Method for producing high levels of squalene

Abstract

Aspects of the present disclosure relate to modified yeast cells capable of producing an increased amount of squalene as compared to unmodified yeast cells, and methods of using the same.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 481,957, filed on January 27, 2023, entitled “METHODS FOR PRODUCING HIGH-LEVEL SQUALENE IN YARROWIA LIPOLYTICA,” the entire disclosure of which is incorporated herein by reference in its entirety. Government licensing rights

[0002] This invention was made with government support from the U.S. Department of Energy under Grant DE-SCOO22016. The government has certain rights in this invention. References to electronic sequence listings

[0003] The contents of the electronic Sequence Listing (M065670542WO00-SEQ-KVC.xml; size: 71,323 bytes; and creation date: January 11, 2024) are incorporated herein by reference in their entirety. Technical Field

[0004] The present disclosure relates to modified yeast cells capable of producing increased amounts of squalene compared to unmodified yeast cells and methods of use thereof. Background Art

[0005] Squalene is a colorless organic triterpenoid with the molecular formula C 30 H5. It is a biochemical precursor of steroids and hopanes. Squalene is also used as a vaccine adjuvant and is present in many commercially available hair and topical skin products. The chemical synthesis of squalene is laborious and time-consuming, and often results in low yields. Summary of the Invention

[0006] The present disclosure relates, at least in part, to modified yeast cells capable of producing increased amounts of squalene compared to unmodified yeast cells and methods of using the same. Squalene is a commercially valuable organic compound originally derived from shark liver oil (Squalus is a genus of shark). Naturally occurring squalene is difficult to obtain, and chemical synthesis of squalene is time-consuming and labor-intensive, often resulting in low yields.

[0007] Thus, aspects of the present disclosure relate to a modified yeast cell comprising: a first set of heterologous polynucleotides encoding a first set of enzymes of the mevalonate pathway, wherein one or more of the first set of enzymes of the mevalonate pathway is linked to a peroxisomal targeting signal; a first heterologous polynucleotide encoding a lipase; and a second set of heterologous polynucleotides encoding a second set of enzymes having triacylglycerol synthesis activity.

[0008] In some embodiments, the modified yeast cell further comprises a third set of heterologous polynucleotides encoding a third set of enzymes having acetyl-CoA synthesis activity.

[0009] In some embodiments, the modified yeast cell further comprises a fourth set of heterologous polynucleotides encoding a fourth set of enzymes having beta-oxidation activity.

[0010] In some embodiments, the first group of enzymes of the mevalonate pathway includes ERG10, ERG13, tHMGR, mvaE, mvaS, ERG12, ERG8, ERG19, IDI, ERG20, ERG9, or any combination thereof.

[0011] In some embodiments, each enzyme in the first group of enzymes of the mevalonate pathway comprises a peroxisomal targeting signal. In some embodiments, ERG20 and ERG9 each comprise a peroxisomal targeting signal. In some embodiments, the peroxisomal targeting signal is located at the C-terminus of one or more of the first group of enzymes of the mevalonate pathway. In some embodiments, the peroxisomal targeting signal is located at the N-terminus of one or more of the first group of enzymes of the mevalonate pathway. In some embodiments, the peroxisomal targeting signal is peroxisomal targeting sequence 1 (PTS1), peroxisomal targeting sequence 2 (PTS2), or peroxisomal targeting sequence 3 (PTS3). In some embodiments, PTS1 is the amino acid sequence serine-lysine-leucine (SKL).

[0012] In some embodiments, the lipase is a triacylglycerol lipase derived from Thermomyces lanuginosus.

[0013] In some embodiments, the second group of enzymes having triacylglycerol synthesis activity includes acetyl-CoA carboxylase (ACC1), diacylglycerol acyltransferase (DGA1), NAD+-dependent G3P dehydrogenase (GPD1), or any combination thereof.

[0014] In some embodiments, the third group of enzymes with acetyl-CoA synthesis activity includes pyruvate carboxylase (PYC1), ATP:citrate lyase (ACL), citrate carrier YHM2, acetyl-CoA synthetase, or any combination thereof. In some embodiments, ACL is derived from Mus musculus. In some embodiments, the acetyl-CoA synthetase is derived from Salmonella enterica. In some embodiments, the acetyl-CoA synthetase comprises an L641P amino acid substitution relative to wild-type acetyl-CoA synthetase.

[0015] In some embodiments, the fourth group of enzymes having beta-oxidation activity includes POX1, POX2, POX3, POX4, POX5, POX6, multifunctional beta-oxidation protein (MFE1), 3-ketoacyl-CoA thiolase (POT1), or any combination thereof.

[0016] In some embodiments, the modified yeast cell is an oleaginous yeast cell. In some embodiments, the oleaginous yeast cell is a Yarrowia cell. In some embodiments, the Yarrowia cell is a Yarrowia lipolytica.

[0017] Aspects of the present disclosure relate to a method of producing squalene, the method comprising culturing any of the modified yeast cells described herein in a culture medium for a sufficient time to produce squalene in peroxisomes of the modified yeast cell.

[0018] In some embodiments, the method further comprises extracting squalene from a modified yeast cell culture. In some embodiments, the culture medium comprises yeast extract, peptone, glucose, and an aqueous buffer. In some embodiments, the culture medium comprises acetate. In some embodiments, the culture medium comprises acetate and a limited amount of one or more sugars. In some embodiments, the one or more sugars comprise glucose, fructose, and / or xylose. In some embodiments, the culture medium comprises a buffer, optionally wherein the buffer is phosphate buffered saline.

[0019] In some embodiments, the sufficient time is at least 6 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 192 hours.

[0020] In some embodiments, at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L, or more than 1.5 g / L of squalene is in the culture medium. In some embodiments, at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L, or more than 1.5 g / L of squalene is extracted from the modified yeast cell culture. In some embodiments, at least 25 mg / g dry cell weight (DCW), at least 50 mg / g DCW, at least 100 mg / g DCW, at least 150 mg / g DCW, or more than 150 mg / g DCW of squalene is extracted from the modified yeast cell culture.

[0021] Furthermore, this summary introduces selected concepts in a simplified form that are further described in the detailed description below. This summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to limit the scope thereof.

[0022] One aspect disclosed herein is a method for producing squalene in yeast, the method comprising a. Provide oleaginous yeast; b. introducing modifications in oleaginous yeast to increase squalene production, wherein the modifications comprise i. introducing genes encoding the mevalonate pathway and its downstream squalene synthesis pathway into the peroxisomes of yeast; ii. introducing a gene encoding a heterologous lipase (tlTGF) from Thermomyces lanuginosus; and iii. Overexpression of genes encoding enzymes responsible for triacylglycerol synthesis; c. growing the modified yeast in a medium with a carbon source; d. Harvesting squalene from peroxisomes of modified yeast.

[0023] In one embodiment of the disclosed method, the modification introduced into the oleaginous yeast further comprises i. Upregulation of the ATP:citrate lyase (ACL)-based cytosolic acetyl-CoA formation pathway, and ii. Overexpression of pyruvate carboxylase PYC1, MmACL from Mus musculus, and mitochondrial vector YHM2.

[0024] In one embodiment of the disclosed method, the oleaginous yeast is Yarrowia lipolytic.

[0025] In one embodiment of the disclosed method, the culture medium comprises yeast extract, peptone, glucose, and an aqueous buffer.

[0026] In one embodiment of the disclosed method, the culture medium comprises acetate.

[0027] In one embodiment of the disclosed method, squalene production exceeds 0.5 g / L, exceeds 1.0 g / L, or exceeds 1.5 g / L.

[0028] In one embodiment of the disclosed method, squalene production is greater than 50 mg / g DCW, greater than 100 mg / g DCW, or greater than 150 mg / g DCW.

[0029] In one embodiment of the disclosed method, squalene production exceeds 0.5 g / L, exceeds 1.0 g / L, or exceeds 1.5 g / L.

[0030] In one embodiment of the disclosed method, squalene production is greater than 50 mg / g DCW, greater than 100 mg / g DCW, or greater than 150 mg / g DCW.

[0031] In one embodiment of the disclosed method, growing the modified yeast in a culture medium with a carbon source comprises culturing the cells for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 192 hours.

[0032] One aspect of the present disclosure is an oleaginous yeast modified by: a. Introducing genes encoding the mevalonate pathway and its downstream squalene synthesis pathway into yeast peroxisomes; b. introducing a gene encoding a heterologous lipase (tlTGF) from Thermomyces lanuginosus; and c. Overexpression of genes encoding enzymes responsible for triacylglycerol synthesis.

[0033] In one embodiment, the disclosed oleaginous yeast is further modified by: a. Upregulation of the ATP:citrate lyase (ACL)-based cytosolic acetyl-CoA formation pathway, and b. Overexpression of pyruvate carboxylase PYC1, MmACL from Mus musculus, and mitochondrial vector YHM2.

[0034] In one embodiment of the disclosed oleaginous yeast, the yeast is Yarrowia lipolytica.

[0035] The following detailed description refers to the accompanying drawings which form a part hereof, and which show by way of illustration specific example implementations. Other implementations may be made without departing from the scope of the present disclosure.

[0036] Each limitation of the present invention can encompass various embodiments of the present invention. Therefore, it is contemplated that each limitation of the present invention relating to any one element or combination of elements can be included in various aspects of the present invention. The application of the present disclosure is not limited to the details of the construction and component arrangement set forth in the following description or shown in the accompanying drawings. The present invention can adopt other embodiments and can be practiced or implemented in various ways. In addition, the words and terms used in this application are for descriptive purposes only and should not be considered as restrictive. The use of "including", "comprising" or "having", "containing", "involving" and their variations is intended to cover the items listed thereafter and their equivalents as well as other items. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The following drawings form part of this specification and are included to further demonstrate certain aspects of the present disclosure, which may be better understood by referring to one or more drawings in combination with the detailed description of specific embodiments presented herein. The drawings are not intended to be drawn to scale. The drawings are merely illustrative and are not required for the practice of the present disclosure. For clarity, not every component may be labeled in every drawing. In the drawings:

[0038] Figures 1A-1E An engineered cytosolic metabolic pathway is shown for the production of squalene. Figure 1A A schematic diagram of the metabolic pathway for squalene production in the cytosol is shown. The squalene biosynthetic pathway begins with acetyl-CoA and is divided into three modules: the ascending pathway, the midstream pathway, and the descending pathway. ERG10, acetyl-CoA acetyltransferase. ERG13, 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthetase. tHMGR, truncated HMG-CoA reductase. ERG12, mevalonate kinase. ERG8, phosphomevalonate kinase. ERG19, mevalonate pyrophosphate decarboxylase. IDI, IPP:DMAPP isomerase. ERG20, farnesyl pyrophosphate synthase. ERG1, squalene synthase. MvaE and MvaS, from Enterococcus faecalis. IPP, isopentenyl diphosphate. DMAPP, dimethylallyl diphosphate. FPP, farnesyl pyrophosphate. ( Figure 1B ) shows the overexpression of each module alone and in combination in Y. lipolytic. Squalene titer was measured after 48 hours of fermentation. ( Figure 1C and 1D ) shows that when YPD medium was supplemented with 0.2 M PBS, the squalene titer ( Figure 1C ) and content ( Figure 1D ) was significantly enhanced. In the medium without PBS, the samples were measured at 48 hours of culture, while in the medium containing PBS, the samples were measured at 72 hours of culture. ( Figure 1E ) shows the fermentation time course curve, which shows that the fermentation with PBS added reached the highest squalene titer at 72 hours of culture, while in the fermentation without PBS conditioning, the highest squalene titer was reached at 48 hours of culture. Statistical significance was tested using a two-sided Student's t-test, *P<0.05, **P<0.01, ***P<0.001. All data are expressed as the mean ± SD of three biologically independent experiments.

[0039] Figures 2A-2C Shows the construction of the peroxisomal squalene synthesis pathway in Yarrowia lipolytica. Figure 2AA schematic diagram of the peroxisomal orthogonal metabolic network for squalene production is shown. Conventional squalene production in Yarrowia lipolytica relies on the endogenous cytosolic MVA pathway (shown in black), which is closely linked to sterol synthesis. Here, an orthogonal pathway for squalene synthesis in the peroxisome was constructed by introducing a complete squalene pathway starting from acetyl-CoA (shown in black), in which the MVA pathway was assembled to harvest peroxisomal acetyl-CoA. Figure 2B The complete squalene pathway is shown to be sequentially assembled in peroxisomes or overexpressed in the cytosol. Squalene titers were measured after 72 hours of fermentation. Figure 2C Shown are time course curves of squalene content and glucose concentration in the culture medium of strain Sq06, which has a cytosolic overexpression pathway, and strain Sq10, which has a peroxisomal engineered pathway. Statistical significance was tested using a two-sided Student's t-test, ***P < 0.001. ns, not significant. All data are expressed as the mean ± SD of three biologically independent experiments.

[0040] Figures 3A-3D Conversion of cellular TAG to squalene synthesis via lipid metabolism is shown. Figure 3A A schematic diagram of intracellular lipid metabolism, including biosynthesis, hydrolysis, and degradation, is shown. Genes overexpressed in this study are shown in black. PYC1, pyruvate carboxylase. YHM2, mitochondrial citrate carrier. MmACL, ATP:citrate lyase from Mus musculus. ACC1, acetyl-CoA carboxylase. GPD1, NAD + G3P-dependent dehydrogenase. DGA1, diacylglycerol acyltransferase. tlTGL, lipase from Thermomyces lanuginosus. POX1-6, acyl-CoA oxidase. MFE1, multifunctional β-oxidation protein. POT1, 3-ketoacyl-CoA thiolase. PEX10, peroxisome biogenesis factor. Figure 3B It was shown that enhancing lipid biosynthesis and its hydrolysis by overexpressing the corresponding rate-limiting enzymes could potentially improve squalene production in peroxisomes. Figure 3C showed that enhancing the β-oxidation pathway into peroxisomal acetyl-CoA formation further enhanced squalene production. Figure 3D The fermentation profile of squalene-producing strain Sq27 in a 3-L bioreactor is shown. Statistical significance was tested using a two-sided Student's t-test, **P < 0.01, ***P < 0.001. ns, not significant. All data are presented as the mean ± SD of three biologically independent experiments.

[0041] Figures 4A-4IEstablishment of an acetate utilization pathway in peroxisomes for enhanced acetyl-CoA supply is shown. Figure 4A A schematic diagram of the metabolic network based on acetate uptake is shown. The asterisked arrow indicates the orthogonal squalene biosynthesis pathway, which originates from acetate in the peroxisome. The gray arrow indicates that the small amount of glucose supplemented in the substrate co-feeding system primarily supports cell growth. SeACS, acetyl-CoA synthetase from Salmonella enterica. Figure 4B Shown are squalene production curves when strain Sq10 was grown in YPD or YPA medium with or without PBS. Figure 4C and 4D It is shown that a reduced biomass was observed when strain Sq10 was cultured in YPA medium compared to that in YPD medium ( Figure 4C ), while the squalene content in YPA and YPD media was the same ( Figure 4D ). Figure 4E and 4F showed that the introduction of SeACS into peroxisomes L641P ), constituted an orthogonal acetate utilization pathway in strain Sq28, which resulted in a decrease in squalene production titer ( Figure 4E ) and cell content ( Figure 4F ) have been significantly improved. Figure 4G Supplementation of acetic acid as a carbon source in both salt and acid form in acetate fermentation in a bioreactor is shown. Since glucose batch feeding inhibits acetate consumption, glucose is continuously fed in small amounts to the acetate culture in a co-feed system. Figure 4H and 4I It was shown that the squalene-producing strain Sq28 was cultured with acetate only ( Figure 4H ) and glucose-acetate mixed co-feed culture ( Figure 4I ). Statistical significance was tested using a two-sided Student's t-test, ***P < 0.001. ns, not significant. All data are presented as mean ± SD of three biologically independent experiments.

[0042] Figure 5 Disruption of LYS5 in the Y. lipolytica po1f strain via Crispr-Cas9 is shown. A single thymidine insertion (triangle) causes a frameshift mutation (asterisk) that abolishes LYS5 activity.

[0043] Figure 6 Shown is an overview of pH changes over the course of fermentation in YPD medium with or without PBS for growing strain Sq06. All data are presented as mean ± SD of three biologically independent experiments.

[0044] Figure 7 Comparison of biomass of strain Sq03 overexpressing ERG20 and ERG9 in the cytoplasm and strain Sq07 overexpressing ERG20 and ERG9 in the peroxisome after 3 days of fermentation is shown. All data are presented as mean ± SD of three biologically independent experiments.

[0045] Figure 8 Squalene production by an engineered strain overexpressing endogenous lipase is shown. Squalene titers were measured after 72 hours of fermentation. All data are presented as mean ± SD of three biologically independent experiments.

[0046] Figure 9 The intracellular lipid production of the engineered strains is shown. The engineered lipid biosynthesis pathway and optimized cytoplasmic acetyl-CoA flux significantly improved intracellular lipid production. Statistical significance was tested using a two-sided Student's t-test, ***P<0.001. All data are expressed as mean ± SD of three biologically independent experiments.

[0047] Figures 10A-10B The results show that cytoplasmic engineered squalene production after optimizing the lipid pathway. In the cytoplasmic engineered squalene production strain Sq06, when three key enzymes involved in lipid biosynthesis, ACC1, DGA1 and GPD1, were overexpressed, although higher intracellular lipid levels were observed ( Figure 10B ), but squalene production decreased ( Figure 10A Statistical significance was tested using a two-sided Student's t-test, ***P<0.001. All data are presented as the mean ± SD of three biologically independent experiments.

[0048] Figures 11A-11B Fine-tuning of NADPH generation for squalene production was shown. When G6PD and 6PGD were overexpressed in engineered strains, squalene ( Figure 11A ) and intracellular lipids ( Figure 11B Statistical significance was tested using a two-sided Student's t-test. ns, not significant. All data are presented as the mean ± SD of three biologically independent experiments.

[0049] Figure 12 Comparison of citric acid levels when PYC1 is overexpressed in engineered strains is shown. Citric acid production was measured after 48 hours of culture. All data are presented as the mean ± SD of three biologically independent experiments.

[0050] Figures 13A-13B Squalene production in engineered strains with enhanced β-oxidation pathways was shown. Further overexpression of POX2, MFE1, POT1, and PEX10 in strain Sq28, which has an orthogonal acetate utilization pathway in peroxisomes, resulted in slightly improved squalene production, regardless of titer ( Figure 13A ) and content ( Figure 13B ) How. Statistical significance was tested using a two-sided Student's t-test, *P < 0.05, ns, not significant. All data are expressed as the mean ± SD of three biologically independent experiments. DETAILED DESCRIPTION

[0051] Engineering microorganisms to produce high-value compounds from renewable feedstocks is a promising alternative to traditional plant- or fossil-based production (1-4). However, synthetic biology efforts to achieve economically viable titers and productivity are often hampered by naturally occurring competing pathways and metabolic crosstalk (3). This is because metabolic networks in the host have evolved to be tightly regulated to maintain metabolic homeostasis, which often makes redirecting metabolic flux to the pathway of interest challenging (5). Although blocking competing pathways by inactivating competing genes (6) or utilizing inducible (7,8) and weakened promoters (9) is a common strategy, this remains challenging when the biosynthetic pathway of interest competes with endogenous pathways essential for cell growth, prompting efforts to develop more efficient methods to funnel metabolic flux toward the target product. An alternative solution to overcome this obstacle is to make the pathway of interest less connected to naturally occurring competing metabolism, which ideally must be orthogonal to the host metabolic network (10,11). Reprogramming cellular metabolism and establishing orthogonal pathways will facilitate improved pathway control and performance.

[0052] A typical case where the establishment of orthogonal metabolic pathways would be beneficial is the synthesis of triterpenes in yeast, whose precursors are closely linked to the sterol biosynthesis pathway. Triterpenes are one of the largest and most structurally diverse families of natural products, and many have been shown to have potential uses in the food industry, cosmetics, and pharmacology (12,13). Among them, squalene is a linear triterpenoid oil that is widely used in the pharmaceutical, health, and cosmetic industries as a dietary supplement, moisturizer, and antitumor agent (14). In particular, squalene has been used as an important component of nanoemulsion vaccine adjuvants in seasonal influenza and COVID-19 vaccines (15). In addition, squalene serves as a key precursor for the synthesis of all structurally complex triterpenes and sterols found in nature (16). Currently, its commercial production mainly comes from shark liver oil and plant seeds (17). Due to the large and rapidly growing global market, obtaining this molecule from natural sources is no longer sustainable, and alternatives for low-cost and sustainable squalene production are urgently needed. Previously, manipulation of central carbon metabolism and the MVA pathway, downregulation of competing pathways and cofactor regeneration, has achieved overproduction of squalene and increased productivity in many microbial strains, such as Saccharomyces cerevisiae (9, 18-21), Escherichia coli (22-24), Yarrowia lipolytica (25, 26), and other microorganisms (14). However, both production titers and yields need to be further enhanced to achieve economically viable industrial-scale production, with properly preventing squalene from being diverted from competing pathways being a major challenge.

[0053] Squalene is a linear triterpene oil widely distributed in plants, fungi, animals, and humans, and serves as a key precursor for the biosynthesis of various triterpenes and steroids. In recent years, it has found applications in medicine, health supplements, and personal care. Squalene is an important component of nanoemulsion vaccine adjuvants and can stimulate and enhance immune responses to antigens. Its most notable application is the well-known MF59 adjuvant, which contains 2.5% (v / v) squalene, 0.25% (w / v) Tween-80, and 0.25% (w / v) Span-85 and is widely used in seasonal influenza, malaria, and Covid-19 vaccines. Squalene was first characterized in 1916 as an extract from shark liver oil, and for decades, the main natural source of squalene was deep-sea shark liver. Due to overfishing and increasing marine pollution, shark-derived squalene is an unfavorable or unsustainable source for commercial applications. Plant seed oils are an alternative source of squalene, however due to the inherent low squalene content and inherently complex chemical mixtures in plant extracts, they are not an environmentally acceptable or economical method of producing high purity squalene.

[0054] Various applications of synthetic squalene produced by cultivation of microorganisms engineered specifically for squalene production have been evaluated and found to be equally effective and safe vaccine adjuvants as animal- and plant-derived squalene. These positive results have encouraged efforts to develop microbial production platforms via synthetic biology to replace traditional squalene production from shark liver oil and seeds. Although several microorganisms have been genetically engineered to overproduce squalene, the production titers and yields of these methods are very low and are uneconomical for industrial-scale production. One reason is that the squalene synthesis pathway competes with other pathways (such as sterol synthesis) that are crucial for cell growth for intracellular intermediates. Therefore, in yeast, squalene synthesis in the cytoplasm is closely linked to the natural sterol biosynthetic pathway, which is crucial for cell growth. Due to this competition for sterol synthesis, engineering yeast that is too conducive to squalene synthesis is quite challenging because it can lead to reduced sterol synthesis and impaired growth. This makes it very difficult to construct robust strains with high squalene productivity.

[0055] In order to overcome the limitation of squalene productivity in yeast, a complete squalene synthesis pathway (mevalonate pathway and its downstream squalene synthesis pathway) was introduced into the peroxisome of Yarrowia lipolytica. Peroxisome is an intracellular compartment that generates an acetyl-CoA pool via fatty acid degradation. This pool can be harvested by the peroxisomal orthogonal squalene synthesis pathway and can also serve as the storage compartment for squalene accumulation. The peroxisomal orthogonal pathway effectively isolates the locally formed squalene from the competitive cytoplasmic pathway, thereby avoiding the complex regulatory mechanism in the cytoplasm. This strategy results in significantly improved squalene production.

[0056] It has also been found that the insufficient supply of precursor acetyl-CoA in peroxisomes limits the production of squalene. Yarrowia lipolytica (Y.lipolytica) is an oleaginous yeast that is easily domesticated on the gene, and it can naturally accumulate a large amount of intracellular lipids. In order to overcome the acetyl-CoA restriction, the second part of this strategy includes utilizing the lipid accumulated in Yarrowia lipolytica (Y.lipolytica) for conversion into peroxisomal acetyl-CoA. For this reason, the heterologous lipase tlTGL from Thermomyces lanuginosu (Thermomyces lanuginosu) was introduced, and the tlTGL specific targeting liposomes was used. This lipase mediates the hydrolysis of triacylglycerol (TAG) into free fatty acids, which are further degraded into acetyl-CoA via the β-oxidation pathway in peroxisomes. Therefore, the expression of tlTGL has accelerated lipid metabolism, and has significantly improved squalene production by increasing the supply of acetyl-CoA.

[0057] To further improve the substrate availability for squalene synthesis in peroxisomes, key enzymes responsible for TAG synthesis, including acetyl-CoA carboxylase (ACC1), diacylglycerol acyltransferase (DGA1), and NAD + The cytosolic acetyl-CoA synthesis pathway was upregulated by upregulating the ATP:citrate lyase (ACL)-based cytosolic acetyl-CoA formation pathway and overexpressing the pyruvate carboxylase PYC1, MmACL from Mus musculus, and the mitochondrial carrier YHM2 (which has been proposed to play an important role in lipid accumulation in oleaginous yeast). These manipulations further enhanced lipid production and its conversion to squalene. Finally, the β-oxidation pathway was enhanced by overexpressing acyl-CoA oxidase (POX), multifunctional β-oxidation protein (MFE1), and 3-ketoacyl-CoA thiolase (POT1). Upregulation of the β-oxidation pathway accelerated fatty acid degradation, releasing more acetyl-CoA for enhanced squalene production in peroxisomes.

[0058] The combined effect of these gene manipulations is that the peroxisomal orthogonal pathway is favorably redirected toward squalene accumulation without negatively impacting cytosolic sterol biosynthesis, thereby maintaining robust cell viability. Ultimately, a strain capable of producing 26.3 g / L of squalene at a productivity of 0.144 g / L / h in bioreactor fermentation was established, which is the highest yield reported for microbial fermentation.

[0059] In summary, disclosed herein are metabolic modulations for squalene superproduction by: • Introduction of a complete pathway for squalene synthesis in the peroxisomes of Yarrowia lipolytica (including the mevalonate pathway and its downstream squalene synthesis pathway). • A heterologous lipase, tlTGL, from Thermomyces lanuginosus, was introduced into liposomes to mediate the hydrolysis of TAG to free fatty acids and increase acetyl-CoA via β-oxidation in peroxisomes. Overexpression of key enzymes responsible for TAG synthesis, including acetyl-CoA carboxylase (ACC1), diacylglycerol acyltransferase (DGA1), and NAD + Dependent G3P dehydrogenase (GPD1). Enhancement of the cytosolic acetyl-CoA synthesis pathway by upregulating the ATP:citrate lyase (ACL)-based cytosolic acetyl-CoA formation pathway and overexpression of the pyruvate carboxylase PYC1, MmACL from Mus musculus, and the mitochondrial transporter YHM2. These modulations further enhanced lipid production and its conversion to squalene. Overexpression of acyl-CoA oxidase (POX), multifunctional β-oxidation protein 1 (MFE1), and 3-ketoacyl-CoA thiolase (POT1) to enhance the β-oxidation pathway.

[0060] In this work, the orthogonal metabolic network in the oil-producing yeast Yarrowia lipolytica (Y.lipolytica) was used for squalene overproduction, and the possibility of metabolic competition in triterpene synthesis was systematically explored to reprogram the peroxisome. It was also demonstrated that the precursor supply in the peroxisome was effectively enhanced for two independent strategies for triterpene production. In yeast, squalene synthesis in the cytoplasm is closely connected with the sterol biosynthetic pathway necessary for cell growth and viability. This strong metabolic crosstalk has caused a major challenge in building a high-productivity squalene robust strain. In order to solve this problem, by introducing the complete squalene synthesis pathway starting from acetyl-CoA, an orthogonal pathway in the peroxisome was constructed, in which the mesohydroxyvalerate (MVA) pathway was assembled to collect the peroxisomal acetyl-CoA pool. The peroxisomal pathway effectively isolates the locally formed squalene from the cytoplasmic competitive pathway and avoids the complex regulatory mechanism present in the cytoplasm, which in turn leads to significantly improved squalene production. However, the insufficient supply of precursor acetyl-CoA in the peroxisome is observed to be a bottleneck for peroxisome production. In view of this, the first strategy is to convert the accumulated intracellular lipids into the peroxisomal acetyl-CoA pool by engineering lipid metabolism involved in biosynthesis, hydrolysis and degradation. Ultimately, the strategy constructed a peroxisomal production strain that was able to produce 32.8g / L squalene with a productivity of 0.15g / L / h in bioreactor fermentation from glucose as a carbon source. Alternatively, in the second strategy, similar squalene production was obtained by establishing an orthogonal acetyl-CoA shortcut in the peroxisome by controlling the acetate utilization pathway. Ultimately, the strategy produced squalene from the peroxisome to 31.6g / L via a substrate co-feeding method from acetate as the main carbon source, with a bioreactor fermentation productivity of 0.14g / L / h. In short, this discovery provides an effective method for the peroxisomal production of acetyl-CoA derived chemicals.

[0061] Engineering microorganisms to produce valuable chemicals often requires intermediates and / or precursors that compete with endogenous metabolic networks to redirect high flux to the product of interest. This is challenging because millions of years of evolution have developed tightly regulated metabolic systems for optimal growth in the organism's natural environment (46). Therefore, it is imperative to develop methods that allow us to prevent metabolic precursors or intermediates from entering competing pathways and to funnel carbon flux to the product of interest. Although blocking or downregulating competing pathways by deleting or attenuating the corresponding genes is a common strategy, disrupting host metabolic fluxes that are critical for cell viability remains challenging.

[0062] Ideally, if the goal is to avoid competition with the native metabolism of the chassis and not to affect cell growth and viability, the heterologous pathway must be orthogonal to the host pathway (10). In this study, Y. lipolytica was chosen as a microbial host to explore the possibility of establishing an orthogonal metabolic network in the peroxisome for the production of squalene, a representative of triterpenes. The peroxisomal orthogonal pathway allows for many times higher production of squalene than the cytosolic pathway, where squalene accumulation is affected by a strong sterol competing pathway. The higher productivity of squalene accumulation in peroxisomes suggests that peroxisomes act as a barrier, effectively isolating locally formed squalene from the cytosolic competing pathway. This in turn transforms the peroxisome into a microfactory for squalene accumulation, where there is less interference with cellular metabolism for growth. Although peroxisome engineering strategies have been widely used in the traditional model yeast S. cerevisiae for monoterpene production (28), their full potential for terpene biosynthesis (especially triterpenes) in the oleaginous yeast Yarrowia lipolytica has not yet been fully explored. On the other hand, due to the very low intracellular lipid levels in S. cerevisiae, the production of acetyl-CoA in peroxisomes for terpene synthesis is extremely limited. In contrast, the oleaginous yeast Y. lipolytica is a natural lipid producer and may provide a relatively higher acetyl-CoA pool for peroxisome production. This advantage will make Y. lipolytica an alternative host for peroxisome engineering production.

[0063] However, the supply of acetyl-CoA in peroxisomes is observed to be a bottleneck for further production of peroxisomes. Considering the cellular lipid accumulation capacity of Yarrowia lipolytica (Y.lipolytica), insufficient supply of acetyl-CoA can be overcome by promoting lipid degradation. Although the liposomes in Yarrowia lipolytica (Y.lipolytica) are generally used as storage compartments for the sequestration of lipophilic compounds and are generally engineered for chemical elevation (36), the enhanced lipid supply is at the expense of acetyl-CoA, thereby limiting the flux into MVA and product formation pathways. In contrast to this traditional method, in the present disclosure, peroxisomes are advantageously reused as sites for the synthesis of squalene, while serving as dynamic warehouses for the storage of locally formed squalene. This design avoids the concern about how to balance the flux distribution between terpenoids and lipid synthesis. By re-converting the accumulated lipids, a larger proportion of the acetyl-CoA pool in the peroxisomes can be supplied for squalene production, and carbon utilization efficiency is greatly improved, resulting in higher titers and per cell content. Interestingly, the conversion of cytosolic acetyl-CoA pool to peroxisomal acetyl-CoA pool is achieved through lipid metabolism (biosynthesis, hydrolysis and degradation).

[0064] In the second approach, an acetyl-CoA shortcut is constructed in the peroxisome via the acetate utilization pathway, greatly simplifying the precursor supply in the host metabolism and avoiding negative feedback regulation. Specifically, the introduction of this precursor supply pathway is connected to the peroxisomal squalene pathway, which is completely unrelated to the natural metabolic network, thereby avoiding competition and metabolic crosstalk. Although acetate-only fermentation exhibits suboptimal cell growth, a substrate co-feeding strategy with a small amount of continuous glucose doping effectively addresses this limitation, providing a solution for overcoming undesirable substrate preferences. More details on the substrate co-feeding strategy are provided in WO 2019 / 006301 (PCT / US2018 / 040290) (the entire contents of which are incorporated herein by reference in their entirety). On the other hand, the efficient conversion of acetate to squalene in this study demonstrates the potential of acetic acid as an alternative low-cost raw material to be biologically upgraded to a variety of value-added chemicals. Acetic acid can be generated from biological CO2 fixation, lignocellulosic biomass degradation, and industrial wastewater digestion (47). Therefore, using acetic acid as a carbon source to produce biofuels and green chemicals will help achieve net-zero greenhouse gas emissions. In conclusion, these findings provide an effective method for biotechnological production of high-value terpenes. Modified yeast cells

[0065] Aspects of the present disclosure relate to modified yeast cells. In some embodiments, the modified yeast cells are oleaginous cells. In some embodiments, the oleaginous cells are oleaginous yeast cells that utilize acetate for cell growth and product synthesis. For example, in some embodiments, the oleaginous yeast cells are Yarrowia lipolytica cells. Yarrowia lipolytica is a non-pathogenic oleaginous yeast that can utilize a variety of carbon sources, including organic acids, hydrocarbons, and various fats and oils. The term "oleaginous" refers to a microorganism that can accumulate more than 20% of its dry cell weight as lipids (see C. Ratledge et al., Microbial routes to lipids. Biochem Soc Trans. December 1989; 17(6): 1139-41). Exemplary oleaginous cells include yeasts such as Yarrowia lipolytica, Candida 107, Rhodotorula glutinis, Rhodosporidium toruloides, Cryptococcus curvatus, Trichosporon pullulan, Lipomyces lipofer, Schwanniomyces occidentalis, and other species from Yarrowia, Lipomyces, Rhodosporidium, and Cryptococcus; oleaginous bacteria such as Rhodococcus, Acinetobacter, and Streptomyces; and oleaginous algae and microalgae.

[0066] Aspects of the present disclosure relate to modified yeast cells that are capable of producing increased titers of squalene compared to unmodified yeast cells. Squalene is an organic triterpene having the molecular formula C 30 H 50 Squalene is a colorless oil originally extracted from shark liver oil. The name "squalene" comes from Squalus, a genus of shark. Squalene is used commercially as a vaccine adjuvant and as an ingredient in hair and topical skin products.

[0067] Squalene is a product of the mevalonate pathway. Acetyl-CoA enters the mevalonate pathway, where it is converted to acetoacetyl-CoA by acetoacetyl-CoA thiolase (e.g., ERG10). Acetoacetyl-CoA is converted to HMG-CoA by 3-hydroxy-3-methylglutaryl-CoA synthetase (e.g., ERG13), which is then converted to mevalonate by 3-hydroxy-3-methylglutaryl-CoA reductase (e.g., HMGR). Mevalonate is converted to mevalonate-5-phosphate by mevalonate kinase (e.g., ERG12), and mevalonate-5-phosphate is converted to mevalonate pyrophosphate by phosphomevalonate kinase (e.g., ERG8). Mevalonate pyrophosphate is converted to isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) by isopentenyl-diphosphate delta isomerase (e.g., IDI). IPP and DMAPP are the end products of the mevalonate pathway. In the biosynthesis of squalene, IPP and DMAPP are condensed to form geranyl pyrophosphate (GPP) by geranyl pyrophosphate synthase (e.g., ERG20). GPP is subsequently converted into farnesyl pyrophosphate (FPP) by farnesyl pyrophosphate synthase (e.g., ERG20). Finally, FPP is converted into squalene by squalene synthase (e.g., ERG9). As known in the art, ERG10, ERG13, tHMGR, mvaE, mvaS, ERG12, ERG8, ERG19, IDI, ERG20, and ERG9 are the nomenclatures for the enzymes of the mevalonate pathway unique to yeast. The mevalonate pathway can be divided into two pathways: the upstream mevalonate pathway and the downstream mevalonate pathway. The upstream mevalonate pathway includes converting two acetyl-CoA molecules into acetoacetyl-CoA by reducing HMG-CoA to mevalonate. The downstream mevalonate pathway includes converting mevalonate into IPP and DMAPP.

[0068] The present disclosure relates, at least in part, to the production of modified yeast cells comprising heterologous polynucleotides encoding enzymes capable of producing squalene from acetyl-CoA. In some embodiments, the modified yeast cells comprise a first set of heterologous polynucleotides encoding a first set of enzymes of the mevalonate pathway. In some embodiments, the first set of enzymes of the mevalonate pathway comprises ERG10, ERG13, tHMGR, mvaE, mvaS, ERG12, ERG8, ERG19, IDI, ERG20, ERG9, or any combination thereof.

[0069] In some embodiments, squalene production is improved by increasing the production of triacylglycerols. In some embodiments, the modified yeast cell comprises a heterologous polynucleotide encoding a lipase. In some embodiments, the lipase is a triacylglycerol lipase derived from Thermomyces lanuginosus. In some embodiments, the modified yeast cell comprises a second group of heterologous polynucleotides encoding a second group of enzymes with triacylglycerol synthesis activity. In some embodiments, the second group of enzymes with triacylglycerol synthesis activity includes acetyl-CoA carboxylase (ACC1), diacylglycerol acyltransferase (DGA1), NAD+-dependent G3P dehydrogenase (GPD1) or any combination thereof. In some embodiments, triacylglycerol is produced from acetyl-CoA through the activity of ACC1, GPD1 and DGA1.

[0070] As described herein, the present disclosure relates to producing squalene from acetyl-CoA. Thus, the present disclosure relates, at least in part, to increasing the amount of acetyl-CoA available in modified yeast cells. In some embodiments, the modified yeast cells comprise a third set of heterologous polynucleotides encoding a third set of enzymes having acetyl-CoA synthesis activity. In some embodiments, the third set of enzymes having acetyl-CoA synthesis activity comprises pyruvate carboxylase (PYC1), ATP:citrate lyase (ACL), citrate carrier YHM2, acetyl-CoA synthetase, or any combination thereof. In some embodiments, ACL is from or derived from Mus musculus. In some embodiments, the acetyl-CoA synthetase is from or derived from Salmonella enterica. In some embodiments, the acetyl-CoA synthetase comprises an L641P amino acid substitution mutation relative to wild-type acetyl-CoA synthetase.

[0071] Acetyl-CoA production can also be increased by increasing beta-oxidation activity in the modified yeast cell. In some embodiments, the modified yeast cell comprises a fourth group of heterologous polynucleotides encoding a fourth group of enzymes having beta-oxidation activity. In some embodiments, the fourth group of enzymes having beta-oxidation activity comprises POX1, POX2, POX3, POX4, POX5, POX6, multifunctional beta-oxidation protein (MFE1), 3-ketoacyl-CoA thiolase (POT1), or any combination thereof. Peroxisome targeting signal

[0072] Aspects of the present disclosure relate, at least in part, to the surprising discovery that sequestering enzymes of the mevalonate pathway in the peroxisomes of modified yeast cells improves squalene production. Therefore, the inventors of the present disclosure exploited this discovery to label one or more enzymes of the mevalonate pathway with a peroxisomal targeting signal. A peroxisomal targeting signal (PTS) is an amino acid sequence that is recognized and bound by peroxisomal receptors. In nature, the PTS is a region of peroxisomal proteins responsible for ensuring their localization to peroxisomes. All peroxisomal proteins are synthesized in the cytoplasm and must be directed to peroxisomes. Peroxisomes consist of a matrix surrounded by a specialized membrane. Receptors within this membrane bind to the peroxisomal targeting signal and initiate transport of the labeled protein to the peroxisome. In most cases, the peroxisomal targeting signal is a short sequence located at the carboxyl-terminus of a protein, typically three amino acids in length. This short sequence serves as the PTS. Its prototype sequence is serine-lysine-leucine (-SKL). This motif and its variants are called PTS1, and the PTS1 receptor is encoded by the PEX5 gene. A peroxisome targeting signal can also be found at the N-terminus (PTS2), which is recognized by a protein complex consisting of the receptor PEX7 and its coreceptors.

[0073] In some embodiments, ERG10 comprises a peroxisomal targeting signal. In some embodiments, ERG13 comprises a peroxisomal targeting signal. In some embodiments, tHMGR comprises a peroxisomal targeting signal. In some embodiments, mvaE comprises a peroxisomal targeting signal. In some embodiments, mvaS comprises a peroxisomal targeting signal. In some embodiments, ERG12 comprises a peroxisomal targeting signal. In some embodiments, ERG8 comprises a peroxisomal targeting signal. In some embodiments, ERG19 comprises a peroxisomal targeting signal. In some embodiments, IDI comprises a peroxisomal targeting signal. In some embodiments, ERG20 comprises a peroxisomal targeting signal. In some embodiments, ERG9 comprises a peroxisomal targeting signal. In some embodiments, ERG20 and ERG9 each comprise a peroxisomal targeting signal. In some embodiments, each of ERG10, ERG13, tHMGR, mvaE, mvaS, ERG12, ERG8, ERG19, IDI, ERG20, and ERG9 comprises a peroxisomal targeting signal. In some embodiments, one enzyme in the mevalonate pathway comprises a peroxisomal targeting signal. In some embodiments, at least two enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least three enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least four enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least five enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least six enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least seven enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least eight enzymes in the mevalonate pathway comprise a peroxisomal targeting signal. In some embodiments, at least nine enzymes in the mevalonate pathway comprise peroxisomal targeting signals.

[0074] In some embodiments, each enzyme in the first group of enzymes of the mevalonate pathway comprises a peroxisomal targeting signal. In some embodiments, ERG20 and ERG9 each comprise a peroxisomal targeting signal. In some embodiments, the peroxisomal targeting signal is located at the C-terminus of one or more of the first group of enzymes of the mevalonate pathway. In some embodiments, the peroxisomal targeting signal is located at the N-terminus of one or more of the first group of enzymes of the mevalonate pathway. In some embodiments, the peroxisomal targeting signal is peroxisomal targeting sequence 1 (PTS1), peroxisomal targeting sequence 2 (PTS2), or peroxisomal targeting sequence 3 (PTS3). In some embodiments, PTS1 is the amino acid sequence serine-lysine-leucine (SKL). method

[0075] Aspects of the present disclosure relate to methods of producing squalene, the methods comprising culturing a modified yeast cell as disclosed herein in a culture medium for a sufficient time to produce squalene in the peroxisomes of the modified yeast cell.

[0076] In some embodiments, the method further includes extracting squalene from a modified yeast cell culture. In some embodiments, the culture medium comprises yeast extract, peptone, glucose and an aqueous buffer. In some embodiments, the culture medium comprises a carbon substrate. The term "carbon substrate" is known in the art and refers to a carbon-based component contained in the culture medium and for supplying carbon and energy to the cultured organism to perform various cellular functions. In some embodiments, the carbon substrate is any sugar substrate consumed by the cell. For example, in some embodiments, the carbon substrate is any of the following sugars: glucose, fructose, galactose, xylose, gluconate, glycerol or other hexoses (e.g., allose, altrose, gulose, idose, talose, psicose, tagatose and sorbose). In some embodiments, the culture medium comprises acetate. In some embodiments, the culture medium comprises acetate and a limited amount of one or more sugars. In some embodiments, one or more sugars include glucose, fructose and / or xylose. In some embodiments, the culture medium comprises a buffer, optionally wherein the buffer is a phosphate buffer saline.

[0077] In some embodiments, the method includes culturing the modified yeast cells in a culture vessel. The culture vessel may alternatively refer to a fermentor and may include aerobic or anaerobic conditions and a fermentation medium to adapt to the environment required by the organism in the culture. The term "fermentor" or "culture vessel" refers to an enclosed space or partially enclosed space in which biological and / or chemical reactions occur, at least a portion of which involves a living organism or a portion of a living organism. In the case of using a liquid culture for fermentation, a fermentor is typically a culture vessel that can accommodate the desired amount of liquid culture medium. If a gas phase is used during the fermentation process, the fermentor employed will have a volume that allows for accommodating the gas phase; if the gas phase is not air, the fermentor is typically sealed in an airtight manner. Typically, a fermentor comprises one or more inflows and / or outflows for introducing liquids, solids, and / or gases into and / or removing them from the fermentor.

[0078] Suitable fermentor configurations will be apparent to those skilled in the art. For example, in some embodiments, a continuous stirred tank reactor (CSTR), bubble reactor (BCR), semi-batch reactor, or trickle bed reactor (TBR) can be employed. In some embodiments, the fermentor contains a culture of microbial cells that undergoes a fermentation process. In some embodiments, the fermentor can be continuously or semi-continuously fed with new microorganisms from a growth or culture vessel.

[0079] In some embodiments, the fermentation tank can be used for the production of microorganisms, such as microorganisms, ...

[0080] The term "aerobic conditions" is art-recognized and refers to conditions in which sufficient oxygen is provided to allow aerobic organisms to efficiently oxidize a carbon source. In some embodiments, aerobic conditions are conditions in which a large amount or even an excess of oxygen is provided, for example, in the form of oxygen microbubbles in a liquid culture medium. For example, a fermentor that includes a gas phase containing at least 10%, at least 15%, at least 20%, at least 30%, at least 50%, or more oxygen is referred to as an aerobic fermentor.

[0081] The term "anaerobic conditions" is art-recognized and refers to conditions where sufficient oxygen is not provided to an aerobic organism for efficient carbon oxidation. In some embodiments, anaerobic conditions are characterized by the substantial absence of oxygen. In other embodiments, the oxygen content is lower than the oxygen content required for efficient carbon source oxidation by the employed microorganisms. For example, a fermentor comprising a liquid culture medium and a gas phase comprising less than 5%, less than 2%, less than 1%, less than 0.5%, less than 0.1%, less than 0.01%, or less than 0.001% oxygen is referred to as an anaerobic fermentor.

[0082] The term "culturing" refers to maintaining a culture of an organism (e.g., a microorganism described herein) for a period of time, typically a period of time sufficient to allow the microorganism to undergo a desired fermentation process. In some embodiments, the culture comprises a microorganism described herein and a culture medium, such as a liquid culture medium.

[0083] In some embodiments, the culture comprises a carbon source, such as a carbon source dissolved in the culture medium. For example, in some embodiments, in a liquid culture medium in an aerobic fermentation tank, microorganisms are cultivated in the presence of a dissolved carbon source (such as acetate or soluble sugar) in the culture medium. In some embodiments, the culture comprises salt and / or buffer to establish salinity, osmotic pressure, and pH conditions for the survival, growth, and / or conversion of a carbon source into a biofuel or biofuel precursor for the organisms suitable for cultivation.

[0084] In some embodiments, the culture comprises one or more other components, such as additives. The non-limiting examples of additives include nutrients, enzymes, amino acids, albumin, growth factors, enzyme inhibitors (such as protease inhibitors), fatty acids, lipids, hormones (such as dexamethasone and gibberellic acid), trace elements, inorganic compounds (such as reducing agents, such as manganese), redox regulators (such as antioxidants), stabilizers (such as dimethyl sulfoxide), polyethylene glycol, polyvinyl pyrrolidone (PVP), gelatin, antibiotics (such as brefeldin A), salts (such as NaCl), chelating agents (such as EDTA, EGTA) and enzymes (such as cellulase, dispase, hyaluronidase or deoxyribonuclease). In some embodiments, the culture may include induction or inhibition of compounds transcribed from conditional or inducible promoters, such as small molecule compounds or drugs, such as doxycycline, tetracycline, tamoxifen, IPTG, hormones or metal ions.

[0085] Although specific culture conditions (e.g., concentration of the carbon source) will depend on the respective microorganism to be cultured, general methods and culture conditions for generating microbial cultures are well known to those skilled in the art and are described, for example, in J. Sambrook and D. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd ed. (January 15, 2001); David C. Amberg, Daniel J. Burke and Jeffrey N. Strathern, Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory Press (April 2005); John N. Abelson, Melvin I. Simon, Christine Guthrie and Gerald R. Fink, Guide to Yeast Genetics and Molecular Biology, Part A, Vol. 194 (Methods in Enzymology Series, 194), Academic Press (March 11, 2004); Christine Guthrie and Gerald R. Fink, Guide to Yeast Genetics and Molecular Biology, Part A, Vol. 194 (Methods in Enzymology Series, 194), Academic Press (March 11, 2004); R. Fink, Guide to Yeast Genetics and Molecular and Cell Biology, Part B, Vol. 350 (Methods in Enzymology, Vol. 350), Academic Press; 1st edition (July 2, 2002); and Christine Guthrie and Gerald R. Fink, Guide to Yeast Genetics and Molecular and Cell Biology, Part C, Vol. 351, Academic Press; 1st edition (July 9, 2002), all of which are incorporated herein by reference.

[0086] In some embodiments, the modified yeast cells are cultured for a sufficient time for the modified yeast cells to convert acetyl-CoA into squalene. In some embodiments, the sufficient time is at least 6 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 192 hours.

[0087] In some embodiments, at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L or more than 1.5 g / L of squalene is in culture medium. In some embodiments, at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L or more than 1.5 g / L of squalene is extracted from modified yeast cell culture. In some embodiments, at least 25 mg / g dry cell weight (DCW), at least 50 mg / g DCW, at least 100 mg / g DCW, at least 150 mg / g DCW or more than 150 mg / g DCW of squalene is extracted from modified yeast cell culture. Other embodiments 1. A method for producing squalene in yeast, the method comprising: providing oleaginous yeast; Modifications are introduced into oleaginous yeast to increase squalene production, wherein the modifications comprise: Genes encoding the mevalonate pathway and its downstream squalene synthesis pathway were introduced into the peroxisomes of yeast; introducing a gene encoding a heterologous lipase (tlTGL) from Thermomyces lanuginosu; and overexpression of genes encoding enzymes responsible for triacylglycerol synthesis; growing the modified yeast in a medium containing a carbon source; and Squalene was harvested from peroxisomes of modified yeast. 2. The method of embodiment 1, wherein the modification introduced into the oleaginous yeast further comprises upregulating a cytosolic acetyl-CoA formation pathway based on ATP:citrate lyase (ACL), and Overexpression of pyruvate carboxylase PYC1, MmACL from Mus musculus, and mitochondrial vector YHM2. 3. The method of any one of embodiments 1-2, wherein the oleaginous yeast is Yarrowia lipolytica. 4. The method of any one of embodiments 1-3, wherein the culture medium comprises yeast extract, peptone, glucose, and an aqueous buffer. 5. The method of any one of embodiments 1-4, wherein the culture medium comprises acetate. 6. The method of any one of embodiments 1-5, wherein squalene production exceeds 0.5 g / L, exceeds 1.0 g / L, or exceeds 1.5 g / L. 7. The method of any one of embodiments 1-6, wherein squalene production is greater than 50 mg / g DCW, greater than 100 mg / g DCW, or greater than 150 mg / g DCW. 8. The method of any one of embodiments 1-7, wherein growing the modified yeast in a culture medium containing a carbon source comprises culturing the cells for at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 192 hours. 9. An oleaginous yeast comprising the modification according to embodiment 1. 10. An oleaginous yeast comprising the modification according to embodiment 2. 11. An oleaginous yeast comprising the modification of any one of embodiments 1-2, wherein the oleaginous yeast is Yarrowia lipolytica. 12. A modified yeast cell comprising: a first set of heterologous polynucleotides encoding a first set of enzymes of the mevalonate pathway, wherein one or more of the first set of enzymes of the mevalonate pathway is associated with a peroxisomal targeting signal; a first heterologous polynucleotide encoding a lipase; and A second set of heterologous polynucleotides encodes a second set of enzymes having triacylglycerol synthesis activity. 13. The modified yeast cell of embodiment 12, further comprising a third set of heterologous polynucleotides encoding a third set of enzymes having acetyl-CoA synthesis activity. 14. The modified yeast cell of embodiment 12 or 13, further comprising a fourth group of heterologous polynucleotides encoding a fourth group of enzymes having beta-oxidation activity. 15. The modified yeast cell of any one of embodiments 12-14, wherein the first group of enzymes of the mevalonate pathway comprises ERG10, ERG13, tHMGR, mvaE, mvaS, ERG12, ERG8, ERG19, IDI, ERG20, ERG9, or any combination thereof. 16. The modified yeast cell of any one of embodiments 12-15, wherein each enzyme in the first group of enzymes of the mevalonate pathway comprises a peroxisomal targeting signal. 17. The modified yeast cell of any one of embodiments 12-15, wherein ERG20 and ERG9 each comprise a peroxisomal targeting signal. 18. The modified yeast cell of any one of embodiments 12-17, wherein the peroxisome targeting signal is located at the C-terminus of one or more of the first group of enzymes of the mevalonate pathway. 19. The modified yeast cell of any one of embodiments 12-17, wherein the peroxisome targeting signal is located N-terminally to one or more of the first group of enzymes of the mevalonate pathway. 20. The modified yeast cell of any one of embodiments 12-19, wherein the peroxisome targeting signal is peroxisome targeting sequence 1 (PTS1), peroxisome targeting sequence 2 (PTS2), or peroxisome targeting sequence 3 (PTS3). 21. The modified yeast cell of embodiment 20, wherein PTS1 is the amino acid sequence Serine-Lysine-Leucine (SKL). 22. The modified yeast cell of any one of embodiments 12-21, wherein the lipase is a triacylglycerol lipase derived from Thermomyces lanuginosus. 23. The modified yeast cell of any one of embodiments 12-22, wherein the second group of enzymes having triacylglycerol synthesis activity comprises acetyl-CoA carboxylase (ACC1), diacylglycerol acyltransferase (DGA1), NAD+-dependent G3P dehydrogenase (GPD1), or any combination thereof. 24. The modified yeast cell of any one of embodiments 13-23, wherein the third group of enzymes having acetyl-CoA synthesis activity comprises pyruvate carboxylase (PYC1), ATP:citrate lyase (ACL), citrate carrier YHM2, acetyl-CoA synthetase, or any combination thereof. 25. The modified yeast cell of embodiment 24, wherein the ACL is derived from mouse (Mus musculu). 26. The modified yeast cell of embodiment 24 or 25, wherein the acetyl-CoA synthetase is derived from Salmonella enterica. 27. The modified yeast cell of embodiment 26, wherein the acetyl-CoA synthetase comprises an L641P amino acid substitution mutation relative to wild-type acetyl-CoA synthetase. 28. The modified yeast cell of any one of embodiments 14-27, wherein the fourth group of enzymes having beta-oxidation activity comprises POX1, POX2, POX3, POX4, POX5, POX6, multifunctional beta-oxidation protein (MFE1), 3-ketoacyl-CoA thiolase (POT1), or any combination thereof. 29. The modified yeast cell of any one of embodiments 12-28, wherein the modified yeast cell is an oleaginous yeast cell. 30. The modified yeast cell of embodiment 29, wherein the oleaginous yeast cell is a Yarrowia cell. 31. The modified yeast cell of embodiment 30, wherein the Yarrowia cell is Yarrowia lipolytica. 32. A method of producing squalene, the method comprising: culturing the modified yeast cell of any one of embodiments 12-31 in a culture medium for a sufficient time to produce squalene in the peroxisomes of the modified yeast cell. 33. The method of embodiment 32, further comprising extracting squalene from the modified yeast cell culture. 34. The method of embodiment 32 or 33, wherein the culture medium comprises yeast extract, peptone, glucose and an aqueous buffer. 35. The method of any one of embodiments 32-34, wherein the culture medium comprises acetate. 36. The method of any one of embodiments 32, 33, and 35, wherein the culture medium comprises acetate and a limited amount of one or more sugars. 37. The method of embodiment 36, wherein the one or more sugars comprises glucose, fructose and / or xylose. 38. The method of any one of embodiments 32-37, wherein the culture medium comprises a buffer, optionally wherein the buffer is phosphate buffered saline. 39. The method of any one of embodiments 32-38, wherein the sufficient time is at least 6 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 192 hours. 40. The method of any one of embodiments 32-39, wherein at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L, or more than 1.5 g / L of squalene is in the culture medium. 41. The method of any one of embodiments 32-40, wherein at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L, or more than 1.5 g / L of squalene is extracted from the modified yeast cell culture. 42. The method of any one of embodiments 32-41, wherein at least 25 mg / g dry cell weight (DCW), at least 50 mg / g DCW, at least 100 mg / g DCW, at least 150 mg / g DCW, or more than 150 mg / g DCW of squalene is extracted from the modified yeast cell culture. Example Example 1: Uncovering the rate-limiting step in the squalene biosynthesis pathway

[0088] In yeast, squalene is synthesized only as an intermediate in the sterol biosynthesis pathway ( Figure 1A ), the sterol biosynthetic pathway is crucial for cell growth and viability. Cytosolic farnesyl pyrophosphate synthase (ERG20) acts as a bifunctional synthase that sequentially catalyzes the condensation of isopentenyl diphosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), which is generated via the mevalonate (MVA) pathway, to form farnesyl diphosphate (FPP). The latter is subsequently converted by ERG9, encoding squalene synthase, to synthesize squalene ( Figure 1A Due to the formation of a strictly regulated and balanced sterol synthesis pathway during evolution, the naturally synthesized squalene content in wild-type Yarrowia lipolytica Polf is extremely low, only 1.8 mg / L ( Figure 1B ). In order to construct a cell factory for squalene overproduction, it was first necessary to identify the possible rate-limiting steps in the squalene biosynthesis pathway, which would identify targets for further optimization. To this end, the squalene biosynthesis pathway starting from acetyl-CoA was divided into three modules: the ascending pathway (upstream of MVA containing ERG10, ERG13 and tHMGR), the mid-pathway (downstream of MVA containing ERG12, ERG8, ERG19 and IDI) and the descending pathway (squalene formation pathway containing ERG20 and ERG9) ( Figure 1A Furthermore, since the heterologous Enterococcus faecalis MvaE and MvaS proteins were well expressed in S. cerevisiae, their ability to catalyze the first three steps of the MVA pathway (corresponding to the steps catalyzed by ERG10, ERG13, and tHMGR proteins, respectively) was investigated. Figure 1A )(27,28).

[0089] Each module was overexpressed in the Y. lipolytica Po1f-TL strain (a variant Po1f with TRP1 and LYS5 disruptions (29)). Figure 5) and evaluated their squalene production capacity. Upregulation of the ascending pathway revealed that the enzymes ERG10, ERG13, and tHMGR were the main bottlenecks of this pathway, as their combined overexpression resulted in a 344-fold increase in squalene production relative to its parental strain (titer of 0.62 g / L) (Sq01 relative to WT, Figure 1B In contrast, overexpression of the midstream or downstream pathways had very limited effects on squalene production (only a 1.2-fold or 1.3-fold increase compared to the parent strain, for Sq02 or Sq03 relative to WT, Figure 1B ), indicating that the corresponding enzyme does not catalyze the limiting step. Interestingly, the strain containing heterologous MvaE and MvaS produced squalene at a titer of 0.69 g / L and significantly increased squalene production by 11.3% compared to the strain overexpressing endogenous ascending pathway enzymes (ERG10, ERG13, and tHMGR) (Sq04 vs. Sq01, Figure 1B ). Therefore, the MvaE and MvaS pair, as an alternative shortcut for optimization of the ascending pathway, was used for all further studies. Unexpectedly, when the expression levels of the ascending and intermediate pathways were upregulated together or the entire squalene biosynthesis pathway was overexpressed, an additional 1.7-fold or 2.0-fold increase in squalene production was observed, ultimately reaching a titer of 1.34 g / L in Sq06 ( Figure 1B ), which may be due to the improved availability of pathway intermediates.

[0090] These results show that, for most, the upward regulation of the squalene synthesis pathway in the cytoplasm effectively plays a role in its biosynthesis (increased 744 times in Sq06 compared to the wild type). The important step is the upward pathway (MVA upstream pathway), which competes for the common precursor acetyl-CoA and de novo lipid formation in Yarrowia lipolytica (Y.lipolytica) and maximizes its conversion to the intermediate MVA. On the other hand, although the upward regulation of the independent midstream and downstream pathways hardly affects squalene production, their effects seem to be extremely obvious in the presence of the upward pathway overexpression. This indicates that the upward regulation of the upward pathway provides a sufficient amount of MVA pool, which requires the high-level expression of downstream enzymes to be fully harvested.

[0091] It was found that when YPD medium was supplemented with 0.2 M phosphate buffer (PBS, pH 6.0), the titer (1.71 g / L, Figure 1C ) and cell content (182.8 mg / g DCW, Figure 1D ) for both squalene production increased significantly by 27% and 41%, respectively. This may be attributed to the pH control of the medium conditioned with PBS compared to the medium not containing PBS ( Figure 6The former results in significant pH changes, which may negatively affect cell physiology, including cell membrane permeability and nutrient transport processes (30). In addition, the pH-controlled fermentation process prolonged the biosynthesis cycle of squalene and reached the highest titer at 72 h of culture, while the optimal production of the fermentation without pH control was observed at 48 h of culture and then decreased significantly ( Figure 1E ). Therefore, PBS-conditioned medium will be used for further studies. Example 2: Establishing an orthogonal pathway for squalene accumulation in peroxisomes

[0092] Although upregulation of the cytoplasmic squalene synthesis pathway contributes to improved squalene production, strong competition from evolutionarily optimized cytoplasmic sterol synthesis makes further squalene accumulation in the cytoplasm particularly difficult. Therefore, further efforts to separate squalene from its competing pathways appear to be crucial and urgent to ensure sustainable accumulation of squalene. Eukaryotic cells have devised solutions to overcome similar challenges by confining metabolic pathways to intracellular compartments to simplify reaction cascades and protect intermediates from competing pathways (31). In this regard, it is hypothesized that establishing an orthogonal pathway for squalene synthesis in yeast organelles would prevent squalene from being diverted from the strong cytoplasmic competing pathway and allow a sufficiently large squalene pool to accumulate. To implement this strategy, peroxisomes were focused on because of the following advantages: (a) peroxisomes are not essential for cell viability (32), which allows for extensive engineering without affecting yeast fitness; (b) they are the site of β-oxidation of fatty acids (which creates a pool of acetyl-CoA that can be accessed through the heterologous MVA pathway); and (c) peroxisomes also serve as storage compartments for lipophilic compounds (9), which would provide ample space for intracellular squalene accumulation. These favorable properties of peroxisomes offer the potential for advantageous reuse to establish an orthogonal metabolic network for efficient squalene synthesis ( Figure 2A ).

[0093] To assess the availability of peroxisomes for squalene production, we first aimed to direct the downstream pathway involving ERG20 and ERG9 to peroxisomes by adding a C-terminal SKL peroxisome targeting signal ( Figure 2A Compared with cytoplasmic overexpression, squalene production was significantly increased by 6.3 times (Sq07 relative to Sq03, Figure 2B In addition, a higher biomass was observed in strain Sq03 compared to Sq07 ( Figure 7), which may be attributed to the increased squalene in Sq03 being directed to the sterol pathway, thereby promoting cell growth. These results support the initial hypothesis that peroxisomes can act as a barrier, sequestering locally formed squalene from cytosolic sterol synthesis. This also suggests that the precursors IPP and DMAPP generated by the cytosolic MVA pathway can be translocated from the cytosol to the oxisomes.

[0094] To extend these findings, the possibility of harvesting the peroxisomal acetyl-CoA pool for squalene production in this organelle was evaluated. To this end, the MVA pathway enzymes were sequentially introduced into the peroxisome. In the presence of ERG20 and ERG9, the sequential addition of the MVA pathway (ERG12, ERG8, ERG19, and IDI) to the peroxisome resulted in an additional 3.8-fold increase in squalene production (Sq09 relative to Sq07). Figure 2B ), while their cytoplasmic overexpression had only a minor effect on squalene production (Sq08 relative to Sq03, Figure 2B When the entire MVA pathway was assembled in the peroxisome, forming a complete orthogonal pathway to harvest peroxisomal acetyl-CoA, a strong additional 40-fold increase in squalene production was observed, with 2.34 g / L produced in strain Sq10 (Sq10 relative to Sq09, Figure 2B ), which also showed a 1.37-fold increase compared to the strain Sq06 that overexpressed the MVA pathway in the cytoplasm (Sq10 relative to Sq06, Figure 2B These data suggest that the heterologous peroxisomal MVA pathway is capable of harvesting the available peroxisomal acetyl-CoA pool. The establishment of an orthogonal metabolic network in the peroxisome suggests that it is possible to circumvent the current limitation of squalene production caused by the strong competition for sterol synthesis in the yeast cytosol. This was further confirmed by the changes in squalene concentration over time ( Figure 2C In the initial stage (24 h), strain Sq06 had a squalene production rate similar to that of strain Sq10 containing the peroxisomal pathway ( Figure 2C However, thereafter, especially after glucose depletion (48-72 h), the squalene productivity of strain Sq06 gradually decreased ( Figure 2C ), it is possible that the squalene formed in the cytoplasm is transported to the sterol pathway, while strain Sq10 still maintains high productivity for the accumulation of squalene in peroxisomes ( Figure 2C ).

[0095] It is noteworthy that although squalene production in strain Sq10 increased by 37% compared with that in Sq06, the increase seems small if compared with the fold changes between Sq07 and Sq03 (6.3-fold) or Sq09 and Sq08 (24.4-fold) ( Figure 2BThis suggests that insufficient acetyl-CoA supply in peroxisomes may impair the function of the peroxisomal pathway, thereby creating a major bottleneck for further accumulation of squalene in peroxisomes. Conversely, the abundant acetyl-CoA pool in the cytosol can compensate for the loss of squalene entering the sterol pathway, resulting in a narrowing of the gap in squalene production between the cytosolic engineered strain Sq06 and the peroxisomal engineered strain Sq10 ( Figure 2B ). Example 3: Conversion of Byproduct Lipids into Peroxisomal Squalene Synthesis

[0096] Next, we focused on enhancing the supply of precursor acetyl-CoA in peroxisomes by promoting lipid metabolism, including its biosynthesis, hydrolysis, and degradation. Figure 3A Yarrowia lipolytica is a natural lipid producer, capable of accumulating 30% to 60% of its cell dry weight (30), primarily in the form of triacylglycerols (TAGs) stored in lipid bodies. While lipid bodies in Y. lipolytica generally facilitate the sequestration and storage of lipophilic compounds, engineered peroxisomes would serve as similar storage compartments for the accumulation of locally formed squalene, making lipid bodies unnecessary for targeted storage. It is hypothesized that TAGs accumulated in lipid bodies would serve as a carbon source to support peroxisomal squalene production. To test this concept, we attempted to convert intracellular TAG into free fatty acids (FFA) by overexpressing TAG hydrolysis mediated by an endogenous lipase (ylTGL) or a heterologous tlTGL from Thermomyces lanuginosus (33) in the peroxisomal squalene-producing strain Sq10, which is degraded in peroxisomes via β-oxidation to generate acetyl-CoA ( Figure 3A ylTGL overexpression slightly improved squalene production ( Figure 8 ), while the introduction of liposome-targeted tlTGL significantly improved squalene titer by 12% (Sq14 vs. Sq10, Figure 3B This result suggests that intracellular TAG is aggregated into peroxisomal squalene synthesis and contributes to high yields. This also suggests that there is considerable potential for improving peroxisomal squalene synthesis if the cytosolic acetyl-CoA pool is converted into peroxisomal acetyl-CoA through lipid metabolism.

[0097] To this end, key enzymes responsible for limiting the biochemical reactions involved in TAG synthesis were overexpressed, including acetyl-CoA carboxylase (ACC1) (34), which converts acetyl-CoA to malonyl-CoA (the first execution step of TAG synthesis), diacylglycerol acyltransferase (DGA1) (34), which catalyzes the final step of TAG synthesis, and NAD+ The phospholipids of Sq14 and Sq15 were significantly increased in Sq14 compared to Sq15, and the lipid content of Sq14 was significantly increased in Sq15 compared to Sq15. Figure 9 Correspondingly, peroxisomal squalene production also increased significantly by 16% (Sq14 relative to Sq15, Figure 3B ), which may be the result of a higher precursor flux through the peroxisomal pathway. By overexpressing these three enzymes, the effect on squalene production based on the cytosolic pathway in strain Sq06 was studied. A significant decrease in squalene production was observed (Sq06 vs. Sq16, Figure 10A ), which may be attributed to the fact that more common acetyl-CoA in the cytosol is directed into lipid synthesis ( Figure 10B ), and this in turn results in limited flux into the cytoplasmic MVA and product formation pathways. Although lipid bodies in Y. lipolytica create hydrophobic pockets that facilitate sequestration and storage of lipophilic terpenes (36), the increased TAG supply comes at the expense of the precursor acetyl-CoA, which is common in the cytoplasm. Therefore, carbon flux needs to be optimally divided between lipid and terpenoid synthesis, but this remains challenging. Alternatively, this limitation was effectively circumvented by constructing an orthogonal terpenoid pathway in the peroxisome. Attempts were also made to increase the supply of the cofactor NADPH required for de novo lipid biosynthesis by overexpressing two genes involved in the pentose phosphate pathway, G6PD (which encodes glucose-6-phosphate dehydrogenase) and 6PGD (which encodes phosphogluconate dehydrogenase) (37). However, neither squalene nor lipid production was significantly improved ( Figure 11A ), indicating that NADH recycling is not the rate-limiting step in this case; therefore, this strategy was not pursued further.

[0098] Acetyl-CoA in the cytosol is the main precursor for lipid synthesis, and sufficient cytosolic acetyl-CoA metabolic flux is crucial for lipid production. We attempted to enhance the supply of cytosolic acetyl-CoA. We first overexpressed pyruvate carboxylase (PYC1) to ensure the efficient formation of oxaloacetate required for citrate biosynthesis and transport ( Figure 3A However, overexpression of PYC1 resulted in a slight increase in squalene production (Sq15 relative to Sq18, Figure 3B Increased citrate pool ( Figure 12 ) suggested that the breakdown of citrate to form acetyl-CoA and oxaloacetate by ATP:citrate lyase (ACL) may be the bottleneck of this pathway. To overcome this limitation, heterologous ACL from mouse (Mus musculus) (MmACL) was introduced because of its affinity for citrate (K m0.05 mM) was higher than endogenous ACL (K m was 3.6 mM (38). Furthermore, providing cytosolic acetyl-CoA in this manner also depends on the activity of mitochondrial citrate export. Therefore, MmACL was overexpressed together with YHM2 (the Y. lipolytica mitochondrial citrate carrier, which has been characterized as an antiporter for citrate and α-ketoglutarate or oxaloacetate) (39). This resulted in a significant increase in squalene production by 8.6%, reaching 3.17 g / L in strain Sq19 (Sq19 relative to Sq18, Figure 3B ).

[0099] Although the above optimized lipid metabolism pathway may redirect carbon flux to peroxisomes and thus significantly promote peroxisomal squalene synthesis (Sq19 increased by 1.45 times compared with Sq10, Figure 3B ), but the lipid pool accumulated in strain Sq19 ( Figure 9 ) suggested that degradation of lipids to acetyl-CoA in peroxisomes may be a limitation to the efficiency of carbon utilization to the desired compound. Therefore, next attempts were made to increase the yield of lipids to squalene, primarily by enhancing the β-oxidation pathway, which drives the conversion of acyl-CoA to acetyl-CoA in peroxisomes ( Figure 3A To this end, the enzymes involved in the β-oxidation process were engineered. The peroxisomal β-oxidation pathway in yeast is a multistep process that requires the activities of three different enzymes ( Figure 3A ), including six acyl-CoA oxidases (40) encoded by six genes, POX1 to POX6, which are responsible for the first execution step of β-oxidation, multifunctional β-oxidation protein (MFE1) (41) involved in the second and third β-oxidation steps, and 3-ketoacyl-CoA thiolase (POT1) (42) catalyzing the last step. To explore the possible limiting steps in the β-oxidation pathway, these six acyl-CoA oxidases were first overexpressed in the peroxisome-producing strain Sq19. Among these six acyl-CoA oxidases, overexpression of POX2 showed the most significant improvement in squalene synthesis in strain Sq21 ( Figure 3C This was attributed to the fact that POX2 preferentially oxidizes the most abundant long-chain fatty acids in Y. lipolytica (40). Subsequently, additional co-overexpression of MFE1 and POT1 further resulted in a 6.7% increase in squalene production (Sq26 vs. Sq21, Figure 3C). In addition, peroxisome population may be another key factor in peroxisome production, as it is possible to provide more space for enzyme expression and product storage. Therefore, the effect of increasing peroxisome population on peroxisomal squalene production was investigated by overexpressing peroxisome biogenesis factor 10 (PEX10), which plays a role in regulating the size and / or number of peroxisomes (42). Pex10 overexpression further improved squalene production by 3.1%, and the yield in strain Sq27 was 3.82 g / L (Sq27 relative to Sq26, Figure 3C ).

[0100] In summary, conversion of byproduct lipids to the peroxisomal acetyl-CoA pool resulted in a 63% increase in squalene production in peroxisomes (Sq27 relative to Sq10, Figure 3B 、 3C ), which suggests that engineered lipid metabolism could potentially contribute to the synthesis of acetyl-CoA-derived chemicals in peroxisomes. The performance of the constructed strain Sq27 was studied in a 3 L fed-batch culture (with glucose as the carbon source). The final titer was 32.8 g / L and the content was 446 mg / g DCW ( Figure 3D ), with a productivity of 0.15 g / L / h. These data demonstrate the robustness of the engineered strain in large culture volumes and high cell density fermentations. Example 4: Establishing an orthogonal acetyl-CoA shortcut in the peroxisome

[0101] Other feasible options were explored that could enhance the supply of acetyl-CoA to peroxisomes without modifying such a long lipid metabolism pathway. It was previously reported that Y. lipolytica has a strong acetate utilization pathway that directly produces the core molecule acetyl-CoA from acetate as a carbon source to support cell growth and target compound synthesis (30) ( Figure 4A ). This natural ability of Yarrowia lipolytica can provide inspiration for solving metabolic engineering challenges. This paper first studied the effect on squalene production in strain Sq10 with a peroxisomal pathway by feeding 27.4 g / L sodium acetate as the sole carbon source (equivalent to 20 g / L glucose) and supplementing 0.2 M PBS (pH 6.0) to control the pH of the culture medium. As a result, a 40% or similar decrease in squalene titer was observed when strain Sq10 was cultured in YPA medium (acetate as a carbon source) compared to YPD medium (glucose as a carbon source) supplemented or not with PBS, respectively. Figure 4B The decreased titer of squalene should be due to the decreased cell growth when cultured in YPA medium ( Figure 4C), since similar squalene contents were observed between YPD and YPA media ( Figure 4D This equivalent content indicates that Y. lipolytica can effectively and potentially absorb acetate as the sole carbon source to produce squalene.

[0102] Given the near-perfect performance of acetate as a carbon source for squalene synthesis by utilizing the endogenous cytosolic acetate uptake pathway, it was hypothesized that establishing an orthogonal acetate utilization pathway in peroxisomes could potentially improve the concentration of peroxisomal acetyl-CoA and enhance the conversion of acetate to squalene. L641P )(43) and targeted it to the peroxisome, which in turn established a metabolic shortcut from acetate to acetyl-CoA for squalene synthesis in the peroxisome ( Figure 4A As a result, the squalene titer obtained was significantly increased by 63% (Sq28 relative to Sq10, Figure 4E ), and its intracellular content increased by 69% (Sq28 compared to Sq10, Figure 4F ), with yields of 2.3 g / L and 420 mg / g DCW, respectively. It is noteworthy that this orthogonal acetyl-CoA shortcut enabled strain Sq28 to produce similar squalene titers in YPA medium, if compared to the titers of Sq10 in YPD medium (Sq28 relative to Sq10, Figure 4B and 4E ). It was observed that the intracellular squalene content in strain Sq28 reached a capacity comparable to that of the previous strain Sq27 (obtained by the first method) when grown in YPD medium (420 mg / g DCW in Sq28 versus 424 mg / g DCW in Sq272). These results strongly suggest that utilizing the orthogonal acetate utilization pathway in peroxisomes can bypass long lipid metabolism steps and create a peroxisomal acetyl-CoA shortcut, thereby achieving metabolic optimality of squalene production in peroxisomes. In addition, POX2, MFE1, POT1, and PEX10 were also overexpressed with the goal of promoting lipid degradation to acetyl-CoA. However, only a slight increase in squalene production in terms of titer and cellular content was observed (Sq28 versus Sq29, Figures 13A-13B ), it is possible that sufficient acetyl-CoA derived from acetate in the peroxisome satisfies the downstream pathway of squalene synthesis. Next, the ability of the engineered strain Sq28 to convert acetate into squalene in a scaled-up bioreactor was investigated. During the fed-batch fermentation process in the bioreactor, a co-feeding strategy was used, in which acetate was fed in both salt and acid forms ( Figure 4GThe latter form not only served as a carbon source, but also as an acid to regulate the pH of the culture medium for optimal cell growth. Ultimately, the titer of squalene production was 16.8 g / L, and the cell content was 394 mg / g DCW ( Figure 4H ).

[0103] Compared to glucose fermentation, the reduction of biomass in acetate fermentation was found to be the main bottleneck for high titer squalene production. Therefore, further efforts towards optimizing cell growth appear to be crucial for acetate fermentation. Substrate mixtures offer the potential to alleviate such limitations in reductive metabolism without genetic engineering. Each substrate has a unique efficiency for carbon, energy, and cofactor production, allowing for fine-tuning of the carbon-energy-cofactor ratio (44). However, due to the evolutionary adaptation of cells in their natural environment, mixed substrate metabolism is often hampered by metabolic inhibition based on substrate preference (45). In order to overcome the undesirable substrate preference without reducing acetate reduction, a limited amount of glucose ( Figure 4G ). The glucose feed rate was kept quite low to maintain negligible concentrations in the reactor (undetectable levels). In this fed-batch setup, the cells consumed both acetate and supplemented glucose, with acetate remaining the primary carbon source. Under these conditions, acetate utilization metabolism dominated, providing precursors for squalene production in peroxisomes, while glucose primarily provided sufficient ATP and NADPH generation for cell maintenance and growth. Using this approach, the production of squalene was significantly improved compared to acetate-only fermentations (16.8 g / L, Figure 4H ) compared to the titer of squalene obtained with the squalene solution (31.6 g / L, Figure 4I ), while intracellular squalene content was similar (402 mg / g DCW in the co-fed fermentation vs. 394 mg / g DCW in the acetate-only fermentation, Figure 4H and 1). Specifically, the cell growth rate with substrate co-feeding was almost twice as fast as the acetate-only control (0.327 DCW / h vs. 0.178 DCW / h). Furthermore, acetate uptake was enhanced by 25% with glucose, indicating that controlling the continuous feeding of the preferred substrate does not inhibit the consumption of the less preferred substrate. These results demonstrate that feed batch co-feeding significantly outperforms the acetate-only control and provides an alternative approach for synthesizing terpenes or even acetyl-CoA-derived chemicals from acetate. Example 5: Methods and Materials Related to Examples 1-4

[0104] Culture conditions and culture medium. The E. coli DH5α cells used for plasmid propagation were grown in Luria-Bertani (LB) medium (BD bioscience) supplemented with the corresponding antibiotics (50 μg / mL kanamycin or 100 μg / mL ampicillin), wherein the culture medium was shaken at 37°C for 16 h. All Yarrowia lipolytica strains were cultured at 30°C with shaking at 230 rpm. The culture medium for the growth of Yarrowia lipolytica and the production of squalene was prepared as follows. YPD medium was prepared from 10 g / L yeast extract (VWR Life Science), 20 g / L peptone (VWR LifeScience) and 20 g / L glucose (Sigma-Aldrich), and 15 g / L agar (BD bioscience) was supplemented as needed for agar plates. YPA broth was prepared from 10 g / L yeast extract (VWR Life Science), 20 g / L peptone (VWR Life Science), and 27.4 g / L sodium acetate (Sigma-Aldrich). Phosphate buffered saline (PBS) with a pH of 6.0 was prepared with 0.2 M Na2HPO4 and 0.2 M NaH2PO4 and was used to prepare YPD- or YPA-PBS fermentation media instead of water. YNB medium for screening transformed Y. lipolytica strains was prepared with 1.7 g / L yeast nitrogen base (YNB, BD bioscience) without amino acids and ammonium sulfate, 20 g / L glucose, 5 g / L ammonium sulfate (VWR LifeScience), 15 g / L agar (BD bioscience), and 0.77 g / L of the appropriate complete supplement mix (without uracil, leucine, lysine, or tryptophan (Sunrise science products). For antibiotic selection, hygromycin B (250 μg / mL, Sigma-Aldrich) or nourseothricin (400 μg / mL, Fisher Scientific) was added to the YPD medium.

[0105] Construction of plasmids and strains. Escherichia coli DH5α (purchased from NEB) was used for plasmid propagation. The laboratory-stored Yarrowia lipolytica po1f strain was used as the basic strain, and its derivatives and plasmids used in this study are listed in Table 1. The primers used for plasmid construction (synthesized by Sigma-Aldrich) are provided in Table 2. The restriction enzyme Not1 used for linearizing the plasmid was purchased from New England Biolabs (NEB). Gene amplification was performed using high-fidelity KAPA HiFi DNA polymerase (KapaBiosystems) to construct the plasmid. Colony PCR identification was performed using GoTaq DNA polymerase (Promega). ZYMO TM Fragment recovery kit (ZYMO TM research) to purify the PCR fragment. High-fidelity DNA assembly master mix The plasmid was constructed and then transformed into chemically competent E. coli DH5α cells by heat shock. Spin Miniprep kit (Qiagen) was used for extraction and subsequent sequencing at Quintara Bioscience. All engineered Y. lipolytica strains were obtained by transformation of linearized plasmids (Not1 digestion) using the lithium acetate method. Recombinants were verified by PCR amplification of genomic DNA. The heterologous genes MvaE (WP_002357755.1) and MvaS (WP_002357756.1) from Enterococcus faecalis and the cucurbitadienol synthase CbQ (K7NBZ9.1) from S. grosvenorii were codon-optimized for Y. lipolytica and synthesized by GeneArt (Thermo Fisher Scientific).

[0106] LYS5 disruption in Yarrowia lipolytica strains using CRISPR-Cas9. Previously, a Yarrowia lipolytica po1f variant, po1f-T, was obtained in which the TRP1 gene was disrupted using CRISPR-Cas9 technology, resulting in three available auxotrophic markers (ura3 - leu2 -, trp1)(29). In order to develop more available nutritional deficiency markers, a similar method was used to destroy LYS5 (YALI0E09306). The CRISPR-Cas9 plasmid containing the gRNA targeting the LYS5 gene (TCTGACAGGCAAGAAGTGGA) (SEQ ID NO: 78) was transformed into the strain po1f-T, in which Ura3 was used as the nutritional deficiency marker. Lysine nutritional deficiency strains were obtained by screening on YNB-Ura and YNB-Ura-lys plates. Thereafter, the positive clones were inoculated on YPD plates and subcultured three times to lose the CRISPR-Cas9 plasmid to obtain the po1f-TL strain (ura3 - leu2 - trp1 - , lys5 - ).

[0107] Shake flask fermentation. A single colony of the engineered strain was picked from the plate and inoculated into 2 mL of YPD medium, then cultured at 30°C for 16 h. The overnight culture was then transferred to a 50 mL shake flask (containing 10 mL of YPD or YPA medium, with an initial OD of 600 was 0.1), and cultured at 30°C with shaking at 230 rpm for 2 to 3 days.

[0108] Bioreactor fermentation. In 3L bioreactor (New Brunswick Bioflo115 system), feed batch fermentation is carried out. For glucose fermentation, initial fermentation is completed with 1L culture medium, and described culture medium contains 50g / L yeast extract, 100g / L peptone, 100g / L glucose and 0.2M PBS, pH 6.0. By inoculating suitable strain into YPD culture medium, and growing 18h under 30 ℃ / 230rpm, and then inoculating to initial OD 600The seed culture of the engineered strain was prepared in a bioreactor with a pH of 1.5 to 2.0. The temperature was maintained at 30°C. During the growth phase (usually 0 to 48 hours), the dissolved oxygen was controlled at 20% and the stirring cascade was 250 to 800 rpm. Air was introduced into the fermentor at 2 vvm. After the feed medium was started, stirring and ventilation were switched and kept constant at 600 rpm and 1 vvm respectively. The pH was maintained at 6.5 by feeding 5M HCl. Foaming was prevented by adding defoamer 204 (Sigma-Aldrich). The fed batch process was started after 48 hours of fermentation using a medium rich in YPD, which consisted of 100 g / L yeast extract, 100 g / L peptone, 500 g / L glucose and 0.2 M PBS. For acetate fermentation, the initial fermentation was completed in 1 L of culture medium containing 20 g / L yeast extract, 40 g / L peptone, 40 g / L sodium acetate and 0.2 M PBS at a pH of 6.0. Seed cultures were prepared by inoculating the appropriate strain into YPD culture medium overnight, and then the seed culture was inoculated into YPA culture medium for 24 h before the seed culture was inoculated into the bioreactor. Dissolved oxygen was controlled at 20% and the stirring cascade was 250-800 rpm. Air was introduced into the fermentor at 2 vvm. The fed-batch process was started with concentrated acetic acid (Sigma-Aldrich) as a carbon source. Supplemented acetic acid also served as a pH regulator to maintain the pH at 6.8. Concentrated YP culture medium (100 g / L yeast extract and 100 g / L peptone) prepared with 0.2 M PBS was added to provide a nitrogen source for cell growth. In the substrate co-feeding system, supplemental glucose was fed continuously at a relatively slow rate to maintain its concentration in the bioreactor at an undetectable level. Samples were taken every 24 hours to measure OD 600 , glucose or acetate concentration, and squalene titer.

[0109] Quantification of residual glucose or acetate in the culture medium. The determination of glucose or acetate in the culture medium was performed using a high performance liquid chromatograph (HPLC, Agilent technologies 1260) equipped with a refractive index detector and an HPX-87H chromatographic column (Bio-Rad). 1 mL of sample was collected and centrifuged at 12,000 g for 1 minute, and then the supernatant was filtered through a 0.2 μm syringe filter and then injected. A mobile phase consisting of 14 mM sulfuric acid was used at a flow rate of 0.7 mL / min at 50 ° C. 10 μL of sample was injected into the HPLC.

[0110] Lipid extraction and quantification. 0.5 mL of cell culture was collected and centrifuged at 12,000 g for 2 minutes, and the supernatant was discarded. 0.5 mL of 0.5 M sodium hydroxide-methanol solution was mixed with the cell pellet, and internal standards were added: 2 mg / mL methyl tridecanoate (Sigma-Aldrich) and 2 mg / mL triheptadecanoylglycerol (Sigma-Aldrich) dissolved in hexane. The mixture was vortexed at room temperature for 1 hour to allow lipid transesterification to fatty acid methyl esters (FAMEs), and then 40 μL of purified sulfuric acid (Sigma-Aldrich) was added for pH neutralization. FAMEs were then extracted by adding 0.5 mL of hexane and then vortexing for 30 minutes. After centrifugation at 12,000 g for 5 minutes, the upper hexane phase was collected for analysis. FAMEs were quantified by GC-FID (Agilent technologies) equipped with an Agilent HP-INNOWAX capillary column. The injection volume was 1 μL, the split ratio was 50:1, and the inlet temperature was 260 ° C. The GC oven temperature was set as follows: initially at 100°C, then increased to 240°C at a rate of 50°C / min and held for 10 minutes. Fatty acids were identified and quantified by comparison with commercially available FAME standards (Sigma-Aldrich). Total lipid content was calculated as the sum of the total fatty acid content of five FAMEs: palmitic acid methyl ester (C16:0), palmitoleic acid methyl ester (C16:1), stearic acid methyl ester (C18:0), oleic acid methyl ester (C18:1), and linoleic acid methyl ester (C18:2).

[0111] Extraction and quantification of squalene. 100 to 500 μL of cell culture was collected and centrifuged at 12,000 g for 2 minutes. The cell pellet was suspended in 500 μL of methanol using glass beads (425-600 μm, Sigma-Aldrich). The mixture was vortexed at room temperature for 1 hour, and then 500 μL of hexane was added to extract squalene by vortexing for 30 minutes. After centrifugation at 12,000 g for 5 minutes, the upper hexane phase was collected for analysis. Squalene was quantified by GC-FID (Agilent technologies) equipped with an Agilent HP-INNOWAX capillary column. The injection volume was 1 μL, the split ratio was 2:1, and the injection port temperature was 260°C. The GC oven temperature was as follows: the initial temperature was set to 100°C for 0.5 minutes, then increased to 250°C at a rate of 50°C / min and held for 8 minutes. Squalene was identified and quantified by comparison with a commercially available squalene standard (Sigma-Aldrich). Squalene production was expressed in grams per liter of fermentation broth (g / L) and milligrams per gram of dry cell weight (mg / gDCW). Optical density was measured at 600 nm using a Thermo Spectronic Genesys 20 (Thermo Scientific) and the formula DCW = 0.3 x OD was used. 600 Calculate cell mass.

[0112] It should be understood that the subject matter defined in the appended claims is not necessarily limited to the detailed description described above, which is disclosed by way of example only. Table 1. Strains and constructs. Table 2. Primer sequences. References 1. Y. Chen, J. Nielsen, Advances in metabolic pathway and strain engineering paving the way for sustainable production of chemical building blocks. Curr. Opin. Biotechnol. 24, 965-972 (2013). 2.P.P.Peralta-Yahya,F.Zhang,S.B.Del Cardayre,J.D.Keasling,Microbialengineering for the production of advanced biofuels.Nature 488,320-328(2012). 3.Y.Liu,J.Nielsen,Recent trends in metabolic engineering of microbialchemical factories.Curr.Opin.Biotechnol.60,188-197(2019). 4.C.E.Vickers,T.C.Williams,B.Peng,J.Cherry,Recent advances insynthetic biology for engineering isoprenoid production inyeast.Curr.Opin.Chem.Biol.40,47-56(2017). 5.J.Nielsen,J.D.Keasling,Engineering cellular metabolism.Cell 164,1185-1197(2016). 6.L.Dong et al.,Co-expression of squalene epoxidases with triterpenecyclases boosts production of triterpenoids in plants and yeast.Metab.Eng.49,1-12(2018). 7.D.-K.Ro et al.,Production of the antimalarial drug precursorartemisinic acid in engineered yeast.Nature 440,940-943(2006). 8.C.J.Paddon et al.,High-level semi-synthetic production of thepotent antimalarial artemisinin.Nature 496,528-532(2013). 9.G.-S.Liu et al.,The yeast peroxisome:A dynamic storage depot andsubcellular factory for squalene overproduction.Metab.Eng.57,151-161(2020). 10.C.Ignea et al.,Orthogonal monoterpenoid biosynthesis in yeastconstructed on an isomeric substrate.Nat.Commun.10,3799(2019). 11.A.Chou,S.H.Lee,F.Zhu,J.M.Clomburg,R.Gonzalez,An orthogonalmetabolic framework for one-carbon utilization.Nature Metabolism 3,1385-1399(2021). 12.R.Thimmappa,K.Geisler,T.Louveau,P.O'Maille,A.Osbourn,Triterpenebiosynthesis in plants.Annu.Rev.Plant Biol.65,225-257(2014). 13.J.D.Connolly,R.A.Hill,Triterpenoids.Nat.Prod.Rep.27,79-132(2010). 14.K.Paramasivan,S.Mutturi,Recent advances in the microbialproduction of squalene.World J.Microbiol.Biotechnol.38,1-21(2022). 15.M.Tateno et al.,Synthetic Biology-derived triterpenes asefficacious immunomodulating adjuvants.Sci.Rep.10,1-11(2020). 16.R.Thimmappa,K.Geisler,T.Louveau,P.O'Maille,A.Osbourn,Triterpenebiosynthesis in plants.Annu.Rev.Plant Biol.65(2014). 17.N.Gohil,G.Bhattacharjee,K.Khambhati,D.Braddick,V.Singh,Engineeringstrategies in microorganisms for the enhanced production of squalene:advances,challenges and opportunities.Frontiers in bioengineering andbiotechnology 7,50(2019). 18.Z.-T.Zhu et al.,Metabolic compartmentalization in yeastmitochondria:Burden and solution for squalene overproduction.Metab.Eng.68,232-245(2021). 19.L.J.Wei et al.,Improved squalene production through increasinglipid contents in Saccharomyces cerevisiae.Biotechnol.Bioeng.115,1793-1800(2018). 20.A.Rasool,M.S.Ahmed,C.Li,Overproduction of squalene synergisticallydownregulates ethanol production in Saccharomycescerevisiae.Chem.Eng.Sci.152,370-380(2016). 21.J.Y.Han,S.H.Seo,J.M.Song,H.Lee,E.-S.Choi,High-level recombinantproduction of squalene using selected Saccharomyces cerevisiae strains.J.Ind.Microbiol.Biotechnol.45,239-251(2018). 22.W.Xu et al.,Improving squalene production by enhancing the NADPH / NADP+ratio,modifying the isoprenoid-feeding module and blocking themenaquinone pathway in Escherichia coli.Biotechnol.Biofuels 12,1-9(2019). 23.J.-J.Pan et al.,Biosynthesis of squalene from farnesyl diphosphatein bacteria:three steps catalyzed by three enzymes.ACS central science 1,77-82(2015). 24.A.Katabami et al.,Production of squalene by squalene synthases andtheir truncated mutants in Escherichia coli.J.Biosci.Bioeng.119,165-171(2015). 25.S.Gao et al.,Iterative integration of multiple-copy pathway genesin Yarrowia lipolytica for heterologousβ-carotene production.Metab.Eng.41,192-201(2017). 26.Y.-Y.Huang et al.,Enhanced squalene biosynthesis in Yarrowialipolytica based on metabolically engineered acetyl-CoAmetabolism.J.Biotechnol.281,106-114(2018). 27.X.Luo et al.,Complete biosynthesis of cannabinoids and theirunnatural analogues in yeast.Nature 567,123-126(2019). 28.S.Dusséaux,W.T.Wajn,Y.Liu,C.Ignea,S.C.Kampranis,Transforming yeastperoxisomes into microfactories for the efficient production of high-value isoprenoids.Proc.Natl.Acad.Sci.USA 117,31789-31799(2020). 29.Y.Ma et al.,Removal of lycopene substrate inhibition enables highcarotenoid productivity in Yarrowia lipolytica.Nat.Commun.13,572(2022). 30.H.Liu,M.Marsafari,F.Wang,L.Deng,P.Xu,Engineering acetyl-CoAmetabolic shortcut for eco-friendly production of polyketides triacetic acidlactone in Yarrowia lipolytica.Metab.Eng.56,60-68(2019). 31.M.T.Alam et al.,The self-inhibitory nature of metabolic networksand its alleviation through compartmentalization.Nat.Commun.8,1-13(2017). 32.A.A.Sibirny,Yeast peroxisomes:structure,functions andbiotechnological opportunities.FEMS Yeast Res.16(2016). 33.K.Yang et al.,Subcellular engineering of lipase dependent pathwaysdirected towards lipid related organelles for highly effectivelycompartmentalized biosynthesis of triacylglycerol derived products inYarrowia lipolytica.Metab.Eng.55,231-238(2019). 34.M.Tai,G.Stephanopoulos,Engineering the push and pull of lipidbiosynthesis in oleaginous yeast Yarrowia lipolytica for biofuelproduction.Metab.Eng.15,1-9(2013). 35.T.Dulermo,J.-M.Nicaud,Involvement of the G3P shuttle andβ-oxidation pathway in the control of TAG synthesis and lipid accumulation inYarrowia lipolytica.Metab.Eng.13,482-491(2011). 36.M.Larroude et al.,A synthetic biology approach to transformYarrowia lipolytica into a competitive biotechnological producer ofβ-carotene.Biotechnol.Bioeng.115,464-472(2018). 37.K.Qiao,T.M.Wasylenko,K.Zhou,P.Xu,G.Stephanopoulos,Lipid productionin Yarrowia lipolytica is maximized by engineering cytosolic redoxmetabolism.Nat.Biotechnol.35,173(2017). 38.H.Zhang et al.,Enhanced lipid accumulation in the yeast Yarrowialipolytica by over-expression of ATP:citrate lyase from Musmusculus.J.Biotechnol.192,78-84(2014). 39.E.Y.Yuzbasheva et al.,The mitochondrial citrate carrier inYarrowia lipolytica:its identification,characterization and functionalsignificance for the production of citric acid.Metab.Eng.54,264-274(2019). 40.A.Beopoulos et al.,Control of lipid accumulation in the yeastYarrowia lipolytica.Appl.Environ.Microbiol.74,7779-7789(2008). 41.P.Kasaragod et al.,Structural enzymology comparisons ofmultifunctional enzyme,type-1(MFE 1):the flexibility of its dehydrogenasepart.FEBS Open bio 7,1830-1842(2017). 42.J.J.Smith,T.W.Brown,G.A.Eitzen,R.A.Rachubinski,Regulation ofperoxisome size and number by fatty acidβ-oxidation in the yeast Yarrowialipolytica.J.Biol.Chem.275,20168-20178(2000). 43.V.J.Starai,J.G.Gardner,J.C.Escalante-Semerena,Residue Leu-641 ofacetyl-CoA synthetase is critical for the acetylation of residue Lys-609 bythe protein acetyltransferase enzyme of Salmonella enterica.J.Biol.Chem.280,26200-26205(2005). 44.J.O.Park et al.,Synergistic substrate cofeeding stimulatesreductive metabolism.Nature Metabolism 1,643-651(2019). 45.J.M.Gancedo,Yeast carbon catabolite repression.Microbiol.Mol.Biol.Rev.62,334-361(1998). 46.T.Yu et al.,Reprogramming Yeast Metabolism from AlcoholicFermentation to Lipogenesis.Cell(2018). 47.J.Xu,N.Liu,K.Qiao,S.Vogg,G.Stephanopoulos,Application of metaboliccontrols for the maximization of lipid production in semicontinuous fermentation.Proc.Natl.Acad.Sci.USA 114,E5308-E5316(2017).

Claims

1. A modified yeast cell comprising: a first set of heterologous polynucleotides encoding a first set of enzymes of the mevalonate pathway, wherein one or more of the first set of enzymes of the mevalonate pathway is linked to a peroxisomal targeting signal; a first heterologous polynucleotide encoding a lipase; and A second set of heterologous polynucleotides encodes a second set of enzymes having triacylglycerol synthesis activity.

2. The modified yeast cell of claim 1, further comprising a third set of heterologous polynucleotides encoding a third set of enzymes having acetyl-CoA synthesis activity.

3. The modified yeast cell of claim 1, further comprising a fourth set of heterologous polynucleotides encoding a fourth set of enzymes having beta-oxidation activity.

4. The modified yeast cell of claim 1, wherein the first group of enzymes of the mevalonate pathway comprises ERG10, ERG13, tHMGR, mvaE, mvaS, ERG12, ERG8, ERG19, IDI, ERG20, ERG9, or any combination thereof.

5. The modified yeast cell of claim 1, wherein each enzyme in the first group of enzymes of the mevalonate pathway comprises a peroxisomal targeting signal.

6. The modified yeast cell of claim 4, wherein ERG20 and ERG9 each comprise a peroxisomal targeting signal.

7. The modified yeast cell of claim 1, wherein the peroxisome targeting signal is located at the C-terminus of one or more of the first group of enzymes of the mevalonate pathway.

8. The modified yeast cell of claim 1, wherein the peroxisomal targeting signal is located at the N-terminus of one or more of the first group of enzymes of the mevalonate pathway.

9. The modified yeast cell of claim 1, wherein the peroxisome targeting signal is peroxisome targeting sequence 1 (PTS1), peroxisome targeting sequence 2 (PTS2), or peroxisome targeting sequence 3 (PTS3).

10. The modified yeast cell of claim 9, wherein PTS1 is the amino acid sequence Serine-Lysine-Leucine (SKL).

11. The modified yeast cell according to claim 1, wherein the lipase is a triacylglycerol lipase derived from Thermomyces lanuginosus.

12. The modified yeast cell according to claim 1, wherein the second group of enzymes having triacylglycerol synthesis activity comprises acetyl-CoA carboxylase (ACC1), diacylglycerol acyltransferase (DGA1), NAD+-dependent G3P dehydrogenase (GPD1), or any combination thereof.

13. The modified yeast cell according to claim 2, wherein the third group of enzymes having acetyl-CoA synthesis activity comprises pyruvate carboxylase (PYC1), ATP:citrate lyase (ACL), citrate carrier YHM2, acetyl-CoA synthetase, or any combination thereof. The modified yeast cell according to claim 13 , wherein the ACL is derived from Mus musculus .

15. The modified yeast cell of claim 13, wherein the acetyl-CoA synthetase is derived from Salmonella enterica.

16. The modified yeast cell of claim 15, wherein the acetyl-CoA synthetase comprises an L641P amino acid substitution mutation relative to wild-type acetyl-CoA synthetase.

17. The modified yeast cell according to claim 3, wherein the fourth group of enzymes having β-oxidation activity includes POX1, POX2, POX3, POX4, POX5, POX6, multifunctional β-oxidation protein (MFE1), 3-ketoacyl-CoA thiolase (POT1) or any combination thereof.

18. The modified yeast cell of claim 1, wherein the modified yeast cell is an oleaginous yeast cell.

19. The modified yeast cell of claim 18, wherein the oleaginous yeast cell is a Yarrowia cell.

20. The modified yeast cell of claim 19, wherein the Yarrowia cell is Yarrowia lipolytica.

21. A method for producing squalene, the method comprising: The modified yeast cell of claim 1 is cultured in a culture medium for a sufficient time to produce squalene in the peroxisomes of the modified yeast cell.

22. The method of claim 21, further comprising extracting squalene from the modified yeast cell culture.

23. The method of claim 21, wherein the culture medium comprises yeast extract, peptone, glucose and an aqueous buffer.

24. The method of claim 21, wherein the culture medium comprises acetate.

25. The method of claim 21, wherein the culture medium comprises acetate and a limited amount of one or more sugars.

26. The method of claim 25, wherein the one or more sugars comprises glucose, fructose and / or xylose.

27. The method of claim 21, wherein the culture medium comprises a buffer, optionally wherein the buffer is phosphate buffered saline.

28. The method of claim 21, wherein the sufficient time is at least 6 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 192 hours.

29. The method of claim 21, wherein at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L, or more than 1.5 g / L of squalene is in the culture medium.

30. The method of claim 21, wherein at least 0.1 g / L, at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 1.0 g / L, at least 1.5 g / L, or more than 1.5 g / L of squalene is extracted from the modified yeast cell culture.

31. The method of claim 21, wherein at least 25 mg / g dry cell weight (DCW), at least 50 mg / g DCW, at least 100 mg / g DCW, at least 150 mg / g DCW, or greater than 150 mg / g DCW of squalene is extracted from the modified yeast cell culture.

Images