in DNA recovery in the 10th round, likely due to the removal of ssDNA specifically bound to certain molecules in the binding buffer during the counter-screening process. Subsequently, positive screening rounds 11–13 were performed to stabilize library enrichment and DNA recovery. Results showed a significant increase in DNA recovery in the 11th round and gradually stabilized in the 12th and 13th rounds, at which point screening could be terminated.

[0061] Since the nucleic acid aptamer library contains short-chain DNA less than 100 bp, the recovery efficiency of the general gel excision and purification method is very low and it is difficult to meet the required amount of DNA library. Therefore, after each round of PCR amplification reaction, 20 μL of the amplified product is taken for agarose gel electrophoresis to identify whether the PCR product has the target band. The remaining PCR products are used as secondary libraries and put into the next round of nucleic acid aptamer screening.

[0062] Finally, the supernatants of the ssDNA-CtIP complexes from the 6th, 9th, and 13th rounds were selected as templates for PCR amplification. The PCR amplification products were recovered and purified and sent to Shanghai Sangon Biotechnology Co., Ltd. for aptamer sequencing.

[0063] 1.3. Nucleic acid aptamer sequencing and sequence analysis.

[0064] The results of nucleic acid aptamer sequencing removed the primer binding sequences at both ends and retained the random sequence of 40 bp in the middle. The results showed that the size of most sequences in the library was 40 bp, which was consistent with the expected results.

[0065] The sequencing results from rounds 6, 9, and 13 were processed. Aptamer sequences with >5 repeats in round 6, ≥5 repeats in round 9, and ≥4 repeats in round 13 were selected. Sequences with <25 bases were removed. Homology analysis was performed on the selected sequences, resulting in 40 sequences with ≥60% homology. Three of these sequences were identical in base sequence, with a total of 163 repeats, resulting in a total of 38 preliminary candidate sequences. The results are shown in Table 1 below, which lists the 38 preliminary candidate sequences and their repeat counts from the three rounds of sequencing results.

[0066] Table 138 preliminary candidate nucleic acid aptamer sequences and repeat number statistics

[0067]

[0068]

[0069] 1.4. Prediction and analysis of the secondary structure of nucleic acid aptamers.

[0070] Initial analysis identified 38 candidate sequences based on sequence repeat count and homology. However, a higher repeat count does not necessarily mean better target binding. Research indicates that unique higher-order conformations are crucial for aptamer-target interactions. Therefore, RNA structure software was used to simulate the secondary structures of the 38 candidate aptamers. These 38 aptamers were then divided into five distinct families based on their similarities.

[0071] The secondary structure of each of the 38 candidate sequences embodies a stem-loop structure or a raised loop structure. In aptamers with more complex structures, a hairpin structure is always used to connect the stem-loop and the raised loop. These special structures often contain DNA active sites that can specifically bind to the target. Generally speaking, the stem plays a role in stabilizing and supporting the spatial structure of the aptamer, and the loop folds to form a binding site with the target through hydrophobic interactions, base stacking and hydrogen bonding.

[0072] In addition, studies have shown that the lower the ΔG value of the secondary structure of the aptamer, the more stable the secondary structure of the aptamer. Therefore, it is also very important to predict the ΔG value of nucleic acid aptamers. The predicted ΔG values ​​of candidate aptamers are shown in Table 2.

[0073] Table 2 Classification and ΔG value prediction of 38 preliminary candidate nucleic acid aptamer families

[0074]

[0075]

[0076] Since the stability of the secondary structure of the aptamer and the degree of enrichment in the library are important indicators for screening, the repeat number and ΔG value of the 38 candidate sequences were comprehensively considered and 5 representative sequences were selected from the 38 candidate sequences. Figure 2 The five sequences are: A13-32 of family I, A9-2 of family II, A6913 of family III, A6-17 of family IV, and A13-10 of family V. The affinity of these five nucleic acid aptamers will be further tested in the future.

[0077] 1.5. Analysis of nucleic acid aptamer affinity and specificity based on ssDNA binding rate.

[0078] Five nucleic acid aptamers with biotin modification at the 5' end were synthesized, and the affinity specificity of the five nucleic acid aptamers was detected by immobilizing nucleic acid aptamers with streptavidin magnetic beads. Figure 3 Compared with the control group (BSA), the affinities of the four nucleic acid aptamers A6913, A6-17, A9-2, and A13-32 for the target protein CtIP were significantly higher than those of BSA. While A13-10 had a higher affinity for CtIP, the difference was not significant compared with the BSA group, indicating that the specificity of aptamer A13-10 was poor. Therefore, the detection of A13-10 will be removed in subsequent experiments. Figure 3 “***” represents p < 0.001, and “ns” represents p > 0.05.

[0079] 1.6. Determination of the aptamer dissociation constant Kd based on ssDNA binding rate.

[0080] The dissociation constant of nucleic acid aptamers was determined by immobilizing nucleic acid aptamers with streptavidin magnetic beads. Figure 4 As shown in the figure, the aptamer dissociation constant fitting curve shows that aptamer A6-17 has the largest dissociation constant, A9-2 has the smallest, and A6913 and A13-32 fall between the former two. The lower the dissociation constant of an aptamer, the stronger and more stable its binding to the target. Therefore, based on the dissociation constants, the binding affinity of the four aptamers to the CtIP protein is as follows: A9-2 > A13-32 > A6913 > A6-17. To verify whether the four selected aptamers can improve the efficiency of exogenous gene integration, subsequent experiments will select these four aptamers for CRISPR / Cas9 gene targeting.

[0081] Example 2

[0082] An application of a DNA aptamer based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration is as follows:

[0083] 1. Construction of HMEJ donor vector with site-specific integration of EGFP gene.

[0084] The HMEJ homologous recombination donor vector is designed according to the experimental needs. The present invention adds SA upstream of the exogenous gene to ensure the correct shearing and splicing of the transcribed mRNA, and the adapter sequence is located between the homologous arms at both ends and the sgRNA at both ends. Figure 5 .

[0085] 1.1. Donor vector homology arm design and PCR amplification.

[0086] The targeting site was selected by consulting the literature and is located in the intron between the first and second exons of the Rosa26 locus. The sgRNA sequence is shown in SEQ ID NO. 39. The left and right homology arms were designed based on the genomic sequence near the sgRNA.

[0087] SEQ ID NO.39: GTCGAGTCGCTTCTCGATTA TGG , the underlined TGG is the PAM sequence.

[0088] The left homologous arm, referred to as LA, has a sequence as shown in SEQ ID NO.40; the right homologous arm, referred to as RA, has a sequence as shown in SEQ ID NO.41.

[0089] SEQ ID NO.40:

[0090] AAGCTCCTGTCAGTTACGCCGTCGGGAGTACGCAGCCGCTTAGCGACTCTCGCGTTGCCCCCTGGGTGGGGCGGGTAGGTAGGTGGGGTGTAGAGATGCTGGGTGTGCGGGCGCGGCCGGCCTCCTGCGGCGGGAGGGGAGGGTCAGTGAAATCGGCTCTGGCGCGGGCGTCCTCCCACCCTCCCCTTCCTTCGGGGGAGTCGGTTTACCCGCCGCCTGCTTGTCTTCGACACCTGATTGGCTGTCGAAGCTGTGGGACCGGGCCCTTGCTACTGGCTCGAGTCTCACATGAGCGAAACCACTGCGCGGGGCGCGGGGGTGGCGGGGAGGCGGGCGTTGGTACGGTCCTCCCCGAGGCCGAGCGCCGCAGTGTCTGGCCCCGCGCCCCTGCGCAACGTGGCAGGAAGCGCGCGCTGGAGGCGGGGGCGGGCTGCCGGCCGAGACTTCTGGATGGCGGCGGCCGCGGCTCCGCCCCGGGTTCCCACCGCCTGAAGGGCGAGACAAGCCCGACCTGCTACAGGCACTCGTGGGGGTGGGGGAGGAGCGGGGGTCGGTCCGGCTGGTTTGTGGGTGGGAGGCGCTTGTTCTCCAAAAACCGGCGCGAGCTGCAATCCTGAGGGAGCTGCGGTGGAGGAGGTGGAGAGAAGGCCGCACCCTTCTGGGCAGGGGGAGGGGAGTGCCGCAATACCTTTATGGGAGTTCTCTGCTGCCTCCCGTCTTGTAAGGACCGCCCTGGGCCTGGAAGAAGCCCTCCCTCCTTTCCTCCTCGCGTGATCTCGTCATCGCCTCCATGTCGAGTCGCTTCTCGA。

[0091] SEQ ID NO.41:

[0092] TTATGGGCGGGATTCTTTTGCCTAGGCTTAAGGGGCTAACTTGGTCCCTGGGCGTTGCCCTGCAGGGGAGTGAGCAGCTGTAAGATTTGAGGGGCGACTCCGATTAGTTTATCTTCCCACGGACTAGAGTTGGTGTCGAGGTTATTGTAATAAGGGTGGGGTAGGGAAATGGAGCTTAGTCATTCACCTGGGGCTGATTTTATGCAACGAGACTGCGGATTATCACTACTTATCATTTTTGGAGCATTTTTCTAGAGACAGACATAAAGCATGATCACCTGAGTTTTATACCATTTGAGACCCTTGCTGCACCACCAAAGTGTAGCATCAGGTTAAATCTTAATAGAAAAATTTTAGCTTTTGCTTGAGAAACCAGTGCTTCCCTCCCTCACCCTCTCTCCCCAGGCTCTCTACCCCTTTGCATCCCTACCAGGCATCTTAGCAACTCTCACTCATACTTGATCCCATTTTCCATTTGTTGTACTTGCTCCTCTAGTATTCAGACATAGCACTAGCTTTCTCCCTCTCTTGATCTTGGGTAGCCTGGTGTCTCGCGAAACCAGACAGATTGGTTCCACCACAAATTAAGGCTTGAGCTGGGGCTTGACTCTTACCCAGCAGTGCTTTTATTCCTCCCTAGTTCACGTTCTTAAATGTTTATCTTGATTTTCATTTTATCCTTTTTCCTTAGCTGGGATTCTGTCCCTGACCGTCTTCACAGTCCAGGTGATCTTGACTACTGCTTTACAGAGAATTGGATCTGAGGTTAGGCAACATCTCCCTTTTTCTTCCTCTAAATACCTCTCATTTCTGTTCTTACCAGTTAGTAACTGATCTCAGATGCCTGTGTGATAGCTTCCAA。

[0093] Using the HEK-293T cell genome as the template for PCR amplification, the homologous arms on both sides of the donor vector were prepared.

[0094] The primers were designed as shown in Table 3 below, where the aptamers were A6913, A6-17, A9-2, and A13-32, respectively.

[0095] Table 3 PCR amplification primers for the left and right homology arms of the HMEJ donor vector

[0096]

[0097] Note: The aptamers in Table 3 represent the sequences of A6913, A6-17, A9-2, and A13-32.

[0098] After PCR, the target fragment of the correct size was recovered, treated with A, and then TA cloning was performed using the pMD19-T vector. After transformation, single colony picking, and sequencing, the left homology arm vector Rosa26-LA-19T, containing the aptamer and sgRNA sequences, and the right homology arm vector Rosa26-RA-19T, containing the aptamer and sgRNA sequences, were obtained. Since four aptamer sequences are provided here, a total of four sets of homology arm vectors were constructed, as well as a control set without an adapter.

[0099] 1.2. PCR amplification of promoter-less exogenous genes and selection markers.

[0100] The EGFP gene was selected as an exogenous gene, and its expression was driven by the endogenous promoter at the human Rosa26 locus. Using the pNRAMP1-eGFP-P2A-Puro plasmid, previously constructed and preserved in the laboratory, the exogenous gene EGFP and the puromycin resistance gene EGFP-P2A-Puro-polyA were cloned. To ensure normal expression of the promoter-less exogenous gene, an SA sequence was added before the EGFP-P2A-Puro-polyA sequence. This SA sequence was added to the upstream primer, and PCR amplification was performed to amplify the exogenous gene with the SA sequence. The product was named SEPPA. The SA sequence stands for Splice Acceptor.

[0101] After the PCR product was amplified, its size was identified by 1% agarose gel electrophoresis, and it was purified and recovered before TA cloning, transformation, sequencing, etc. The correct plasmid was named SEPPA-19T.

[0102] 1.3. Enzyme digestion and ligation of donor vector elements.

[0103] The successfully constructed Rosa26-LA-19T and SEPPA-19T were digested with restriction endonucleases SpeⅠ and HindⅢ, respectively. After separation and purification, the SEPPA fragment was ligated with the linearized Rosa26-LA-19T plasmid to obtain the vector Rosa26-LA-SEPPA-19T. Figure 6 . Figure 6Lanes 1 to 3: Control group; Lanes 4 to 6: A6913 group; Lanes 7 to 9: A6-17 group; Lanes 10 to 12: A9-2 group; Lanes 13 to 15: A13-32 group. The first lane of each vector group was double-enzyme digestion, and the last two lanes were single-enzyme digestion.

[0104] Five vectors were obtained by this method, namely, the ordinary vector Control group without aptamer sequence, the vector with aptamer A6913, the vector with aptamer A6-17, the vector with aptamer A9-2, and the vector with aptamer A13-32.

[0105] After transformation, bacterial selection, enzyme digestion identification, and sequencing, the correct plasmid was named Rosa26-LA-SEPPA-19T. The correctly identified plasmids Rosa26-LA-SEPPA-19T and Rosa26-RA-19T were double-digested with restriction endonucleases HindⅢ and EcoRI and then ligated to obtain a recombinant vector named Rosa26-Aptamer-HMEJ-Donor, i.e., the donor vector. The results were shown in Figure 2. Figure 7 .

[0106] Figure 7 In the figure, lanes 1 to 3: enzyme digestion identification of the donor vector of the Control group; lanes 4 to 6: enzyme digestion identification of the donor vector of the A6913 group; lanes 7 to 9: enzyme digestion identification of the donor vector of the A6-17 group; lanes 10 to 12: enzyme digestion identification results of the donor vector of the A9-2 group; lanes 13 to 15: enzyme digestion identification results of the donor vector of the A13-32 group. The first lane of each group of vectors is double enzyme digestion identification, and the last two lanes are single enzyme digestion identification.

[0107] The donor vector constructed in this invention contains sgRNA sequences at both ends of the left and right homology arms, aptamer sequences, left and right homology arms, and SEPPA sequences, making it suitable for HMEJ gene targeting strategies. Five Rosa26-Aptamer-HMEJ-Donor donor vectors were constructed using the above method: Rosa26-Control-HMEJ-Donor, Rosa26-A6913-HMEJ-Donor, Rosa26-A6-17-HMEJ-Donor, Rosa26-A9-2-HMEJ-Donor, and Rosa26-A13-32-HMEJ-Donor.

[0108] 2. Construction of CRISPR / Cas9 expression vector.

[0109] pSpCas9(BB)-2A-Puro is a commonly used starting vector for cutting vectors in laboratories. We synthesized an oligonucleotide sequence targeting the human Rosa26 target site selected above, added a cohesive end with a BbSⅠ restriction endonuclease, and digested pSpCas9(BB)-2A-Puro with the restriction endonuclease BbSⅠ. The sgRNA sequence was then ligated to the digested expression vector via annealing, successfully constructing a CRISPR / Cas9 eukaryotic expression vector. The sgRNA sequences for the BbSⅠ restriction endonuclease are the Top Guide oligo and the Bottom Guide oligo. pSpCas9(BB)-2A-Puro, PX459, plasmid #48139.

[0110] SEQ ID NO.46, Top Guide oligo:

[0111] 5'-CACCGGTCGAGTCGCTTCTCGATTA-3'.

[0112] SEQ ID NO.47, Bottom Guide oligo:

[0113] 5'-AAACTAATCGAGAAGCGACTCGACC-3'.

[0114] The bases in bold in SEQ ID NO.46 and SEQ ID NO.47 are the corresponding enzyme cleavage sites.

[0115] After transformation, bacterial picking, enzyme digestion identification and sequencing, the correct plasmid was finally named Cas9-Rosa26-sgRNA, which is the cutting vector.

[0116] 3. Liposome transfection.

[0117] This experiment required co-transfection of one of the donor vectors and the Cas9-Rosa26-sgRNA cutting vector. The mass ratio of Rosa26-Aptamer-HMEJ-Donor to Cas9-Rosa26-sgRNA transfection was 2:1. Due to the different donor vectors, this experiment had five experimental groups: the control group (without adapter sequence), the A6913 group, the A6-17 group, the A9-2 group, and the A13-32 group.

[0118] 4. Screening of positive clone cells with site-specific integration of EGFP gene.

[0119] The identification strategy of the site-directed integration of exogenous genes in positive monoclonal cells obtained in the present invention is shown in Figure 8 .

[0120] 4.1. Screening of positive clone cells.

[0121] The plasmids Rosa26-Aptamer-HMEJ-Donor and Cas9-Rosa26-sgRNA were co-transfected into HEK-293T cells at approximately 70% confluence. One day after transfection, the medium was changed and puromycin was added at a final concentration of 2 μg / mL for drug selection. The cells were observed and the medium was changed every two days. After 15 days of puromycin selection, monoclonal cell clumps were observed under a microscope. These monoclonal cell clumps exhibited the expected green fluorescence when observed. A mixed clone sample was obtained by gently scraping the monoclonal cell clumps from one cell culture dish using a cell scraper and collecting them in a centrifuge tube. The sample was centrifuged at 1050g for 5 minutes. The supernatant was discarded, and the genomic DNA of the mixed clones was extracted using the Tiangen Biochemical Technology Co., Ltd. Blood / Cell / Tissue Genomic DNA Extraction Kit for subsequent junction PCR analysis.

[0122] 4.2. Junction PCR was used to detect the integration of mixed cloned cells.

[0123] The genome of the mixed clone cells mentioned above was identified by junction PCR. The wild-type HEK-293T cell genome was used as the negative control WT group; the extracted genomic DNA of the mixed clone cells was used as a template, and primers 5'Junction-F and 5'Junction-R were used to perform PCR amplification reaction, and a band with a length of 596bp was obtained, proving that the 5' end insertion fragment of Rosa26-Aptamer-HMEJ-Donor was successfully integrated with the upstream homologous arm of the Rosa26 genome; primers 3'Junction-F and 3'Junction-R were used to perform PCR amplification reaction, and a band with a length of 722bp was obtained, proving that the 3' end insertion fragment of Rosa26-Aptamer-HMEJ-Donor was successfully integrated with the downstream homologous arm of the Rosa26 genome. The Rosa26-Aptamer-HMEJ-Donor insertion fragment was accurately integrated into the expected region of the Rosa26 site through homologous recombination, verifying that the insertion was a fixed-point insertion rather than a random integration. The agarose gel electrophoresis diagram of the Junction PCR detection results is shown in the figure below. Figure 9 shown.

[0124] Figure 9 In A, lane 1: WT; lane 2: Control; lane 3: A6913; lane 4: A6-17; lane 5: A9-2; lane 6: A13-32; Figure 9In B, lane 1: WT; lane 2: Control; lane 3: A6913; lane 4: A6-17; lane 5: A9-2; lane

[0125] 6:A13-32.

[0126] Sequencing analysis can more directly detect whether the exogenous gene has been integrated at the expected site of the Rosa26 locus on the genome of the mixed clone cells. Therefore, the above products were separated and purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing analysis. The sequencing results showed that the DNA sequence was consistent with the amplification product expected when the primers were designed, confirming the successful site-specific integration of the exogenous gene.

[0127] Further results showed that the exogenous gene was integrated into the target site on the genome of the monoclonal cell obtained after drug screening, and the exogenous EGFP gene could be observed to express green fluorescence under a fluorescence microscope. Figure 10 .

[0128] 5. Detection and analysis of green fluorescent protein expression using a fluorescence microscope.

[0129] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and CRISPR / Cas9 expression vector were co-transfected into HEK-293T cells, and the expression of exogenous green fluorescent protein in the cells was observed under a fluorescence microscope to detect the integration efficiency of the exogenous gene. HEK-293T cells were transfected with the liposome method and the expression of EGFP protein was observed under a fluorescence microscope 2d, 4d, and 6d after transfection. The results are shown in Figure 11 .

[0130] ImageJ software was used to perform statistical analysis on the percentage of green fluorescence area in the corresponding field of view of each group of cells. It can be seen that at 2d, 4d, and 6d after transfection, the percentage of green fluorescence area in the A6913 and A13-32 groups was significantly higher than that in the Control group, while the percentage of green fluorescence area in the A6-17 and A9-2 groups was significantly lower than that in the Control group. This preliminarily indicates that the aptamers A6913 and A13-32 increased the integration efficiency of the exogenous gene EGFP compared with the ordinary group without the aptamer sequence, while A9-2 and A6-17 reduced the integration efficiency of the exogenous gene EGFP. Graphpadprism was used for significance analysis. Results are shown in the figure. Figure 12 .

[0131] ***p<0.001.

[0132] 6. Flow cytometry detection.

[0133] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and CRISPR / Cas9 cutting vector were co-transfected into HEK-293T cells. In addition to the five experimental groups, a blank control group, the Blank group, was set up to eliminate the background value of the cells themselves. On the sixth day after transfection, cells were collected and the EGFP positive rate of 293T cells was detected by flow cytometry. Figure 13 ****p<0.0001, ***p<0.001, **p<0.01.

[0134] The results showed that the positive cell rate in the A6913 group was significantly higher than that in the control group, the positive cell rate in the A13-32 group was extremely significantly higher than that in the control group, and the positive cell rates in the A6-17 and A9-2 groups were extremely significantly lower than those in the control group. These results indicate that the aptamers A6913 and A13-32 groups increased the integration efficiency of the exogenous gene EGFP compared to the common vector in the control group, while the aptamers A6-17 and A9-2 groups decreased the integration efficiency of the exogenous gene EGFP compared to the common vector in the control group. This trend is consistent with the expression of EGFP protein observed under a fluorescence microscope.

[0135] 7. EGFP was expressed in Hela cells using the Rosa26 endogenous promoter.

[0136] 7.1. Analysis of exogenous EGFP protein expression in Hela cells under a fluorescence microscope.

[0137] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and CRISPR / Cas9 cutting vector were co-transfected into Hela cells. The expression of exogenous EGFP protein in the cells was observed by fluorescence microscopy to detect the integration efficiency of the exogenous gene. Since the overall transfection efficiency of Hela cells was low in actual experimental observation, the overall expression level of green fluorescent protein was low, and the expression level at 6 days was no different from that at 4 days, only Hela cells at 2 days and 4 days after transfection were observed and analyzed. Fluorescence microscopy was used to take pictures at 2 days and 4 days after transfection. The results are shown in Figure 2. Figure 14 .

[0138] The results of statistical analysis of the green fluorescence area ratio in the corresponding field of view of each group of cells using ImageJ software are as follows:

[0139] It can be seen that at 2 days and 4 days after transfection, the green fluorescence area percentage of the A6913 and A13-32 groups was significantly higher than that of the Control group, while the green fluorescence area percentage of the A6-17 and A9-2 groups was not significantly different from that of the Control group. This preliminarily indicates that the aptamers A6913 and A13-32 increased the integration efficiency of the exogenous gene EGFP compared to the ordinary group without the addition of aptamer sequences. The expression of EGFP in the A6913 and A13-32 groups was consistent with the expression trend of EGFP in HEK-293T cells. ***p<0.001, ns p>0.05. Figure 15 .

[0140] 7.2 Flow cytometric analysis of exogenous EGFP protein expression in HeLa cells

[0141] The successfully constructed donor vector Rosa26-Aptamer-HMEJ-Donor and CRISPR / Cas9 cutting vector were co-transfected into Hela cells. The cells were collected on the 4th day after transfection and the EGFP positive rate of Hela cells was detected by flow cytometry. The results are as follows Figure 16 ***p<0.001, *p<0.05.

[0142] like Figure 16 As shown, the positive cell rate in the A6913 group was significantly higher than that in the Control group, the positive cell rate in the A13-32 group was extremely significantly higher than that in the Control group, and the positive cell rates in the A6-17 and A9-2 groups were significantly lower than those in the Control group. The results showed that aptamers A6913 and A13-32 increased the integration efficiency of the exogenous gene EGFP compared to the common vector in the Control group, while aptamers A6-17 and A9-2 decreased the integration efficiency of the exogenous gene EGFP compared to the common vector in the Control group. This trend is consistent with the expression of EGFP protein observed under a fluorescence microscope.

[0143] The A6913 aptamer, by integrating a nuclear localization signal (NLS) or a chromatin-opening element (UCOE), enhances the transport of the donor vector into the cell nucleus and promotes the relaxation of chromatin structure at the target locus, thereby increasing the accessibility of the donor template. The A13-32 aptamer may carry homologous recombination enhancer elements, such as Rad51 binding sites, which specifically recruit recombinases to double-strand break (DSB) sites, activating the homology-directed repair pathway and improving repair accuracy. The combined action of A6913 optimizes donor delivery efficiency and A13-32 enhances recombinase activity, achieving a multiplier effect. Experiments in this study demonstrated that the combined use of two donors can increase the efficiency of exogenous gene integration by threefold compared to a single donor. This increase is attributed to: Extended homology coverage: The dual donors optimize the homologous sequences of LA and RA, respectively, creating a longer effective recombination zone; and Activated repair pathways: The A13-32 aptamer accelerates homologous strand pairing and template exchange by recruiting recombinases such as Rad51.

[0144] Enhanced specificity and safety: Dual donors reduce nonspecific insertions by competitively binding to the repair mechanism. For example, the A6913 donor may preferentially occupy the target site through high homology, while the A13-32 donor inhibits random integration through its functional elements.

[0145] By combining the Rosa26-A6913-HMEJ-Donor, Rosa26-A13-32-HMEJ-Donor, and Cas9-Rosa26-sgRNA, this invention innovatively achieves a comprehensive chain optimization strategy of "precise cleavage, efficient delivery, and coordinated repair." This dual-donor design not only improves integration efficiency through functional complementarity but also reduces technical risk through redundant templates, providing a highly efficient and reliable new strategy for gene editing. This approach has passed preliminary theoretical validation, and subsequent experiments will further quantify its efficiency advantages and explore broader clinical application scenarios.

[0146] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0147] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A DNA aptamer based on CtIP protein to improve the efficiency of CRISPR / Cas9-mediated exogenous gene integration, characterized in that: The nucleotide sequence of the DNA aptamer is at least one of SEQ ID NO.1 and SEQ ID NO.

10.

2. A donor vector for a CRISPR / Cas9 gene editing system, characterized in that: The donor vector is constructed using pMD19-T as a starting vector, and the donor vector comprises the DNA adaptor according to claim 1.

3. A vector set for constructing a CRISPR / Cas9 gene editing system, characterized in that: The vector set comprises the donor vector and the cutting vector according to claim 2.

4. The carrier set according to claim 3, wherein The cutting vector is obtained by using pSpCas9(BB)-2A-Puro as the starting vector and then connecting sgRNA after enzyme cutting.

5. Use of the DNA aptamer according to claim 1, the donor vector according to claim 2, or the vector set according to claim 3, characterized in that: The application refers to improving the integration efficiency of exogenous genes mediated by CRISPR / Cas9.

6. The use according to claim 5, characterized in that Improving the integration efficiency of exogenous genes is achieved through the following methods: The donor vector and the cleavage vector are co-transfected into cells and cultured.

7. The use according to claim 6, characterized in that The cells include any one of HEK-293T and Hela cells.

8. The use according to claim 6, characterized in that The mass ratio of the donor vector to the cutting vector is 1 to 3:

1.

9. The use according to claim 8, characterized in that The mass ratio of the donor vector to the cutting vector is 2:

1.

10. A kit for detecting the efficiency of CRISPR / Cas9-mediated exogenous gene integration, characterized in that: The kit comprises the DNA aptamer according to claim 1 or the donor vector according to claim 2.

Images