Application of a pycnoporus sanguineus fermentation broth

Abstract

The present application relates to a kind of pilat phlebiopsis fermentation liquor and its application, pilat phlebiopsis fermentation liquor is prepared using the following method: pilat phlebiopsis (Phlebiopsis pilatii) HE39 is inoculated into culture medium and fermented, centrifuged, and the supernatant is taken;The preservation number of pilat phlebiopsis (Phlebiopsis pilatii) HE39 is CGMCC No.41168.The pilat phlebiopsis fermentation liquor provided in the present application can be used for degrading lignin and cellulose, has good degradation ability to lignin in ground combustible, has good laccase activity, lignin peroxidase and manganese peroxidase activity, and can improve the weight loss rate of forest ground combustible.

Description

[0001] This invention is a divisional application. The original Chinese patent application number was 202411792677.3, the application date was December 7, 2024, and the patent title at the time of application was: A strain of *Pseudomonas pilosa* and its application. Technical Field

[0002] This invention belongs to the field of microbial technology, and in particular relates to the application of a fermentation broth of *Pyrola piraceae*. Background Technology

[0003] Forest litter is the primary source of forest ground cover fuels, and lignin is a major component of these fuels. The degradation of forest ground cover fuels relies on the catalysis of a complex lignin-degrading enzyme system secreted by lignin-degrading fungi, consisting of extracellular oxidoreductases such as laccase (Lac), lignin peroxidase (LiP), and manganese peroxidase (MnP). Basidiomycetes, such as white rot fungi, exhibit a particularly strong ability to degrade lignin. The lignin degradation capacity varies significantly among different fungal strains and is closely related to the growth conditions of the strains.

[0004] Kang Yue et al. screened a strain of Aspergillus nidus from garden waste. Through solid-state fermentation experiments, it showed good degradation effect on lignin in common garden wastes such as Euonymus alatus, Juniperus chinensis and Forsythia suspensa in Beijing. The lignin degradation rate was 15.77%-29.90% higher than the control (Kang Yue, Li Suyan, Sun Xiangyang, et al. Screening, identification and ability study of lignin-degrading fungi in garden waste [J]. Forestry Science Research, 2019, 32(3):80-87.). Zhang Fangfang et al. screened one strain of Fomitopsis bipinnatifida and one strain of Fomitopsis subnigricans from 16 strains of white rot fungi. The degradation rate of lignin in corn stalks reached 13.60% and 21.87%, respectively (Zhang Fangfang, Zhang Tong, Dai Dan, et al. Screening of highly efficient lignin-degrading bacteria and their degradation effect on corn stalks [J]. Acta Mycologica Sinica, 2021, 40(7):1869-1880.). Yang Li et al. determined the optimal culture conditions for enzyme production, including optimal culture time, temperature, dissolved oxygen, inoculum quantity, and pH, through liquid fermentation studies of the *Trichoderma atroviride* strain Z-1, which exhibits significant lignin-degrading enzyme activity (Yang Li, Sun Xiaodong, Li Linlin, et al. Screening of *Trichoderma* strains producing lignin-degrading enzymes and their enzyme production characteristics [J / OL]. *Acta Mycosystema Sinica*, 1-9 [2024-08-02]. https: / / doi.org / 10.13346 / j.mycosystema.240032.).

[0005] Applying lignin-degrading fungi can improve the lignin degradation rate, and optimizing the culture conditions of the strains can further enhance their enzyme activity, thereby promoting lignin degradation. However, obtaining suitable strains and their prepared fermentation broths is a key issue. Currently, there are no reports on the degradation of lignin or cellulose in forest trees by *Pseudomonas pilosa* and its fermentation broth. Domestic and international research on lignin biodegradation mainly focuses on the paper industry, biocomposting, environmental protection, and feed and food industries, with relatively little research conducted in forest fire prevention. In the forestry field, due to differences in tree species, the lignin-degrading strains will have varying abilities to degrade lignin in different types of trees. Summary of the Invention

[0006] In view of the problems existing in the prior art, the present invention provides an application of the fermentation broth of *Pterygium pilatum*. The fermentation broth provided by the present invention can be used to degrade lignin and cellulose, prepare preparations for degrading lignin and / or cellulose, etc. It has a good degradation ability for lignin / cellulose in ground cover combustibles, and has good laccase activity, lignin peroxidase and manganese peroxidase activity, which can improve the weight loss rate of forest combustibles.

[0007] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0008] This invention provides a strain of Phlebiopsispilatii, strain name Phlebiopsispilatii HE39, accession number CGMCC No.41168, which was deposited on February 5, 2024 at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China.

[0009] This invention conducted a screening study on fungi capable of degrading lignin in forest ground cover combustibles and preliminarily optimized the composition of their culture medium, providing a basis for expanding new approaches to reduce ground cover combustible loads using lignin-degrading strains. The study found that the strain HE39 provided by this invention has excellent degradation capabilities for lignin and cellulose in ground cover combustibles, exhibiting good laccase activity, lignin peroxidase activity, and manganese peroxidase activity, which can improve the weight loss rate of forest ground combustibles.

[0010] This invention provides a method for preparing Phlebiopsis pilatii fermentation broth, comprising the following steps: inoculating the above-mentioned Phlebiopsis pilatii HE39 into a culture medium for fermentation, centrifuging, and collecting the supernatant.

[0011] Furthermore, the culture medium is PDB medium or fermentation medium.

[0012] Furthermore, in the fermentation medium, the carbon source is selected from any one or more of sucrose, corn flour, soluble starch, and glucose.

[0013] Furthermore, in the fermentation medium, the nitrogen source is selected from any one or more of tryptone, soybean flour, yeast powder, and malt extract.

[0014] Furthermore, in the fermentation medium, the inorganic salts are selected from any one or more of calcium chloride, sodium chloride, magnesium sulfate, and potassium dihydrogen phosphate.

[0015] Furthermore, the fermentation medium contained 10.0 g / L of carbon source, 20.0 g / L of nitrogen source, and 3.0 g / L of inorganic salts.

[0016] Using the above-mentioned culture medium is beneficial to improving the enzyme production activity of strain HE39.

[0017] Furthermore, the culture time is 5-7 days.

[0018] Further, the mixture was cultured under shaking at a speed of 160 rpm.

[0019] Furthermore, the centrifugation conditions were 4000 rpm for 10 min.

[0020] The fermentation broth of *Pyrola pilata* provided by the present invention can be used in any of (1) to (5), and the fermentation broth of *Pyrola pilata* is prepared by the above method;

[0021] (1) Degradation of lignin and / or cellulose;

[0022] (2) Preparation of formulations that degrade lignin and / or cellulose;

[0023] (3) Degrading forest ground cover combustibles;

[0024] (4) Produces lignin-degrading enzymes;

[0025] (5) Increase the weight loss rate of combustibles in forest land.

[0026] The fermentation broth prepared by this invention has a good ability to degrade lignin and cellulose in ground cover combustibles, and has good laccase activity, lignin peroxidase and manganese peroxidase activity, which can improve the weight loss rate of forest combustibles.

[0027] The present invention provides a method for using the above-mentioned *Pterygodium pilatum* fermentation broth, comprising the following steps: treating lignin or lignin-containing substances with the above-mentioned *Pterygodium pilatum* fermentation broth.

[0028] The above methods can also be used as methods for degrading lignin / cellulose, degrading ground cover combustibles, increasing the activity of lignin-degrading enzymes, and increasing the weight loss rate of forest combustibles. Attached Figure Description

[0029] Figure 1 The percentages of different fungal genera are shown.

[0030] Figure 2 The left image shows the color reaction of colony 2-1-24 on guaiacol-PDA, and the right image shows the decolorization reaction of colony HE-1-3-⑨ on aniline blue-PDA plate.

[0031] Figure 3 The graph shows the degradation effect of strain HE-1-3-⑨ on filter paper strips.

[0032] Figure 4 This is the result of changes in the content of degraded cellulose in ground cover combustibles indoors.

[0033] Figure 5 This shows the colony growth status of strain HE-1-3-⑨.

[0034] Figure 6 Phylogenetic tree of lignin-degrading bacterium HE39 based on rDNA-ITS sequence.

[0035] Figure 7 The experimental results show the changes in the cellulose degradation rate of ground cover combustibles under different microbial agent treatments. Detailed Implementation

[0036] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0037] Lignin-degrading fungi are widely used in the biodegradation of lignin. To explore the degradation effect of lignin-degrading fungi on forest ground cover combustibles, combustibles from broadleaf Korean pine forests, aspen-birch mixed forests, larch-birch mixed forests, and red spruce forests were used as the source of degrading fungi and the test samples. The mass loss and lignin content of the combustibles after degradation were measured. The results showed that a strain with excellent lignin degradation ability in ground cover combustibles was screened and identified as Phlebiopsis pilatii HE39. This strain initially showed strong lignin degradation ability, with lignin degradation rates of 19.69% and 16.01% in poplar and spruce combustibles after 10 days of treatment, respectively. After 60 days of treatment, the weight loss rates of larch-birch and spruce combustibles were 23.00% and 22.00%, respectively. Sucrose, soybean flour, and calcium chloride were the optimal carbon source, nitrogen source, and inorganic salt for enzyme production of strain HE39, respectively. The optimized fermentation medium formula (g / L) was determined to be: sucrose 10.0, soybean flour 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.

[0038] Unless otherwise specified, the experimental methods used in this invention are all conventional methods in the art; the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art, which can be obtained through commercial channels or prepared by conventional methods by those skilled in the art.

[0039] Study Area Overview: The study area is located at the Yitong Forest Pest Natural Enemy Breeding Demonstration Base of the Jilin Provincial Academy of Forestry Sciences, geographically situated at 124°50′–125°46′E and 43°03′–43°38′N. It has a continental monsoon climate with an average annual temperature of 2.8℃, a frost-free period of 120–140 days, and an average annual precipitation of 723 mm. The average altitude of the experimental site is 300 m. The main forest stands include broadleaf Korean pine (Pinuskoraiensis), Manchurian ash (Fraxinus mandshurica), Mongolian oak (Querus mongolica), white birch (Betula platyphylla), aspen (Populus davidiana), larch (Larix gmelinii), and mixed forests. The soil in the study area is predominantly dark brown forest soil.

[0040] PDA medium is prepared according to the following ratio: 200g potato, 20g glucose, 20g agar, 3g KH2PO4, 1.5g MgSO4·7H2O, 0.01g VB1, and 1000mL distilled water.

[0041] PDA-guaiacol medium: Guaiacol is added to PDA medium, with a final concentration of 0.02% by volume.

[0042] PDA-Aniline Blue Medium: Add aniline blue to PDA medium to a final concentration of 0.1 g / L.

[0043] PDB medium is prepared according to the following ratio: 200g potato, 20g glucose, 3g KH2PO4, 1.5g MgSO4·7H2O, 0.01g VB1, and 1000mL distilled water.

[0044] Hutchison's medium was prepared in the following proportions: 1.0 g KH2PO4, 0.1 g NaCl, 0.3 g MgSO4·7H2O, 2.5 g NaNO3, 0.01 g FeCl3, 0.1 g CaCl2, 1000 mL distilled water, pH 7.2.

[0045] The malt extract culture medium was prepared according to the following ratio: 10.0g glucose, 20.0g malt extract, 0.5g Tween 80, 3.0g KH2PO4, and 1000mL distilled water.

[0046] The basal culture medium was prepared according to the following proportions: 10.0g glucose, 20.0g malt extract powder, 3.0g KH2PO4, 0.5g Tween 80, 1000mL distilled water, and natural pH.

[0047] CMC-Na medium is prepared in the following proportions: 10.0g sodium carboxymethyl cellulose, 4.0g ammonium sulfate, 2.0g potassium dihydrogen phosphate, 0.5g magnesium sulfate heptahydrate, 10.0g peptone, 15.0g agar, and 1000mL distilled water.

[0048] In the examples, primers ITS1 and ITS4 were both synthesized by Shanghai Sangon Biotech.

[0049] In this embodiment, if data statistics and analysis are involved, Excel and Origin software are used to perform statistical analysis on the data.

[0050] The following is a description through specific embodiments.

[0051] Example 1

[0052] Plot setup and sample collection: Representative sites were selected from four forest types in the study area—broadleaf Korean pine forest, aspen-birch mixed forest, birch-larch mixed forest, and pure red spruce (Picea koraiensis) forest—based on indicators such as altitude, aspect, slope gradient, and slope position. Five 1m × 1m quadrats were randomly set up within each forest type plot. In the summer of 2022, undecomposed and semi-decomposed ground cover combustibles were collected as sources of degradation bacteria and samples for degradation experiments.

[0053] Strain isolation and identification: Samples of combustible ground cover from different decomposition layers were moderately pulverized, placed in sterile water, and shaken to mix. The mother liquor was diluted to a series of concentration gradients (10, 20, and 30-fold dilutions). The diluted solutions were plated on PDA agar plates containing streptomycin (200 μg / L) and incubated at 28°C for 5 days. Single colonies with significantly different morphological characteristics were selected, repeatedly isolated and purified to obtain pure strains, which were then numbered and stored. Fungal genomic DNA was extracted and amplified by PCR using primers ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO:1) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO:2). After 1% agarose gel electrophoresis, the unpurified product was sequenced by Shanghai Sangon Biotech Co., Ltd. Based on the ITS sequencing results, sequence alignment was performed using BLAST on NCBI. Combined with existing related ITS sequences in GenBank, a phylogenetic tree was constructed using MEGA 5.1 software.

[0054] A total of 62 fungal strains were isolated using the above methods. The isolated strains were classified and identified by morphological observation and ITS-rDNA sequencing. They were identified as 21 species belonging to 18 genera: *Aspergillus*, *Cerrena*, *Coniochaeta*, *Coniothyrium*, *Discosia*, *Fusarium*, *Phoma*, *Paraconiothyrium*, *Paramyrothecium*, *Peniophora*, *Pestalotiopsis*, *Phlebiopsis*, *Plectosphaerella*, *Trichoderma*, *Microdiplodia*, *Myrothecium*, *Schizophyllum*, and *Letendraea*. Among them, *Pseudomonas* was the dominant genus, accounting for 55% of the total isolated strains. This was followed by *Pseudomonas* and *Pseudomonas*, accounting for 11% and 6% of the total isolated strains, respectively. Figure 1 ).

[0055] Example 2

[0056] 2.1 Screening for lignin-degrading fungi: One representative strain from each of the 21 identified species was selected for screening lignin-degrading fungi. The ability of the strains to secrete extracellular lignin-degrading enzymes was assessed using the guaiacol plate staining method and the aniline blue plate destaining method. Mycelial discs were prepared at the edge of pure strain colonies and inoculated into the center of PDA-guaiacol plates. The plates were incubated at 28°C. After 5 days of growth, colonies with clearly defined colored zones were selected. The diameters of the colonies and colored zones on the PDA-guaiacol medium were measured using calipers. Strains with a high ratio of colored zone to colony diameter were selected. The selected mycelial discs were inoculated onto PDA-aniline blue plates and incubated at 28°C. The formation time of the destaining zone was observed and recorded, and the diameters of the colonies and destaining zones on the PDA-aniline blue medium were measured using calipers.

[0057] The guaiacol colorimetric method can effectively reflect the laccase activity of the strains, while the decolorization of aniline blue is related to the production of lignin peroxidase and manganese peroxidase. Through observation and calculation, only strains from the genera *Phlebiopsis*, *Cerrena*, *Paraconiothyrium*, *Coniothyrium*, *Letendraea*, and *Peniophora* among the 18 genera were able to oxidize guaiacol and produce a colorimetric zone. Figure 2 ), including HE-1-3-⑨ and YM-1-3- Nine fungi, including YM-3-4-⑥, 2-1-24, YM-1-4-⑤, 2-1-36, Red 1-3-4-⑥, YY-3-3-③, and 1-2-25, have relatively large chromogenic zones, as shown in Table 1. Their φC / φF ratios are all greater than 1, suggesting they may be lignin-degrading fungi with high laccase production activity. Among them, Red 1-3-4-⑥, HE-1-3-⑨, 2-1-24, and YM-1-4-⑤ can also decolorize aniline blue. Figure 2 These bacteria can produce peroxidase, and it is preliminarily determined that the four strains are lignin-degrading fungi.

[0058] Table 1. Results of guaiacol plate color development and aniline blue plate decolorization.

[0059]

[0060]

[0061] Note: φF: Colony diameter; φC: Diameter of the color development zone; φD: Diameter of the decolorization zone.

[0062] 2.2 Screening of cellulose-degrading fungi

[0063] (1) Cellulose-degrading strains were screened using the Congo red staining method. The purified strains were inoculated in a triangular pattern onto CMC-Na agar plates and incubated at 28°C. After colonies grew on the plates, Congo red reagent was added to the medium for staining, followed by destaining with 1 mol / L NaCl solution. Colonies producing hydrolysis zones were selected, and the diameter of the hydrolysis zone and the colony on the CMC-Na agar plate were measured using calipers. Strains with the larger ratio were selected for filter paper strip degradation tests to verify the actual degradation ability of the cellulose-degrading strains.

[0064] Experimental Results: The identified strains were inoculated onto CMC-Na plates and cultured. After staining and destaining, six strains from the genera *Coniochaeta*, *Pestalotiopsis*, *Aspergillus*, *Coniothyrium*, *Phlebiopsis*, and *Cerrena* showed prominent hydrolysis zones with a φH / φF ratio greater than 1. These strains were HE-1-3-⑨, 1-1-41, 1-2-1, 2-1-24, YY-3-3-⑥, and 2-2-32, respectively. These six strains were preliminarily identified as cellulose-degrading fungi. The size of the colonies and their surrounding hydrolysis zones is shown in Table 2. The size of the hydrolysis zone is related to the amount and activity of cellulase produced by the fungus; a larger hydrolysis zone indicates a stronger ability of the strain to degrade cellulose. Among them, strain HE-1-3-⑨ had a significantly higher φH / φF ratio than the other tested strains, indicating that it had the greatest potential for cellulase production.

[0065] Table 2. Results of CMC-Na plate staining

[0066] Note: φH: Diameter of the hydrolysis zone

[0067] (2) Filter paper strip degradation test, including the following steps: Mycelial cakes were prepared at the edge of the colonies of the selected strains, inoculated into PDB medium, and cultured at 28℃ and 160 rpm for 5 days to obtain the strain seed culture. The culture was then centrifuged to obtain the bacterial suspension. Filter paper strips were added to Hutchison's inorganic salt medium, and 1 mL of bacterial suspension was inoculated. The culture was then cultured at 28℃ and 160 rpm, and the degradation of the filter paper strips was observed periodically. The degradation ability of the cellulose-degrading bacteria was judged based on the degree of breakage of the filter paper strips.

[0068] 7-15 days after inoculation with each strain, the filter paper strips showed signs of ulceration. The degradation effect of strain HE-1-3-⑨ on the filter paper strips is shown in the figure below. Figure 3 As shown, this indicates that strain HE-1-3-⑨ has the ability to degrade cellulose.

[0069] Based on the above results, it can be seen that strain HE-1-3-⑨ has the ability to degrade both lignin and cellulose.

[0070] Example 3

[0071] Degradation test of ground cover combustibles: The strains screened in Example 2 were inoculated onto PDA plates and cultured at 28℃ for 7 days. Mycelial cakes were prepared in areas with vigorous mycelial growth using a punch (φ=6mm). The mycelial cakes were inoculated into Erlenmeyer flasks containing 100mL of PDB medium and cultured at 28℃ and 160rpm for 7 days with constant temperature shaking. After centrifugation at 4000rpm for 10min, the supernatant was taken as the lignin-degrading strain suspension.

[0072] The undecomposed surface combustible samples from Example 1 were dried to constant weight and cut into small pieces. 2g of the small pieces were weighed and placed in a 50mL Erlenmeyer flask containing 20mL of malt extract medium. 600μL of bacterial suspension (i.e., the lignin-degrading bacterial suspension prepared using the above method) was inoculated to determine the mass loss of combustibles and lignin content during the degradation process. Separate Erlenmeyer flasks containing combustible samples from different forest types were prepared, with an equal volume of sterile water added as a control. All Erlenmeyer flasks were placed in an incubator and cultured at 25℃ and 80% humidity. Sampling began on day 10 after inoculation. Three samples from Erlenmeyer flasks treated with different bacterial suspensions were taken each time to determine the mass loss, lignin content, and cellulose content. Sampling was repeated every 10 days, with the final sample taken on day 60.

[0073] Take the degraded ground cover combustible sample from the Erlenmeyer flask, remove the surface hyphae with tweezers, dry to constant weight, and calculate the mass loss rate of the sample after degradation.

[0074]

[0075] Qingdao Standard Testing Group Co., Ltd. used the ELISA double antibody sandwich method to determine the lignin and cellulose content of ground cover combustible samples during the degradation process, and calculated the lignin degradation rate and cellulose degradation rate.

[0076]

[0077] The study found that YM-1-4-⑤ had a slow growth rate and was not suitable for degradation. Therefore, considering the growth rate of the strains, three strains—Red 1-3-4-⑥, HE-1-3-⑨, and 2-1-24—were selected for ground cover combustible degradation experiments. Table 3 shows that during the 60 days of degradation, the overall mass of ground cover combustibles in each forest stand type exhibited a fluctuating decreasing trend, with significant weight loss in the first 10 days, reaching a maximum of 25.17%. The weight loss rate of combustibles varied among different forest stand types. The overall weight loss rate of larch-birch, spruce, and poplar-birch combustibles was higher than that of broadleaf Korean pine combustibles. After 60 days of degradation, the highest weight loss rates for larch-birch, spruce, and poplar-birch combustibles reached 23.00%, 22.00%, and 26.33%, respectively, while the highest weight loss rate for broadleaf Korean pine combustibles was only 11.83%. Among them, the highest weight loss rates of larch-birch and spruce combustibles both occurred after degradation by the bacterial strain HE-1-3-⑨.

[0078] Table 3. Changes in the mass loss of combustibles from different forest cover types during degradation.

[0079]

[0080] During the degradation process, the lignin content in ground cover combustibles showed significant differences under different microbial treatments (Table 4). In the first 10 days, except for broadleaf Korean pine combustibles, the lignin content in combustibles from other forest stand types decreased rapidly, consistent with the mass loss of combustibles in the same stage. The weight loss of combustible samples may be partly attributed to lignin degradation. Among them, the microbial strain HE-1-3-⑨ first showed a strong lignin degradation ability. The highest lignin degradation rates in poplar and spruce combustibles both occurred after degradation by HE-1-3-⑨, reaching 19.69% and 16.01%, respectively. During the 10-20 day period, the lignin content in spruce combustibles degraded by strains Red 1-3-4-⑥ and HE-1-3-⑨ continuously decreased, while the lignin content in broadleaf Korean pine combustibles treated with strain 2-1-24 increased, showing enrichment. Considering the entire degradation process, the lignin degradation effects in spruce and birch combustibles were superior to those in larch-birch and broadleaf Korean pine combustibles, with the highest degradation rates after 60 days being 23.42% and 23.28%, respectively. Strains Red 1-3-4-⑥ and HE-1-3-⑨ exhibited strong lignin degradation capabilities. Based on the speed of lignin degradation, strain HE-1-3-⑨ was identified as the target strain.

[0081] Table 4. Changes in lignin content of combustibles from different forest cover types during degradation.

[0082]

[0083] Changes in cellulose content in ground cover combustibles of different forest stand types are as follows: Figure 4 As shown in the figure, similar to lignin, cellulose content decreased significantly from 0 to 10 days. The largest decrease was observed in broadleaf Korean pine forest combustibles, with a degradation rate approximately 1.79-2.83 times that of other combustibles. By the end of the indoor degradation process, strain HE-1-3-⑨ exhibited higher activity and the best cellulose degradation effect compared to other strains, with a degradation rate of approximately 16.79%-21.90%. After 60 days of degradation, compared among different forest stand types, broadleaf Korean pine forest combustibles showed the greatest decrease in cellulose content and the highest degree of degradation.

[0084] Based on the results of indoor degradation experiments on ground cover combustibles, strains Red 1-3-4-⑥ and HE-1-3-⑨ exhibited relatively high lignin degradation capabilities, while strain HE-1-3-⑨ showed relatively strong cellulose degradation capabilities. Although strain 2-1-24, previously screened, possessed the ability to degrade both lignin and cellulose, its performance was poor when using ground cover combustibles as the degradation substrate. Therefore, strains Red 1-3-4-⑥ and HE-1-3-⑨ were ultimately selected as the source strains for the preparation of the inoculant and applied in field degradation experiments.

[0085] Example 4: Strain Identification

[0086] After incubating strain HE-1-3-⑨ on PDA medium at 28℃ for 7 days, the colony surface of strain HE-1-3-⑨ showed a white, fluffy appearance, with slender hyphae that were relatively evenly and loosely distributed. Figure 5 ).

[0087] Based on the ITS sequencing results, the ITS sequence of strain HE-1-3-⑨ was aligned with the type strain and closely related strains in GenBank, and a phylogenetic tree was constructed using MEGA 5.1 software. The phylogenetic analysis results are shown below. Figure 6 The strain HE-1-3-⑨ was identified as Phlebiopsis pilatii and named HE39.

[0088] On February 5, 2024, strain HE-1-3-⑨ was deposited at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China. The strain name is HE39, and it is recommended to classify it as Phlebiopsis pilatii. The accession number is CGMCC No. 41168.

[0089] Example 5

[0090] Culture medium composition optimization: The following components were selected as carbon source, nitrogen source, and inorganic salt to replace glucose, malt extract powder, and potassium dihydrogen phosphate in the basal culture medium.

[0091] The specific experimental method includes the following steps:

[0092] Strain HE39 was inoculated onto PDA plates and cultured at 28℃ for 7 days. Mycelial cakes were prepared in areas of vigorous mycelial growth using a punch (φ=6mm). These cakes were then inoculated into Erlenmeyer flasks containing 100mL of PDB medium and cultured at 28℃ with shaking at 160rpm for 7 days. After centrifugation at 4000rpm for 10 minutes, the supernatant was collected as the lignin-degrading strain suspension, used as the seed culture for subsequent experiments. The seed culture was inoculated into 250mL Erlenmeyer flasks containing 50mL of the corresponding medium (3% by volume), and cultured at 28℃ and 180rpm for 3 days. After centrifugation, the supernatant was collected to determine the enzyme activities of LiP, MnP, and Lac. LiP enzyme activity was determined by Qingdao Kechuang Quality Testing Co., Ltd. using an ELISA kit; MnP enzyme activity was determined by Qingdao Kechuang Quality Testing Co., Ltd. using an ELISA kit; Lac enzyme activity was determined by Qingdao Kechuang Quality Testing Co., Ltd. using an ELISA kit.

[0093] Based on the combined results of various enzyme activity assays, the optimal carbon source, nitrogen source, and inorganic salts were selected as the new fermentation medium formula, providing a source of nutrients for the subsequent formulation of field degradation agents.

[0094] Different carbon sources: sucrose, corn flour, and soluble starch were used to replace glucose in the basal medium, respectively;

[0095] Different nitrogen sources: yeast extract, tryptone, and soybean meal were used to replace the malt extract in the basal culture medium, respectively.

[0096] Different inorganic salts: potassium dihydrogen phosphate in the basal culture medium was replaced with calcium chloride, sodium chloride, and magnesium sulfate, respectively.

[0097] The effects of different nutrient components (carbon source, nitrogen source, and inorganic salts) in the basal culture medium on the lignin-degrading enzyme production capacity of strain HE39 were analyzed, and the results are shown in Table 5. According to the enzyme activity assay results, when sucrose was used as the carbon source, the LiP and MnP of strain HE39 reached their maximum values, at 568.27 U / L and 42.32 U / L, respectively; when soybean meal was used as the nitrogen source, the Lac activity of strain HE39 reached its maximum value, at 100.53 U / L; and when calcium chloride was used as the inorganic salt, the LiP activity of strain HE39 was the highest. In summary, sucrose, soybean meal, and calcium chloride are the optimal carbon source, nitrogen source, and inorganic salt for enzyme production of strain HE39, respectively. Based on this, the optimized fermentation medium (g / L) was determined as follows: sucrose 10.0, soybean meal 20.0, calcium chloride 3.0, and Tween 80 0.5. This formulation will be used as the nutrient source for subsequent inoculum preparation.

[0098] Table 5 Enzyme production activity of strain HE39 under different culture medium components.

[0099]

[0100]

[0101] Furthermore, the study found that the degradation rate of lignin increased intermittently during the degradation process, exhibiting an enrichment phenomenon. This may be due, on one hand, to lignin, as a recalcitrant substance, binding with other macromolecules in ground cover combustibles, such as cellulose, to form a barrier structure, restricting the entry of microorganisms and inhibiting their physiological metabolic activities. On the other hand, the rapid loss of readily decomposable components (soluble carbon, nitrogen, phosphorus, etc.) in ground cover combustibles during the initial stages of degradation leads to a rapid decrease in their proportion within the combustibles, thus increasing the proportion of recalcitrant components such as lignin and affecting its degradation rate. Therefore, research on lignin degradation in ground cover combustibles needs to comprehensively consider the influence of other components.

[0102] Lignin-degrading bacteria have applications in multiple fields. In agriculture, by screening highly efficient lignin-degrading bacteria and optimizing enzyme production conditions, they can be applied to the degradation of agricultural waste (straw) to improve degradation efficiency. In animal husbandry, lignin-degrading bacteria can be used to break down the lignin structure in plant-based feed, improving animal digestibility and utilization, thereby reducing feed costs. In industry, lignin-degrading fungi can be used to construct co-culture systems for the biological pretreatment of straw, reducing the structural barrier of lignin biomass and effectively improving the efficiency of biomass conversion to biofuels. In forestry, lignin-degrading bacteria can be used to improve soil quality and structure, enhance plant growth efficiency, and thus promote ecosystem stability.

[0103] Example 6 Field Degrading Bacterial Agent and its Preparation Method

[0104] Fermentation medium (g / L): sucrose 10.0, soybean flour 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.

[0105] The method for preparing the inoculum includes the following steps: Selecting the screened fungus HE39 as the source strain for inoculum preparation. Opening a pure culture plate of the strain in a sterile operating table, using a sterilized punch (6mm outer diameter) to create mycelial cakes in areas of vigorous mycelial growth, inoculating 40 mycelial cakes into a 1000mL Erlenmeyer flask containing 400mL of fermentation medium, and incubating at 28℃ and 160rpm with constant temperature shaking for 5 days. Centrifuging at 4000rpm for 10min and collecting the supernatant yields the degraded inoculum.

[0106] Example 7

[0107] The field degradation experiment was conducted in pure stands of birch and larch, and mixed stands of Mongolian oak and Scots pine at the Yitong Base of the Jilin Academy of Forestry Sciences. One 10m × 10m standard plot was set up for each forest type, and three 1m × 1m quadrats were set up within each standard plot. Ground cover combustibles were collected from the quadrats before the start of field degradation, dried to constant weight, and then placed in nylon mesh bags (10.0g per bag). The forest type and sample number were marked on the bags, the initial weight was recorded, and the bags were returned to the quadrats and secured with metal mesh.

[0108] Selected degrading fungal strains were chosen as the source strains for inoculant preparation. In a sterile operating room, the pure culture plate of the degrading strain was opened, and mycelial cakes were prepared in areas of vigorous mycelial growth using a sterilized punch (6 mm outer diameter). Forty mycelial cakes were inoculated into 1000 mL Erlenmeyer flasks containing 400 mL of optimized fermentation medium, with 0.5 g of Tween 80 added. The flasks were incubated at 28℃ and 160 rpm for 5 days with constant temperature shaking to obtain the degrading strain suspension, which was then bottled for later use. Three dosages (low, medium, and high, 50 mL, 100 mL, and 150 mL respectively) were manually sprayed onto nylon mesh bags in small sample plots. Spraying should be as uniform as possible to ensure that all combustible materials in the bags are in contact with the inoculant. Each standard plot of the three forest types underwent the same treatment. Combustible material samples were collected every 14 days, with 5 bags taken each time, for a total of 6 samplings. The cellulose content of the samples was determined. The method for detecting cellulose degradation rate is as described in Example 3.

[0109] The field degradation effect of cellulose in ground cover combustibles, such as Figure 7 As shown, with the extension of degradation time, the cellulose degradation rate of combustibles from different forest types treated with fungal agents HE39 and H46 (the fungal agent prepared from Red 1-3-4-⑥ according to the method in Example 6) showed an increasing trend, and was significantly higher than that of the control group (no fungal agent used). By the end of the field degradation, the cellulose degradation rates of combustibles from birch, larch, and Mongolian oak-Pinus sylvestris forests were 15.29%-20.59%, 8.66%-12.68%, and 14.32%-18.66%, respectively, which were 1.74-2.69 times, 1.79-3.08 times, and 4.01-5.53 times higher than the control, respectively. Throughout the degradation process, the degradation effect of fungal agent HE39 was consistently better than that of fungal agent H46; the cellulose degradation effect among different doses of both fungal agents was high dose > medium dose > low dose > control group.

[0110] Example 8

[0111] The experimental method was the same as in Example 7. Field degradation effect: The lignin degradation effect in the ground cover combustibles of birch, larch, and Mongolian oak-Pinus sylvestris forests treated with the fungal agent was better than that in the control group without the fungal agent. After 84 days of field degradation, the lignin degradation rate reached a maximum of 23.48%.

[0112] This invention qualitatively screened four lignin-degrading fungi from ground cover combustible samples collected in the field. Through measurements of combustible mass loss and lignin degradation rate during ground cover combustible degradation experiments, strain HE39 was ultimately identified as having a strong overall lignin degradation capacity. Its degradation significantly increased both the mass loss of ground cover combustibles and the lignin degradation rate, indicating the feasibility and further research and development value of using lignin-degrading fungi to reduce ground cover combustible load. In this invention, the weight loss rate of poplar and birch combustibles was the highest, reaching 26.33% after 60 days of degradation; after degradation by HE39, its lignin degradation rate reached 23.28%, higher than that of other fungal treatments.

[0113] The lignin-degrading strain HE39 screened in this invention promotes the degradation of lignin in ground cover combustibles. Therefore, to achieve efficient degradation of ground cover combustibles, other strains with degradation capabilities can be introduced in practical applications to prepare compound microbial agents, and the optimal enzyme production conditions can be explored to achieve synergistic degradation effects. This invention can provide a basis for using microorganisms to reduce forest combustible load, thereby lowering forest fire risk levels and fire losses.

[0114] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of a *Pyrola piraceae* fermentation broth in any one of (1) to (5), characterized in that, The fermentation broth of *Pyrola pilata* was prepared by the following method: *Pyrola pilata* (… Phlebiopsis pilatii HE39 was inoculated into culture medium for fermentation, centrifuged, and the supernatant was collected; Pilatus pilatus ( Phlebiopsis pilatii HE39 has the accession number CGMCC No. 41168; (1) Degradation of lignin and / or cellulose; (2) Preparation of formulations that degrade lignin and / or cellulose; (3) Degrading forest ground cover combustibles; (4) Produces lignin-degrading enzymes; (5) Increase the weight loss rate of combustibles in forest land.

2. The application according to claim 1, characterized in that, The culture medium is PDB medium or fermentation medium.

3. The application according to claim 2, characterized in that, In the fermentation medium, the carbon source is selected from any one or more of sucrose, corn flour, soluble starch and glucose; the nitrogen source is selected from any one or more of tryptone, soybean flour, yeast powder and malt extract; and the inorganic salt is selected from any one or more of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

4. The application according to claim 3, characterized in that, The fermentation medium contained 10.0 g / L of carbon source, 20.0 g / L of nitrogen source, and 3.0 g / L of inorganic salts.

5. The application according to any one of claims 1-4, characterized in that, The culture temperature was 28℃; the culture time was 5-7 days; the culture was carried out with shaking at 160 rpm; and the centrifugation conditions were 4000 rpm for 10 min.

6. A method for using *Pyrola piraceae* fermentation broth, characterized in that, Includes the following steps: The fermentation broth of *Pyrola pilata* was treated with lignin or lignin-containing substances. The fermentation broth of *Pyralidus pilatus* was prepared by the following method: *Pyralidus pilatus* (… Phlebiopsis pilatii HE39 was inoculated into culture medium for fermentation, centrifuged, and the supernatant was collected; Pilatus pilatus ( Phlebiopsis pilatii HE39 has the accession number CGMCC No. 41168.

7. The method of use according to claim 6, characterized in that, The culture medium is PDB medium or fermentation medium.

8. The method of use according to claim 7, characterized in that, In the fermentation medium, the carbon source is selected from any one or more of sucrose, corn flour, soluble starch and glucose; the nitrogen source is selected from any one or more of tryptone, soybean flour, yeast powder and malt extract; and the inorganic salt is selected from any one or more of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

9. The method of use according to claim 8, characterized in that, The fermentation medium contained 10.0 g / L of carbon source, 20.0 g / L of nitrogen source, and 3.0 g / L of inorganic salts.

10. The method of use according to any one of claims 6-9, characterized in that, The culture temperature was 28℃; the culture time was 5-7 days; the culture was carried out with shaking at 160 rpm; and the centrifugation conditions were 4000 rpm for 10 min.

Images