A SNP molecular marker associated with corn ear rot and its application
Through whole-genome association analysis and solid-phase chip technology, SNP molecular markers related to corn ear rot were developed, which solved the problems of environmental interference and false negatives in the identification of corn ear rot resistance, achieved efficient and accurate corn breeding tool support, and promoted the cultivation of multi-excellent locus varieties.
Patent Information
- Application Number
- CN202511053506.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-30
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2045-07-30
AI Technical Summary
Existing technologies are susceptible to environmental interference and have long cycles in identifying corn ear rot resistance. Single-molecule marker detection is prone to false negatives, making it difficult to efficiently and accurately identify corn ear rot resistance genotypes.
Whole-genome association analysis combined with solid-phase chip high-throughput genotyping was used to develop multi-locus collaborative haplotype markers based on linkage disequilibrium. 70 SNP loci were used to accurately locate resistance-associated loci, and the genotype of corn plants was detected using the high-density gene chip Maize 50K.
It significantly improved the accuracy of identifying functional sites of micro-effect genes, provided efficient and accurate molecular tools to support corn breeding, revealed the genetic variation characteristics of corn ear rot, and promoted the cultivation of varieties with multiple excellent sites.
Smart Images

Figure CN120555649B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular marker development, and in particular relates to a SNP molecular marker associated with corn ear rot and an application thereof. Background Art
[0002] Corn is a major staple food crop, playing a crucial role in the production of feed, food, industrial raw materials, and energy, and is crucial to the agricultural economy and food security. Corn ear rot is a serious fungal disease that can cause a 10%-20% yield reduction. In severely infected areas, yields can drop by 50% or even disappear completely. Furthermore, rotting corn ears contain a range of mycotoxins, such as aflatoxins, deoxynivalenol, nivalenol, zearalenone, and fumonisins. These mycotoxins can cause disease in livestock and increase the risk of cancer in humans, severely impacting the economic value of corn. Breeding corn varieties with disease-resistant genes to effectively reduce the incidence of the disease has become a key research focus to ensure corn yields and enhance food safety and economic value.
[0003] Genome-wide association analysis (GWAS) is a highly efficient method for analyzing the genetic basis of complex traits. Its core principle is to detect tens of thousands of single nucleotide polymorphisms (SNPs) in natural populations using high-throughput genotyping techniques. Combined with phenotypic data for target traits, statistical models are then used to identify population-level associations between genotype and phenotype. Compared to traditional linkage analysis, this method does not require the construction of segregating populations and can directly utilize maize inbred lines. It can also simultaneously analyze the genetic effects of multiple minor genes, providing a target location foundation for the subsequent development of resistance-related molecular markers.
[0004] Currently, traditional phenotypic evaluation in the identification of corn ear rot resistance is susceptible to environmental interference and has a long cycle, while the single-molecule marker detection system may produce false negative results due to primer failure or allele loss. Existing technologies still have technical bottlenecks in efficiently and accurately identifying genotypes of corn ear rot resistance.
[0005] In response to the above technical bottlenecks, the present invention innovatively utilizes the high-throughput and high-precision genotyping advantages of solid-phase chips, accurately locates resistance-associated sites through whole-genome association analysis, and then develops multi-locus collaborative haplotype markers based on linkage disequilibrium, which significantly improves the identification accuracy of functional sites of micro-effect genes, and provides molecular tool support for scalable application for the genome design and breeding of corn resistant to ear rot. Summary of the Invention
[0006] The problem to be solved by the present invention is to provide a SNP molecular marker related to corn ear rot and application thereof.
[0007] The present invention provides a SNP molecular marker associated with corn ear rot, wherein the SNP molecular marker includes the following 70 SNP sites:
[0008] The genomic position of SNP1 is Chr7: 123731149 bp;
[0009] The genomic position of SNP2 is Chr7: 123731235 bp;
[0010] The genomic position of SNP3 is Chr7: 123731342 bp;
[0011] The genomic position of SNP4 is Chr7: 123731395 bp;
[0012] The genomic position of SNP5 is Chr7: 123731412 bp;
[0013] The genomic position of SNP6 is Chr7: 123731452 bp;
[0014] The genomic position of SNP7 is Chr7: 123731460 bp;
[0015] The genomic position of SNP8 is Chr7: 123731486 bp;
[0016] The genomic position of SNP9 is Chr7: 123731550 bp;
[0017] The genomic position of SNP10 is Chr7: 123731596 bp;
[0018] The genomic position of SNP11 is Chr7: 123731615 bp;
[0019] The genomic position of SNP12 is Chr7: 123731642 bp;
[0020] The genomic position of SNP13 is Chr7: 123731672 bp;
[0021] The genomic position of SNP14 is Chr7: 123731770 bp;
[0022] The genomic position of SNP15 is Chr7: 123731935 bp;
[0023] The genomic position of SNP16 is Chr7: 123732076 bp;
[0024] The genomic position of SNP17 is Chr7: 123732131 bp;
[0025] The genomic position of SNP18 is Chr7: 123732143 bp;
[0026] The genomic position of SNP19 is Chr7: 123732325 bp;
[0027] The genomic position of SNP20 is Chr7: 123732377 bp;
[0028] The genomic position of SNP21 is Chr7: 123732392 bp;
[0029] The genomic position of SNP22 is Chr7: 123732506 bp;
[0030] The genomic position of SNP23 is Chr7: 123732521 bp;
[0031] The genomic position of SNP24 is Chr7: 123732539 bp;
[0032] The genomic position of SNP25 is Chr7: 123732578 bp;
[0033] The genomic position of SNP26 is Chr7: 123732608 bp;
[0034] The genomic position of SNP27 is Chr7: 123732627 bp;
[0035] The genomic position of SNP28 is Chr7: 123732645 bp;
[0036] The genomic position of SNP29 is Chr7: 123732655 bp;
[0037] The genomic position of SNP30 is Chr7: 123732661 bp;
[0038] The genomic position of SNP31 is Chr7: 123732680 bp;
[0039] The genomic position of SNP32 is Chr7: 123732694 bp;
[0040] The genomic position of SNP33 is Chr7: 123732717 bp;
[0041] The genomic position of SNP34 is Chr7: 123732722 bp;
[0042] The genomic position of SNP35 is Chr7: 123732725 bp;
[0043] The genomic position of SNP36 is Chr7: 123732739 bp;
[0044] The genomic position of SNP37 is Chr7: 123732820 bp;
[0045] The genomic position of SNP38 is Chr7: 123732828 bp;
[0046] The genomic position of SNP39 is Chr7: 123732851 bp;
[0047] The genomic position of SNP40 is Chr7: 123732909 bp;
[0048] The genomic position of SNP41 is Chr7: 123732976 bp;
[0049] The genomic position of SNP42 is Chr7: 123733025 bp;
[0050] The genomic position of SNP43 is Chr7: 123733066 bp;
[0051] The genomic position of SNP44 is Chr7: 123733071 bp;
[0052] The genomic position of SNP45 is Chr7: 123733143 bp;
[0053] The genomic position of SNP46 is Chr7: 123733160 bp;
[0054] The genomic position of SNP47 is Chr7: 123733217 bp;
[0055] The genomic position of SNP48 is Chr7: 123733252 bp;
[0056] The genomic position of SNP49 is Chr7: 123733265 bp;
[0057] The genomic position of SNP50 is Chr7: 123733336 bp;
[0058] The genomic position of SNP51 is Chr7: 123733353 bp;
[0059] The genomic position of SNP52 is Chr7: 123733399 bp;
[0060] The genomic position of SNP53 is Chr7: 123733446 bp;
[0061] The genomic position of SNP54 is Chr7: 123733486 bp;
[0062] The genomic position of SNP55 is Chr7: 123733509 bp;
[0063] The genomic position of SNP56 is Chr7: 123734379 bp;
[0064] The genomic position of SNP57 is Chr7: 123779324 bp;
[0065] The genomic position of SNP58 is Chr7: 123789885 bp;
[0066] The genomic position of SNP59 is Chr7: 123796772 bp;
[0067] The genomic position of SNP60 is Chr7: 123802325 bp;
[0068] The genomic position of SNP61 is Chr7: 123802398 bp;
[0069] The genomic position of SNP62 is Chr7: 123810722 bp;
[0070] The genomic position of SNP63 is Chr7: 123816027 bp;
[0071] The genomic position of SNP64 is Chr7: 123816040 bp;
[0072] The genomic position of SNP65 is Chr7: 123816046 bp;
[0073] The genomic position of SNP66 is Chr7: 123816118 bp;
[0074] The genomic position of SNP67 is Chr7: 123816124 bp;
[0075] The genomic position of SNP68 is Chr7: 123816131 bp;
[0076] The genomic position of SNP69 is Chr7: 123816170 bp;
[0077] The genomic position of SNP70 is Chr7: 123817750 bp.
[0078] The physical location of the SNP site was determined based on the whole genome sequence version 4.0 of B73.
[0079] The present invention provides a haplotype molecular marker, the haplotype sequence of the haplotype molecular marker is composed of the genotypes of the SNP molecular marker in sequence, and the haplotype sequence of the haplotype molecular marker is shown in SEQ ID NO.1.
[0080] The haplotype sequence formed by the genotypes of the SNP molecular markers is the sequence shown in SEQ ID NO. 1, indicating that corn has ear rot resistance. Specifically, the haplotype formed by the above SNP molecular markers, in ascending order based on physical position, is: GGCATACGACCAGGTTATAGTCATATAGCCGATGATATTTTGAGGATACATGTGCAAAAACCTATCTGTT (SEQ ID NO. 1), which is a functional genotype for ear rot resistance.
[0081] The invention provides a corn plant with ear rot resistance, wherein the corn plant contains the haploid molecular marker.
[0082] The present invention provides a method for identifying or assisting in identifying resistance of corn plants to ear rot, comprising the following steps:
[0083] 1) obtaining the whole genome sequence of corn plant version 4.0, detecting the genotypes of the SNP molecular markers, and obtaining a haplotype sequence composed of the genotypes in sequence;
[0084] Specifically, the high-density gene chip Maize 50K (50K SNP) can be used to detect the genotype of the SNP molecular marker.
[0085] 2) comparing the haplotype sequence obtained in step 1) with the haplotype sequence of the haplotype molecular marker;
[0086] 3) identifying or assisting in identifying the resistance of corn plants to ear rot based on the comparison results.
[0087] The present invention provides an application of a reagent for detecting the SNP molecular marker and / or the haplotype molecular marker in the cultivation, identification and screening of corn with ear rot resistance.
[0088] Compared with the prior art, the present invention has the following beneficial results:
[0089] The present invention conducts genome-wide association analysis based on SNP site information and ear rot phenotypic data in 484 important corn variety parents, obtains SNP molecular markers significantly associated with corn ear rot, and obtains haplotype molecular markers closely linked to corn ear rot-associated sites through linkage disequilibrium analysis. The present invention uses solid-phase chips to obtain genotypes, which is more cost-effective; using inbred lines of major domestic variety parents as research materials, the relevant genes / sites can be directly used for variety screening and improvement; with the help of genome-wide association analysis, it is more capable of mining micro-effect genes and analyzing the relationship between multiple genetic loci in parallel than linkage mapping; using molecular markers to efficiently and accurately identify corn ear rot-related genotypes, the haplotype molecular markers for ear rot resistance developed by the present invention reveal the genetic variation characteristics of corn ear rot, which can be used for the further development of corn chip functional sites, laying the foundation for cultivating varieties with multiple excellent site aggregations, and providing a new tool for molecular marker-assisted selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0090] Figure 1 These are the Manhattan plot and QQ plot of the genome-wide association analysis of the present invention; A is the Manhattan plot, and B is the QQ plot.
[0091] Figure 2 The present invention is linked to the 69 sites of SNP site ch7_123731550 (R 2 > 0.64).
[0092] Figure 3 This is the result of linkage disequilibrium analysis of SNP molecular markers in the 1 Mb interval upstream and downstream of the present invention.
[0093] Figure 4 The SNP site information and haplotype frequencies of the four haplotype groups of the present invention are shown.
[0094] Figure 5 Figures A and B are the interval distribution diagram H and expression map of genes Zm00001d020586 and Zm00001d020590 of the present invention; A is the interval distribution diagram of genes Zm00001d020586 and Zm00001d020590, and B is the expression map of genes Zm00001d020586 and Zm00001d020590. DETAILED DESCRIPTION
[0095] The following is a technical solution of a SNP molecular marker related to corn ear rot and its application in the present invention, which is further described by specific examples.
[0096] Example 1: Genome-wide association analysis of corn ear rot
[0097] (1) Phenotype acquisition
[0098] In 2024, 484 core inbred lines from various corn-producing regions across China were planted in Fengcheng, Liaoning Province, during the mid-season corn-producing region of East North China. The planting density was 4,500 plants per mu (approximately 15 plants per inbred line), with three biological replicates per row. A completely randomized block design was used. After the plants developed natural disease, the ear rot disease grade of the 1,452 rows of corn inbred lines was assessed. Eight uniformly distributed plants were surveyed per row. The Xianyu 335 parent, PH6WC, was planted every ten rows to correct for inter-plot variability.
[0099] (2) Genotype identification
[0100] Leaves of 484 maize inbred lines were sampled, and DNA was extracted using the alkaline lysis method. The high-density gene chip Maize 50K (50K SNP) was used to identify the genotypes of the 484 inbred lines mentioned above according to the standard Illumina Infinium gene chip detection process, and 35,985 SNP markers covering the entire genome were obtained.
[0101] (3) Correlation analysis
[0102] Using TASSEL 5.0 software, the minimum allele frequency (MAF) was set to 0.05 for quality control. Principal component analysis (PCA) and a kinship matrix were used to obtain covariate data for GWAS analysis. First, a general linear model (GLM) analysis was performed using the PCA results as the population structure. The quantile-quantile plot (QQ plot) showed that the points starting at 0 were consistently above the diagonal, indicating the presence of false positives and suggesting that the GLM model was not suitable. Subsequently, a mixed linear model (population structure + kinship) was used to analyze the association between markers and corn ear rot disease grade: y = Xβ + Qυ + Zμ + ε (where y is the observed phenotypic value, X is the SNP genotype, β is the SNP effect, Q is the population structure matrix, υ is the population structure effect, Z is the kinship matrix, μ is the random effect, and ε is the residual). The QQ plot showed that the points starting at 0 were mostly located on the diagonal line. After the value exceeded 3, the points began to deviate from the straight line and tilt upward, indicating that both false positives and false negatives were well controlled, indicating that the MLM model was suitable.
[0103] The results of the mixed linear model showed that the SNPs at positions 123731550bp and 123816046bp on chromosome 7 of maize were significantly associated with corn ear rot (p-value = 1.87×10 -4 , p-value=1.87×10 -4 ). The Manhattan plot and QQ plot of genome-wide association analysis are as follows Figure 1 As shown in A and B.
[0104] Example 2: Development of haplotype markers for ear rot-associated sites in Example 1
[0105] (1) The SNP genotype information of the 1 Mb region upstream and downstream of the chr7_123731550 locus (including chr7_123816046) of 540 maize inbred lines from the maize association population was downloaded from the Maizego website (http: / / www.maizego.org / ), totaling 2928 SNP variant sites.
[0106] (2) After saving the 2928 SNP gene information from the 540 inbred lines as hapmap format files, the linkage disequilibrium analysis was performed using the TASSEL5 software to calculate the correlation coefficient r with the chr7_123731550 locus. 2 The linkage SNP sites with a value greater than 0.64 (the value is between 0-1, indicating the degree of linkage between two SNP sites, and 1 indicates that the two SNP sites are completely linked), a total of 69 SNP sites closely linked to this site (including chr7_123816046). 69 sites linked to the SNP site ch7_123731550 (R 2 > 0.64) Figure 2 The results of linkage disequilibrium analysis of SNP molecular markers in the 1 Mb interval upstream and downstream are shown in Figure 3 shown.
[0107] (3) The genotypes of the above 70 SNP loci (including SNP_123231550 and SNP_123816046) in 540 inbred lines were extracted and haplotype analysis was performed using Haploview software. Four major haplotypes, Hap1 to Hap4, were obtained. Among them, Hap1 was closely linked to the ear rot resistance genotype (AT) at the corn ear rot associated loci (chr7_123731550, chr7_123816046). Therefore, Hap1 is a haplotype molecular marker associated with corn ear rot resistance. Its haplotype sequence is shown in SEQ ID NO. 1. The SNP locus information and haplotype frequencies of the four haplotypes are shown in Figure 4.
[0108] (4) Based on the reference genome sequence of the inbred line B73, only two genes, Zm00001d020586 and Zm00001d020590, that may be related to ear rot were found in the common region of 100 kb upstream and downstream of these two SNP sites (SNP_123231550 and SNP_123816046). According to the published RNA-seq data, Zm00001d020586 is only expressed in pollen, and Zm00001d020590 is only expressed in pollen. 1d020590 is expressed in the embryo and endosperm. According to gene function annotation, Zm00001d020586 encodes pectin methylesterase, which may be related to plant cell wall modification, and Zm00001d020590 encodes alanine aminotransferase, which is related to amino acid metabolism. The former is not expressed in the grain and may require specific conditions for induction. Pectin polysaccharides, as an important component of the cell wall, affect the cell wall's ability to resist pathogen infection. The former is likely related to ear rot resistance. The interval distribution of genes Zm00001d020586 and Zm00001d020590 is shown in the figure below. Figure 5 As shown in A, the expression patterns of genes Zm00001d020586 and Zm00001d020590 are as shown in Figure 5 As shown in B.
[0109] Example 3: Verification of haplotype molecular markers
[0110] Based on the haplotype molecular marker (Hap1) of Example 2: GGCATACGACCAGGTTATAGTCATATAGCCGATGATATTTTGAGGATACATGTGCAAAAACCTATCTGTT (SEQ ID NO. 1), 484 inbred lines were divided into two groups for t-test. The haplotype grouping results are shown in Table 1. There was a significant difference in the ear rot disease grade between the two inbred lines (p-value = 1.74×10 -3 ), indicating that the haplotype marker is associated with ear rot. The genotype identification of the haplotype marker can be used to judge and improve the ear rot of inbred lines to a certain extent.
[0111] Table 1 Haplotype clustering results
[0112]
[0113] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A method for identifying resistance of corn plants to ear rot, characterized in that: The following steps are involved: 1) Obtain the whole genome sequence of corn plant version 4.0, detect the genotype of SNP molecular markers, and obtain the haplotype sequence composed of the genotypes in sequence; the SNP molecular markers are composed of the following 70 SNP sites composition: The genomic position of SNP1 is Chr7: 123731149 bp; The genomic position of SNP2 is Chr7: 123731235 bp; The genomic position of SNP3 is Chr7: 123731342 bp; The genomic position of SNP4 is Chr7: 123731395 bp; The genomic position of SNP5 is Chr7: 123731412 bp; The genomic position of SNP6 is Chr7: 123731452 bp; The genomic position of SNP7 is Chr7: 123731460 bp; The genomic position of SNP8 is Chr7: 123731486 bp; The genomic position of SNP9 is Chr7: 123731550 bp; The genomic position of SNP10 is Chr7: 123731596 bp; The genomic position of SNP11 is Chr7: 123731615 bp; The genomic position of SNP12 is Chr7: 123731642 bp; The genomic position of SNP13 is Chr7: 123731672 bp; The genomic position of SNP14 is Chr7: 123731770 bp; The genomic position of SNP15 is Chr7: 123731935 bp; The genomic position of SNP16 is Chr7: 123732076 bp; The genomic position of SNP17 is Chr7: 123732131 bp; The genomic position of SNP18 is Chr7: 123732143 bp; The genomic position of SNP19 is Chr7: 123732325 bp; The genomic position of SNP20 is Chr7: 123732377 bp; The genomic position of SNP21 is Chr7: 123732392 bp; The genomic position of SNP22 is Chr7: 123732506 bp; The genomic position of SNP23 is Chr7: 123732521 bp; The genomic position of SNP24 is Chr7: 123732539 bp; The genomic position of SNP25 is Chr7: 123732578 bp; The genomic position of SNP26 is Chr7: 123732608 bp; The genomic position of SNP27 is Chr7: 123732627 bp; The genomic position of SNP28 is Chr7: 123732645 bp; The genomic position of SNP29 is Chr7: 123732655 bp; The genomic position of SNP30 is Chr7: 123732661 bp; The genomic position of SNP31 is Chr7: 123732680 bp; The genomic position of SNP32 is Chr7: 123732694 bp; The genomic position of SNP33 is Chr7: 123732717 bp; The genomic position of SNP34 is Chr7: 123732722 bp; The genomic position of SNP35 is Chr7: 123732725 bp; The genomic position of SNP36 is Chr7: 123732739 bp; The genomic position of SNP37 is Chr7: 123732820 bp; The genomic position of SNP38 is Chr7: 123732828 bp; The genomic position of SNP39 is Chr7: 123732851 bp; The genomic position of SNP40 is Chr7: 123732909 bp; The genomic position of SNP41 is Chr7: 123732976 bp; The genomic position of SNP42 is Chr7: 123733025 bp; The genomic position of SNP43 is Chr7: 123733066 bp; The genomic position of SNP44 is Chr7: 123733071 bp; The genomic position of SNP45 is Chr7: 123733143 bp; The genomic position of SNP46 is Chr7: 123733160 bp; The genomic position of SNP47 is Chr7: 123733217 bp; The genomic position of SNP48 is Chr7: 123733252 bp; The genomic position of SNP49 is Chr7: 123733265 bp; The genomic position of SNP50 is Chr7: 123733336 bp; The genomic position of SNP51 is Chr7: 123733353 bp; The genomic position of SNP52 is Chr7: 123733399 bp; The genomic position of SNP53 is Chr7: 123733446 bp; The genomic position of SNP54 is Chr7: 123733486 bp; The genomic position of SNP55 is Chr7: 123733509 bp; The genomic position of SNP56 is Chr7: 123734379 bp; The genomic position of SNP57 is Chr7: 123779324 bp; The genomic position of SNP58 is Chr7: 123789885 bp; The genomic position of SNP59 is Chr7: 123796772 bp; The genomic position of SNP60 is Chr7: 123802325 bp; The genomic position of SNP61 is Chr7: 123802398 bp; The genomic position of SNP62 is Chr7: 123810722 bp; The genomic position of SNP63 is Chr7: 123816027 bp; The genomic position of SNP64 is Chr7: 123816040 bp; The genomic position of SNP65 is Chr7: 123816046 bp; The genomic position of SNP66 is Chr7: 123816118 bp; The genomic position of SNP67 is Chr7: 123816124 bp; The genomic position of SNP68 is Chr7: 123816131 bp; The genomic position of SNP69 is Chr7: 123816170 bp; The genomic position of SNP70 is Chr7: 123817750 bp; The physical location of the SNP site was determined based on the whole genome sequence version 4.0 of B73; 2) comparing the haplotype sequence obtained in step 1) with the haplotype sequence having ear rot resistance; 3) Identifying the resistance of corn plants to ear rot based on the comparison results; wherein, the haplotype composed of the above SNP molecular markers in ascending order based on physical position is: GGCATACGACCAGGTTATAGTCATATAGCCGATGATATTTTGAGGATACATGTGCAAAAACCTATCTGTT, which is a functional genotype for ear rot resistance.
2. Use of a reagent for detecting SNP molecular markers in the cultivation, identification, and screening of corn with ear rot resistance; the SNP molecular markers are composed of the following 70 SNP sites: The genomic position of SNP1 is Chr7: 123731149 bp; The genomic position of SNP2 is Chr7: 123731235 bp; The genomic position of SNP3 is Chr7: 123731342 bp; The genomic position of SNP4 is Chr7: 123731395 bp; The genomic position of SNP5 is Chr7: 123731412 bp; The genomic position of SNP6 is Chr7: 123731452 bp; The genomic position of SNP7 is Chr7: 123731460 bp; The genomic position of SNP8 is Chr7: 123731486 bp; The genomic position of SNP9 is Chr7: 123731550 bp; The genomic position of SNP10 is Chr7: 123731596 bp; The genomic position of SNP11 is Chr7: 123731615 bp; The genomic position of SNP12 is Chr7: 123731642 bp; The genomic position of SNP13 is Chr7: 123731672 bp; The genomic position of SNP14 is Chr7: 123731770 bp; The genomic position of SNP15 is Chr7: 123731935 bp; The genomic position of SNP16 is Chr7: 123732076 bp; The genomic position of SNP17 is Chr7: 123732131 bp; The genomic position of SNP18 is Chr7: 123732143 bp; The genomic position of SNP19 is Chr7: 123732325 bp; The genomic position of SNP20 is Chr7: 123732377 bp; The genomic position of SNP21 is Chr7: 123732392 bp; The genomic position of SNP22 is Chr7: 123732506 bp; The genomic position of SNP23 is Chr7: 123732521 bp; The genomic position of SNP24 is Chr7: 123732539 bp; The genomic position of SNP25 is Chr7: 123732578 bp; The genomic position of SNP26 is Chr7: 123732608 bp; The genomic position of SNP27 is Chr7: 123732627 bp; The genomic position of SNP28 is Chr7: 123732645 bp; The genomic position of SNP29 is Chr7: 123732655 bp; The genomic position of SNP30 is Chr7: 123732661 bp; The genomic position of SNP31 is Chr7: 123732680 bp; The genomic position of SNP32 is Chr7: 123732694 bp; The genomic position of SNP33 is Chr7: 123732717 bp; The genomic position of SNP34 is Chr7: 123732722 bp; The genomic position of SNP35 is Chr7: 123732725 bp; The genomic position of SNP36 is Chr7: 123732739 bp; The genomic position of SNP37 is Chr7: 123732820 bp; The genomic position of SNP38 is Chr7: 123732828 bp; The genomic position of SNP39 is Chr7: 123732851 bp; The genomic position of SNP40 is Chr7: 123732909 bp; The genomic position of SNP41 is Chr7: 123732976 bp; The genomic position of SNP42 is Chr7: 123733025 bp; The genomic position of SNP43 is Chr7: 123733066 bp; The genomic position of SNP44 is Chr7: 123733071 bp; The genomic position of SNP45 is Chr7: 123733143 bp; The genomic position of SNP46 is Chr7: 123733160 bp; The genomic position of SNP47 is Chr7: 123733217 bp; The genomic position of SNP48 is Chr7: 123733252 bp; The genomic position of SNP49 is Chr7: 123733265 bp; The genomic position of SNP50 is Chr7: 123733336 bp; The genomic position of SNP51 is Chr7: 123733353 bp; The genomic position of SNP52 is Chr7: 123733399 bp; The genomic position of SNP53 is Chr7: 123733446 bp; The genomic position of SNP54 is Chr7: 123733486 bp; The genomic position of SNP55 is Chr7: 123733509 bp; The genomic position of SNP56 is Chr7: 123734379 bp; The genomic position of SNP57 is Chr7: 123779324 bp; The genomic position of SNP58 is Chr7: 123789885 bp; The genomic position of SNP59 is Chr7: 123796772 bp; The genomic position of SNP60 is Chr7: 123802325 bp; The genomic position of SNP61 is Chr7: 123802398 bp; The genomic position of SNP62 is Chr7: 123810722 bp; The genomic position of SNP63 is Chr7: 123816027 bp; The genomic position of SNP64 is Chr7: 123816040 bp; The genomic position of SNP65 is Chr7: 123816046 bp; The genomic position of SNP66 is Chr7: 123816118 bp; The genomic position of SNP67 is Chr7: 123816124 bp; The genomic position of SNP68 is Chr7: 123816131 bp; The genomic position of SNP69 is Chr7: 123816170 bp; The genomic position of SNP70 is Chr7: 123817750 bp; The physical location of the SNP site is determined based on the whole genome sequence version 4.0 of B73; the haplotypes composed of the above SNP molecular markers in ascending order based on physical location are: GGCATACGACCAGGTTATAGTCATATAGCCGATGATATTTTGAGGATACATGTGCAAAAACCTATCTGTT is the functional genotype for ear rot resistance.