IPSCs residual detection method and application thereof

Abstract

The invention relates to an iPSCs (induced pluripotent stem cells) residue detection method and application thereof. The detection method comprises the following steps: taking an LINC00678 (Accession: NR102708.1) gene as a gene for detecting the specificity of iPSCs; according to the detection method disclosed by the invention, the rapid and simple technical effect can be realized, the lower detection limit of the residual level of the iPSCs can reach one hundred thousandth level, the detection cost is low, and the detection is more efficient.

Description

Technical Field

[0001] The present application relates to the technical field of iPSCs residual detection, and specifically to an iPSCs residual detection method and application thereof. Background Art

[0002] Induced pluripotent stem cells (iPSCs, iPS cells) possess pluripotency and the potential to differentiate into virtually any cell type. Numerous industrial studies have explored the production of therapeutic cells through the differentiation of iPSCs. However, incomplete differentiation often occurs during the differentiation of iPSCs into target cells. Due to the tumorigenic capacity of iPSCs, iPSC residuals have become a critical parameter for iPSC-derived cell therapy products.

[0003] Currently, existing methods for detecting residual iPSCs include immunostaining-based detection methods, ELISA-based detection methods, flow cytometry-based detection methods, and PCR-based methods. Finding specific markers of iPSCs cells compared to other cells is the basis of all the above detection methods. In theory, any iPSCs-specific molecular characteristics can be used as detection indicators, including proteins, metabolites, RNA, glycosylation modifications, etc. Common pluripotency markers include OCT4 、 NANOG , SSEA4, TRA-1-60 and TRA-1-81, among which OCT4 and NANOG The product of TRA-1-60 is a transcription factor localized in the nucleus, while SSEA4, TRA-1-60, and TRA-1-81 are characteristic cell surface protein modifications. All of the common pluripotency markers mentioned above can be detected using immunostaining, but the main challenges are low specificity and sensitivity, and the detection of intracellular markers is time-consuming. Flow cytometry presents similar challenges to immunostaining, but flow cytometry tends to use cell surface antigens as detection targets, and apoptosis of iPSCs during processing may result in low test results. ELISA is often used to detect secreted markers and has high sensitivity, but also high nonspecificity and high cost. PCR methods offer higher sensitivity than other methods and can also have good specificity, though specificity is affected by factors such as the detection target, primer design, and reaction conditions. Compared to conventional PCR, digital PCR can significantly improve detection sensitivity, but at a higher cost. Furthermore, common pluripotency markers are not sufficient for detecting residual iPSCs below 1 in 10,000. Summary of the Invention

[0004] In response to the above-mentioned deficiencies in the prior art, the present application provides a rapid, simple, low-cost, and efficient method for detecting residual iPSCs that can reduce the detection limit of residual iPSCs to 1 in 100,000.

[0005] In order to solve the above technical problems, the technical solution adopted in this application is: a method for detecting residual iPSCs, which uses LINC00678 (Accession: NR_102708.1) gene was used as a gene for detecting iPSCs specificity.

[0006] Furthermore, the low-cost and high-sensitivity iPSCs residual detection method described in this application, LINC00678 The gene is used as a specific gene for detecting iPSCs residual in iPSCs differentiated cells.

[0007] Furthermore, the present application describes a low-cost, high-sensitivity method for detecting residual iPSCs, which utilizes qRT-PCR.

[0008] Furthermore, the present application describes a low-cost, highly sensitive method for detecting residual iPSCs, which utilizes dye-based qRT-PCR.

[0009] Furthermore, the dye-based qRT-PCR method uses specific primers, and the sequences of the specific primers are as follows: Forward primer: 5′-CCAACGAACATCTCACCAAT-3′; Reverse primer: 5′-TCCCGTCATTCTGCTAACAC-3′; or Forward primer: 5′-CCTGCGAGACGCAACAGAAT-3′; Reverse primer: 5′-ACTCCACCTGACCATTGCCT-3′; or Forward primer: 5′-GATACCCTGCGAGACGCAAC-3′; Reverse primer: 5′-CTCCACCTGACCATTGCCTG-3′.

[0010] Furthermore, the detection limit of the iPSCs residual detection method is 1 in 100,000.

[0011] Furthermore, the coefficient of determination of the regression equation of the sample dilution linear detection corresponding to the iPSCs residual detection method was 0.9924.

[0012] Furthermore, in the dye-based qRT-PCR amplification reaction system, the concentration of the forward primer is 100-500 nM, and the concentration of the reverse primer is 100-500 nM.

[0013] Furthermore, the dye-based qRT-PCR is specifically as follows: The sample sources described are: mesenchymal stem cells (MSC), iPSCs, Passage 0 iPSCs-derived mesodermal progenitor cells (iPSCs-MPC), Passage 2 iPSCs-MPC cDNA, Passage 0 iPSCs-derived vascular endothelial cells (iPSCs-VEC), Passage 1 iPSCs-VEC, Passage 2 iPSCs-VEC; LINC00678 Primer sequences: Forward primer: 5′-CCAACGAACATCTCACCAAT-3′; Reverse primer: 5′-TCCCGTCATTCTGCTAACAC-3′; or Forward primer: 5′-CCTGCGAGACGCAACAGAAT-3′; Reverse primer: 5′-ACTCCACCTGACCATTGCCT-3′; or Forward primer: 5′-GATACCCTGCGAGACGCAAC-3′; Reverse primer: 5′-CTCCACCTGACCATTGCCTG-3′.

[0014] q-PCR kit: SuperReal fluorescent quantitative premix reagent enhanced version; The reaction system for qRT-PCR is: 20 μL

[0015] The reaction procedure for qRT-PCR is as follows:

[0016] The present application also provides an application of an iPSCs residual detection method in a kit, the kit comprising reagents: 2xSuperReal PreMix Plus, Primer (S+AS, 5 μM), cDNA Template, 50× ROX Reference Dye, DNase / RNase-free water (enzyme-free sterile water); Include LINC00678 Primer sequences: Forward primer: 5'-CCAACGAACATCTCACCAAT-3', Reverse primer: 5′-TCCCGTCATTCTGCTAACAC-3′; or Forward primer: 5′-CCTGCGAGACGCAACAGAAT-3′; Reverse primer: 5′-ACTCCACCTGACCATTGCCT-3′; or Forward primer: 5′-GATACCCTGCGAGACGCAAC-3′; Reverse primer: 5′-CTCCACCTGACCATTGCCTG-3′.

[0017] Advantages and beneficial effects of this application: 1. In the iPSCs residual detection method of the present application, it was found through screening that LINC00678 The specificity of expression in iPSCs cells is stronger than some common pluripotency-related genes. qRT-PCR results show LINC00678 There is a high expression level in iPSCs cells. In the cDNA dilution experiment, use LINC00678 The detection limit of cells as a detection indicator is about 1 / (5X10 5 ), which is higher than the detection limit of 1 / 10000 residual iPSCs when using common pluripotency markers as detection indicators; Therefore, the detection method of the present application is only based on LINC00678 This type of long non-coding RNA can achieve highly sensitive detection of iPSCs residuals, which reduces the detection limit of iPSCs residual levels to one in one hundred thousand and can be quantified.

[0018] 2. This application is selected LINC00678 Afterwards, specific PCR primer sequences were designed: forward primer CCAACGACATCTCACCAAT, reverse primer TCCCGTCATTCTGCTAACAC. LINC00678The primer design of the gene enables the detection of high expression in iPSCs and intermediate mesodermal progenitor cells (MPCs) differentiated from iPSCs to VECs when using PCR dye method to detect iPSCs remnants. LINC00678 The expression of β-actin was detected in Passage 0 iPSCs-VEC at a lower level. LINC00678 The expression of β-actin was not detected in MSC, Passage 1 iPSCs-VEC and Passage 2 iPSCs-VEC. LINC00678 expression.

[0019] 3. This application developed a standard curve for detecting residual iPSCs using the qRT-PCR method: Sample source: iPSCs cDNA; Detection indicators: LINC00678 ; LINC00678 Primer sequences: Forward primer: CCAACGAACATCTCACCAAT; Reverse primer: TCCCGTCATTCTGCTAACAC; or Forward primer: 5′-CCTGCGAGACGCAACAGAAT-3′; Reverse primer: 5′-ACTCCACCTGACCATTGCCT-3′; or Forward primer: 5′-GATACCCTGCGAGACGCAAC-3′; Reverse primer: 5′-CTCCACCTGACCATTGCCTG-3′.

[0020] q-PCR Kit: SuperReal Fluorescence Quantitation Premix Enhanced Edition (Brand: TIANGEN, Cat. No.: FP205) qRT-PCR reaction procedures and systems: refer to implementation case 3; iPSCs cDNA serial dilution: After extracting total RNA from iPSCs, reverse transcribe it into cDNA. Use DNase / RNase-free water to perform serial dilutions of the iPSCs cDNA stock solution. The dilution ratio between adjacent samples should be 1:2, 1:4, 1:5, or 1:10.

[0021] Sample preparation was as shown in Table 7 below. iPSCs cDNA was diluted with DNase / RNase-free water. LINC00678As a detection indicator to construct a standard curve of iPSCs content, the qRT-PCR method can stably detect close to 1 / (5X10 5 The determination coefficient of the regression equation was 0.9847, and the residual of the regression model tended to increase with the increase of dilution multiple.

[0022] 4. Previous detection of iPSCs residues tended to use more pluripotency-related marker genes, mainly protein-encoding genes and some pluripotent stem cell-specific protein modification characteristics. LINC00678 are non-protein-coding genes; in our scenario, LINC00678 The effect is better than others; compared with methods such as ELISA, PCR has stronger detection capabilities and lower costs; this application uses a dye-based q-PCR method to achieve better detection effects, and its cost is lower than the probe-based q-PCR method; and this application uses conventional q-PCR, which does not require high-cost detection equipment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 . RT-PCR gel electrophoresis results of pluripotency-related genes 1. Each row is a cell sample, and each column is the RT-PCR gel electrophoresis results of a pair of primers for a pluripotency-related gene.

[0024] Figure 2 . RT-PCR gel electrophoresis results of pluripotency-related genes 2. Each row represents a cell sample, and each column represents the RT-PCR gel electrophoresis results of a pair of primers for a pluripotency-related gene.

[0025] Figure 3 . Different cell samples LINC00678 The amplification curve and melting curve of the qRT-PCR test results. Each curve corresponds to a reaction system, and the color of the curve represents the source of the sample corresponding to the curve.

[0026] Figure 4 Amplification and melting curves of qRT-PCR results showing the linearity of dilution of iPSC cDNA samples using ACTB as the detection indicator. Each curve corresponds to a reaction system, and the color of the curve represents the iPSC content in the sample corresponding to the curve.

[0027] Figure 5Regression model and residuals for the linearity of iPSC cDNA sample dilution using ACTB as the detection indicator. Each point corresponds to a reaction system. In the left figure, the X-axis and Y-axis represent the CT value of the qRT-PCR result corresponding to a system and the -log10-transformed value of the iPSC content in the sample corresponding to the system, respectively. In the right figure, the X-axis and Y-axis represent the -log10-transformed value of the iPSC content in the sample corresponding to a system and the residuals of the regression model's prediction of the iPSC content in that system, respectively.

[0028] Figure 6 . by LINC00678 The amplification curve and melting curve of the qRT-PCR results were used to construct the standard curve for iPSCs content detection. Each curve corresponds to a reaction system, and the color of the curve represents the iPSCs content in the sample corresponding to the curve.

[0029] Figure 7 . by LINC00678 A regression model and residuals of the standard curve for iPSCs content detection were constructed for detection indicators. Each point corresponds to a reaction system. In the left figure, the X-axis and Y-axis represent the CT value of the qRT-PCR result corresponding to a system and the -log10-transformed value of the iPSCs content in the sample corresponding to the system, respectively. In the right figure, the X-axis and Y-axis represent the -log10-transformed value of the iPSCs content in the sample corresponding to a system and the residuals of the regression model's prediction of the iPSCs content in the system, respectively.

[0030] Figure 8 The effect of the constructed standard curve for iPSC content detection on the prediction of iPSC content in a mixture of iPSCs and MSCs; each point corresponds to a reaction system, with the X-axis representing the -log10-converted value of the iPSC content predicted using the standard curve and the Y-axis representing the -log10-converted value of the actual iPSC content in the sample corresponding to the system.

[0031] Figure 9 The predicted effect of the constructed standard curve for iPSC content detection on the iPSC content in a mixture of iPSCs and iPSCs-VECs; each point corresponds to a reaction system, with the X-axis representing the -log10-converted value of the iPSC content predicted using the standard curve and the Y-axis representing the -log10-converted value of the actual iPSC content in the sample corresponding to the system. DETAILED DESCRIPTION

[0032] The following will be combined with the embodiments and drawings to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the embodiments described are only preferred embodiments, not all embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this invention.

[0033] Implementation Case 1: Design and Synthesis of Primers LINC00678 (Accession: NR_102708.1), designed using Primer5 LINC00678 The specific primers were selected and their specificity was verified by primer blast. The primer information is shown in Table 1 below: Table 1 LINC00678 Specific primers

[0034] Implementation Case 2: LINC00678 Expression-specific detection (RT-PCR method) Sample sources: Mesenchymal stem cell (MSC) cDNA, iPSCs cDNA, Passage 0 iPSCs-derived mesodermal progenitor cell (iPSCs-MPC) cDNA, Passage 2 iPSCs-MPC cDNA, Passage 0 iPSCs-derived vascular cell (iPSCs-VEC) cDNA, Passage 1 iPSCs-VEC cDNA, Passage 2 iPSCs-VEC cDNA LINC00678 Primer sequences: Forward primer: CCAACGAACATCTCACCAAT (5′-3′); Reverse primer: TCCCGTCATTCTGCTAACAC (5′-3′); PCR reagents: Premix Taq Version 2.0 plus dye (Takara, RR901A) The PCR reaction system is shown in Table 2 below: 20 μL Table 2 PCR reaction system

[0035] The PCR reaction program is shown in Table 3 below: Table 3 PCR reaction procedure

[0036] Experimental results: The results of RT-PCR assay showed that compared with some common pluripotency marker genes ( LIN28A , ZSCAN10 , CAMKV , IDO1 , L1TD1 , VRTN-1 , CNMD , ESRG-3 , LDHA , POU5F1 , NANOG , TUBB , CRIPTO ), LINC00678 The specificity is better ( Figure 1 and 2 ).

[0037] Implementation Case 3: LINC00678 Expression-specific detection (qRT-PCR method) Sample source: iPSCs cDNA, MSC cDNA, P0 iPSCs-MPC cDNA, P2 iPSCs-MPC cDNA, P0 iPSCs-VEC cDNA, P1 iPSCs-VEC cDNA, P2 iPSCs-VEC cDNA; LINC00678 Primer sequences: Forward primer: CCAACGAACATCTCACCAAT (5'-3'), Reverse primer: TCCCGTCATTCTGCTAACAC (5′-3′); q-PCR Kit: SuperReal Fluorescence Quantitation Premix Enhanced Edition (TIANGEN, FP205) The qRT-PCR reaction system is shown in Table 4 below: 20 μ Table 4 PCR reaction system

[0038] The qRT-PCR reaction procedure is shown in Table 5 below: Table 5 qRT-PCR reaction procedure

[0039] Experimental results: Using qRT-PCR, we could detect higher expression of cytokines in iPSCs and P0 iPSCs-MPCs. LINC00678 The expression of β-actin was detected in P0 iPSCs-VEC cells. LINC00678 The expression of MPCP1 was not detected in MSC, P2 iPSCs-MPCP1 iPSCs-VEC and P2 iPSCs-VEC cells. LINC00678 The expression ( Figure 3 ).

[0040] Implementation Case 4: Sample Dilution Linearity Detection (qRT-PCR Method) Sample source: iPSCs cDNA Detection index: ACTB Primer sequences: ACTB-F, GAGCTGCGTGTGGCT (5'-3'); ACTB-R, GCACAGCCTGGATAGCAAC (5'-3'); q-PCR Kit: SuperReal Fluorescence Quantitation Premix Enhanced Edition (Brand: TIANGEN, Cat. No.: FP205) qRT-PCR reaction procedure and system: Same as implementation case 3; iPSCs cDNA concentration gradient dilution: After extracting iPSCs total RNA, it is reverse transcribed into cDNA. The iPSCs cDNA stock solution is serially diluted using DNase / RNase-free water. The dilution ratio between adjacent samples is 1:2, 1:4, 1:5, or 1:10.

[0041] The sample preparation is shown in Table 6 below: Table 6 Sample preparation

[0042] Experimental results: When iPSCs cDNA was diluted with DNase / RNase-free water and ACTB was used as the detection index, the qRT-PCR method could stably detect nearly 1 / 10 6 The coefficient of determination of the regression equation for the iPSCs cell content was 0.9924, and the residual of the regression model tended to increase with the increase of dilution multiple (see Figure 4 and 5 ).

[0043] Case Study 5: Developing a Standard Curve for Detecting iPSC Residues Using qRT-PCR Sample source: iPSCs cDNA Detection indicators: LINC00678 LINC00678Primer sequences: Forward primer: CCAACGAACATCTCACCAAT (5′-3′); Reverse primer: TCCCGTCATTCTGCTAACAC (5′-3′); q-PCR Kit: SuperReal Fluorescence Quantitation Premix Enhanced Edition (Brand: TIANGEN, Cat. No.: FP205) qRT-PCR reaction procedure and system: same as implementation case 3 iPSCs cDNA concentration gradient dilution: After extracting iPSCs total RNA, it is reverse transcribed into cDNA. The iPSCs cDNA stock solution is serially diluted using DNase / RNase-free water. The dilution ratio between adjacent samples is 1:2, 1:4, 1:5, or 1:10.

[0044] The sample preparation is shown in Table 7 below: Table 7 Sample preparation

[0045] Experimental results: When iPSCs cDNA was diluted with DNase / RNase-free water, LINC00678 As a detection indicator, the qRT-PCR method can stably detect close to 1 / (5X10 5 ) of iPSCs cell content, the coefficient of determination of the regression equation was 0.9847, and the residual of the regression model tended to increase with the increase of dilution multiple ( Figure 6 and 7 ).

[0046] Case Study 6: Detection of iPSCs Content in a Mixture of iPSCs and MSCs Sample source: (iPSCs + MSC) cDNA Detection indicators: LINC00678 ; LINC00678 Primer sequences: Forward primer: CCAACGAACATCTCACCAAT (5′-3′); Reverse primer: TCCCGTCATTCTGCTAACAC (5′-3′); q-PCR Kit: SuperReal Fluorescence Quantitation Premix Enhanced Edition (Brand: TIANGEN, Cat. No.: FP205) qRT-PCR reaction procedure and system: Same as implementation case 3; iPSCs cell gradient dilution: iPSCs and MSCs were digested and resuspended separately, and the cell concentration was adjusted to 1 × 10 after counting. 6 The iPSC suspension was serially diluted with MSC suspension. Total RNA was extracted from the mixed iPSC and MSC cells and reverse transcribed into cDNA for qRT-PCR analysis.

[0047] Experimental results: Under the condition of gradient dilution of iPSCs using MSCs, LINC00678 As a detection indicator, based on the test results of two batches, the standard curve regression model was used to predict the content of iPSCs in different samples. The correlation coefficients between the predicted values ​​and the true values ​​were all above 0.99 ( Figure 8 ).

[0048] Case Study 7: Detection of iPSCs Content in a Mixture of iPSCs and iPSCs-VECs Sample source: (iPSCs + Passage 2 iPSCs-VEC) cDNA Detection indicators: LINC00678 LINC00678 Primer sequences: Forward primer: CCAACGAACATCTCACCAAT (5′-3′); Reverse primer: TCCCGTCATTCTGCTAACAC (5′-3′); q-PCR Kit: SuperReal Fluorescence Quantitation Premix Enhanced Edition (Brand: TIANGEN, Cat. No.: FP205) qRT-PCR reaction procedure and system: same as implementation case 3 iPSCs cell gradient dilution: iPSCs and Passage 2 iPSCs-VECs were digested and resuspended separately. After counting, the cell concentration was adjusted to 1 × 10 6 The iPSC suspension was serially diluted using Passage 2 iPSCs-VEC suspension. Total RNA was extracted from the mixed iPSCs and Passage 2 iPSCs-VEC cells, reverse transcribed into cDNA, and used for qRT-PCR analysis.

[0049] Experimental results: When iPSCs were serially diluted using Passage 2 iPSCs-VEC, LINC00678As a detection indicator, based on the test results of 4 batches, the standard curve regression model was used to predict the content of iPSCs in different samples. The correlation coefficients between the predicted values ​​and the true values ​​were all above 0.99 ( Figure 9 ).

[0050] It can be seen from the above embodiments that this application adopts LINC00678 The specificity of expression in iPSCs cells is stronger than some common pluripotency-related genes. qRT-PCR results show LINC00678 There is a high expression level in iPSCs cells; in the cDNA dilution experiment, use LINC00678 The detection limit of cells as a detection indicator is about 1 / (5X10 5 ), which is higher than the detection limit of 1 / 10,000 residual iPSCs when using common pluripotency markers as detection indicators.

Claims

1. A method for detecting residual iPSCs, characterized by: This detection method uses LINC00678 (Accession: NR_102708.1) gene was used as a gene for detecting iPSCs specificity.

2. The method for detecting residual iPSCs according to claim 1, wherein: The LINC00678 The gene is used as a specific gene for detecting iPSCs residual in iPSCs differentiated cells.

3. The method for detecting residual iPSCs according to claim 2, wherein: The detection method uses qRT-PCR.

4. The method for detecting residual iPSCs according to claim 3, wherein: The detection method uses dye-based qRT-PCR.

5. The method for detecting residual iPSCs according to claim 4, wherein: The dye-based qRT-PCR method uses specific primers, the sequences of which are as follows: Forward primer: 5′-CCAACGAACATCTCACCAAT-3′; Reverse primer: 5′-TCCCGTCATTCTGCTAACAC-3′; or Forward primer: 5′-GATACCCTGCGAGACGCAAC-3′; Reverse primer: 5′-CTCCACCTGACCATTGCCTG-3′.

6. The method for detecting residual iPSCs according to claim 5, wherein: The detection limit of this detection method is one in one hundred thousand.

7. The method for detecting residual iPSCs according to claim 5, wherein: The determination coefficient of the regression equation for the sample dilution linear detection corresponding to this detection method is 0.9924.

8. The method for detecting residual iPSCs according to claim 5, wherein: In the dye-based qRT-PCR amplification reaction system, the concentration of the forward primer is 100-500 nM, and the concentration of the reverse primer is 100-500 nM.

9. The method for detecting residual iPSCs according to claim 8, wherein: The dye-based qRT-PCR method is specifically as follows: The reaction system for qRT-PCR is: 20 μL 。 10. The method for detecting residual iPSCs according to claim 9, wherein: The dye-based qRT-PCR method is specifically as follows: The reaction procedure for qRT-PCR is as follows: Melting curve analysis.

11. Use of a method for detecting residual iPSCs in a kit, characterized in that: The kit contains the following reagents: 2xSuperReal PreMix Plus, Primer (S+AS, 5 μM), cDNA Template, 50× ROX Reference Dye, DNase / RNase-free water; Primer sequences containing LINC00678: Forward primer: 5′-CCAACGAACATCTCACCAAT-3′; Reverse primer: 5′-TCCCGTCATTCTGCTAACAC-3′; or Forward primer: 5′-CCTGCGAGACGCAACAGAAT-3′; Reverse primer: 5′-ACTCCACCTGACCATTGCCT-3′; or Forward primer: 5′-GATACCCTGCGAGACGCAAC-3′; Reverse primer: 5′-CTCCACCTGACCATTGCCTG-3′.

Images