Application of GAL-5B protein and coding gene thereof in regulating and controlling raffinose accumulation of wheat grains

Abstract

The invention discloses an application of GAL-5B protein and a coding gene thereof in regulating and controlling raffinose accumulation of wheat grains. The agronomic characters and quality characters of a GAL-5B mutant and transgenic GAL-5B wheat are analyzed, and it is found that due to GAL-5B protein function deficiency, raffinose accumulation in wheat grains can be remarkably promoted, meanwhile, the starch content in the grains is reduced, and the protein content in the grains is increased; and the overexpression of GAL-5B reduces the raffinose content in the wheat grains. It is found for the first time that the GAL-5B protein and related biological materials thereof can be used for regulating and controlling the raffinose content in plant seeds, and the GAL-5B protein and the related biological materials can play an important role in cultivating functional wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of GAL-5B protein and its encoding gene in regulating raffinose accumulation in wheat grains. Background Art

[0002] Raffinose family oligosaccharides (RFOs) are a class of oligosaccharides derived from sucrose and characterized by varying numbers of galactosyl groups attached to the glucose residues. Previous studies have shown that RFOs are widely involved in plant responses to abiotic stress and accumulate during grain seed maturation. Once ingested, RFOs are indigestible due to their specialized glycosidic bonds and are instead absorbed by intestinal probiotics. This increases their biomass, which in turn reduces obesity-related health risks by producing short-chain fatty acids or promoting bile acid metabolism.

[0003] Studies have found that the RFOs synthesized and accumulated in monocots are almost exclusively raffinose, while in dicots, the higher-polymerized stachyose and verbascose are predominant. During metabolism, raffinose family oligosaccharides can be hydrolyzed to a fructose terminal by β-fructofuranosidase (β-FFase), or to multiple galactosyl groups attached to glucose residues by α-galactosidase (α-GAL), ultimately becoming monosaccharides and sucrose, which then enter other metabolic pathways.

[0004] Because humans lack endogenous digestive enzymes that break down α-(1,6) glycosidic bonds, raffinose oligosaccharides (RFOs) in food cannot be directly digested and absorbed by the human body. However, these oligosaccharides can be absorbed and utilized by human intestinal probiotics. These RFOs, which exhibit these characteristics, belong to the class of dietary fibers known as nondigestible oligosaccharides (NDOs) and are considered a class of prebiotics with important functions. Studies have shown that consuming a certain amount of RFOs significantly increases the biomass of bifidobacteria in the intestinal microbiota that efficiently utilize these substrates. Adding RFOs or galactooligosaccharides (GOS) to the diet of mice fed a high-fat diet significantly improves serum total cholesterol, low-density lipoprotein cholesterol, lipopolysaccharide (LPS), and total bile acid levels, reduces liver steatosis, and mitigates obesity-related health risks. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to regulate the accumulation of raffinose in wheat grains.

[0006] In order to solve the above technical problems, the present invention first provides a new use of GAL-5B protein or a substance for regulating the content and / or activity of the GAL-5B protein.

[0007] The present invention provides the use of a GAL-5B protein or a substance for regulating the content and / or activity of the GAL-5B protein in any of the following A1) to A5): A1) Regulating the raffinose content in plant seeds; A2) Regulate starch content in plant grains; A3) Regulate the protein content in plant seeds; A4) breeding plants with altered raffinose and / or starch and / or protein content in their grain; A5) Plant breeding or plant variety improvement; The GAL-5B protein is any one of the following B1) to B4): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

[0008] In the protein described in B2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. Such tags include, but are not limited to, GST (glutathione sulfhydryltransferase)-tagged proteins, His6-tagged proteins (His-tag), MBP (maltose binding protein)-tagged proteins, Flag-tagged proteins, SUMO-tagged proteins, HA-tagged proteins, Myc-tagged proteins, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein), or AviTag-tagged proteins.

[0009] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0010] In the protein described in B4) above, the identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of a pair of amino acid sequences can be calculated by searching in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can be obtained. The identity includes amino acid sequences having 80% or greater, 85% or greater, 90% or greater, 91% or greater, 92% or greater, 93% or greater, 94% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, or 99% or greater homology to the amino acid sequence set forth in SEQ ID NO: 2 of the present invention.

[0011] The proteins described in B1) to B4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0012] In the above application, the substance that regulates the content and / or activity of GAL-5B protein includes a substance that increases the content and / or activity of GAL-5B protein or a substance that decreases the content and / or activity of GAL-5B protein.

[0013] Furthermore, the substance that increases the activity of the GAL-5B protein may be a protein, polypeptide or small molecule compound that enhances or promotes the function of the GAL-5B protein.

[0014] The substance that increases the content of GAL-5B protein can be a substance that promotes the synthesis of GAL-5B protein, inhibits the degradation of GAL-5B protein, or overexpresses GAL-5B protein.

[0015] The substance that reduces the activity of the GAL-5B protein can be a protein, polypeptide or small molecule compound that inhibits the function of the GAL-5B protein.

[0016] The substance that reduces the content of GAL-5B protein can be a substance that inhibits GAL-5B protein synthesis or promotes GAL-5B protein degradation or knocks down (knocks down) or knocks out the gene encoding the GAL-5B protein.

[0017] Furthermore, the substance for knocking down (knockdown) the GAL-5B protein-encoding gene can be any substance that can inhibit or interfere with the expression of the above-mentioned GAL-5B protein-encoding gene, such as gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0018] The substance that knocks out the GAL-5B protein-encoding gene can be any substance that prevents the host cell from producing the functional protein product of the GAL-5B gene, such as removing all or part of the coding gene sequence, introducing mutations that prevent the production of functional protein, removing or altering regulatory components (e.g., promoter editing) that prevents transcription of the coding gene sequence, or preventing translation by binding to mRNA. Typically, the knockout is performed at the genomic DNA level, so that the knockout is permanently carried by the cell's progeny.

[0019] Furthermore, the substance for knocking out the GAL-5B protein-encoding gene may be a substance that causes the GAL-5B gene in the plant to mutate (the mutation may be a deletion mutation and / or an insertion mutation and / or a base substitution) thereby losing its activity. The mutation may be caused by any method known in the art, such as the zinc finger protein ZFN gene editing system, the TALENs gene editing system, the CRISPR / Cas9 gene editing system, T-DNA insertion, and the like.

[0020] In order to solve the above problems, the present invention provides a new use of biomaterials related to GAL-5B protein.

[0021] The present invention provides use of a biomaterial related to the GAL-5B protein in any of the following A1) to A5): A1) Regulating the raffinose content in plant seeds; A2) Regulate starch content in plant grains; A3) Regulate the protein content in plant seeds; A4) breeding plants with altered raffinose and / or starch and / or protein content in their grain; A5) Plant breeding or plant variety improvement; The biological material is any one of the following E1) to E5): E1) a nucleic acid molecule encoding the above-mentioned GAL-5B protein; E2) a nucleic acid molecule for knocking down or knocking out the above-mentioned GAL-5B protein encoding gene; E3) an expression cassette containing the nucleic acid molecule described in E1) or E2); E4) a recombinant vector containing the nucleic acid molecule described in E1) or E2); E5) A recombinant microorganism containing the nucleic acid molecule described in E1) or E2).

[0022] In the above application, the nucleic acid molecule E1) is any one of the following: F1) DNA molecule shown in sequence 1; F2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and encoding the above-mentioned GAL-5B protein.

[0023] Those skilled in the art can readily mutate the nucleotide sequence encoding the GAL-5B protein of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that are 75% or greater identical to the GAL-5B nucleotide sequence isolated from the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the GAL-5B protein and have the same function. Identity refers to sequence similarity with a naturally occurring nucleic acid sequence, including nucleotide sequences that are 75% or greater, 80% or greater, 85% or greater, 90% or greater, or 95% or greater identical to the nucleotide sequence encoding the protein consisting of the amino acid sequence set forth in Sequence 2 of the present invention. Identity can be assessed visually or using computer software. Using computer software, identity between two or more sequences can be expressed as a percentage (%), which can be used to assess identity between related sequences.

[0024] E2) The nucleic acid molecule may be gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA or antisense RNA.

[0025] Any of the above-mentioned nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0026] Any of the above-mentioned nucleic acid molecules can be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0027] Any of the above-described expression cassettes may include a promoter, the nucleic acid molecule described in E1) or E2) above, and a terminator. Promoters useful in the present invention include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Furthermore, the expression cassette may also include an enhancer sequence.

[0028] Any of the above-mentioned vectors refers to a vector capable of carrying the nucleic acid molecule described in E1) or E2) above into a host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid, viral vector (such as retrovirus (including lentivirus), adenovirus, adeno-associated virus, etc.).

[0029] Any of the above-mentioned recombinant vectors refers to a recombinant DNA molecule constructed in vitro by ligating the nucleic acid molecule described in E1) or E2) with the vector. Existing plant expression vectors can be used to construct a recombinant vector containing the nucleic acid molecule described in E1) or E2). Such plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). Such plant expression vectors may also contain the 3′ untranslated region of the exogenous gene, i.e., the polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression.

[0030] Any of the aforementioned microorganisms may be bacteria, fungi, actinomycetes, protozoa, algae or viruses. Specifically, the bacteria may be Agrobacterium (such as Agrobacterium EHA105).

[0031] Any of the above-mentioned recombinant microorganisms refers to recombinant microorganisms with altered functions obtained by genetic manipulation and modification of the target microorganism. For example, a recombinant microorganism is obtained by introducing the above-mentioned recombinant vector into the target microorganism. The recombinant microorganism can be understood to refer not only to the specific recombinant microorganism, but also to the progeny of such a cell. Due to natural, accidental, or intentional mutations and / or changes, such progeny may not be completely identical to the original parent cell, but are still included in the scope of recombinant microorganisms.

[0032] In any of the above applications, regulating the raffinose content in the plant seeds is to increase or decrease the raffinose content in the plant seeds. The regulation is negative regulation, i.e., when the GAL-5B protein content and / or activity in the plant increases, the raffinose content in the plant seeds decreases; when the GAL-5B protein content and / or activity in the plant decreases or is absent, the raffinose content in the plant seeds increases.

[0033] In a specific embodiment of the present invention, when the expression level of the GAL-5B gene in a plant is increased, the raffinose content in the plant grain is reduced.

[0034] In another embodiment of the present invention, when the GAL-5B gene in a plant is mutated to cause the loss of GAL protein function, the raffinose content in the plant grains is increased.

[0035] In any of the above applications, regulating the starch content in plant seeds is to reduce the starch content in plant seeds, which is specifically manifested as: when the GAL-5B protein content and / or activity in the plant is reduced or absent, the starch content in the plant seeds is reduced.

[0036] In a specific embodiment of the present invention, when the GAL-5B gene in a plant mutates and causes the loss of GAL-5B protein function, the starch content in the plant grains is reduced.

[0037] In any of the above applications, regulating the protein content in plant seeds is to increase the protein content in plant seeds, which is specifically manifested as: when the GAL-5B protein content and / or activity in the plant is reduced or absent, the protein content in the plant seeds is increased.

[0038] In a specific embodiment of the present invention, when the GAL-5B gene in a plant mutates and causes the loss of GAL-5B protein function, the protein content in the plant grains increases.

[0039] The purpose of any of the above plant breeding is to cultivate plant varieties with high raffinose content and / or low starch content and / or high protein content.

[0040] In order to solve the above technical problems, the present invention also provides a method for cultivating transgenic plants with increased raffinose content and / or reduced starch content and / or increased protein content in their grains.

[0041] The method provided by the present invention for cultivating transgenic plants with increased raffinose content and / or reduced starch content and / or increased protein content in their grains is method one or method two; The first method comprises the steps of reducing the content and / or activity of the GAL-5B protein in a target plant to obtain a transgenic plant; wherein the transgenic plant seeds have a higher raffinose content and / or protein content than the target plant, and a lower starch content than the target plant. Furthermore, the method for reducing the content and / or activity of the GAL-5B protein in the target plant comprises introducing a substance that reduces the content and / or activity of the GAL-5B protein into the target plant.

[0042] Method 2 comprises the following steps: replacing the base G at position 830 (corresponding to position 11516409 on chromosome 5 in the wheat genome) in the GAL-5B gene (SEQ ID NO: 1) in the plant genome with the base A to produce a transgenic plant; the transgenic plant's seeds have a higher raffinose content and / or protein content than the target plant, and a lower starch content than the target plant. Furthermore, the replacement is homozygous, meaning that the same replacement occurs on both homologous chromosomes.

[0043] In order to solve the above technical problems, the present invention finally provides a method for cultivating transgenic plants with reduced raffinose content in their grains.

[0044] The method for cultivating transgenic plants with reduced raffinose content in seeds provided by the present invention comprises the following steps: increasing the content and / or activity of the GAL-5B protein in target plants to obtain transgenic plants; the raffinose content in the seeds of the transgenic plants is lower than that of the target plants.

[0045] Furthermore, the method for increasing the content and / or activity of the GAL-5B protein in the target plant is to overexpress the GAL-5B protein in the target plant.

[0046] Furthermore, the overexpression method is to introduce the coding gene of the GAL-5B protein into the target plant.

[0047] In any of the above-described uses or methods, the transgenic plants include not only first-generation transgenic plants obtained by transforming target plants with a substance that overexpresses, suppresses, or knocks out the GAL-5B gene, but also progeny thereof. Transgenic plants can be propagated within the species in which they are grown, or they can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. Transgenic plants include seeds, callus tissue, whole plants, and cells.

[0048] In any of the above uses or methods, the plant is a monocotyledonous plant; further, the monocotyledonous plant is wheat; further, the wheat is wild-type tetraploid Durum wheat (Kronos).

[0049] The present invention is throughGAL-5B Wheat mutants and transgenics GAL-5B Analysis of wheat's agronomic and quality traits revealed that GAL-5B protein deficiency significantly promoted raffinose accumulation in wheat grains, while simultaneously reducing starch content and increasing protein. Overexpression of GAL-5B, however, reduced raffinose content in wheat grains. This discovery, the first of its kind, demonstrates that GAL-5B and related biomaterials can be used to regulate raffinose, protein, and starch content in plant grains, potentially playing a crucial role in developing functional wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 for gal-5b Identification of mutant materials. A is wild type and gal-5b Sequencing results of target genes in mutants; B is wild type, gal-5b Mutants and transgenics GAL-5B Wheat kernel phenotype.

[0051] Figure 2 For wild type, gal-5b Mutants and transgenics GAL-5B Statistics of agronomic traits of wheat. A is wild type, gal-5b Mutants and transgenics GAL-5B Thousand-grain weight of wheat; B is wild type, gal-5b Mutants and transgenics GAL-5B The number of grains per wheat plant.

[0052] Figure 3 For wild type, gal-5b Mutants and transgenics GAL-5B Statistics of wheat grain quality traits. A is wild type, gal-5b Mutants and transgenics GAL-5B Protein content in wheat grains; B is wild type, gal-5b Mutants and transgenics GAL-5B Starch content in wheat grains; C is wild type, gal-5b Mutants and transgenics GAL-5B Raffinose content in wheat grains.

[0053] Figure 4 The chromatogram of the sample is shown in Figure 2, where the red peak is the target peak. DETAILED DESCRIPTION

[0054] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0055] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0056] The tetraploid Durum wheat (Kronos) in the following examples is described in the document “Krasileva, KV, et al. (2017). "Uncovering hidden variation in polyploid wheat." Proceedings of the National Academy of Sciences 114(6): E913-E921.”

[0057] The amino acid sequence of the GAL-5B protein in Example 1 below is shown as Sequence 2 in the sequence listing, and the encoding gene sequence is shown as Sequence 1 in the sequence listing.

[0058] Example 1. Preparation of GAL-5B related genetic materials one, gal-5b Mutants and their sequence analysis gal-5b The mutant is a wheat mutant obtained by subjecting wild-type wheat Kronos to EMS mutagenesis. gal-5b Mutant seeds can be ordered from SeedStor in the UK or Dubcovsky Laboratory in the US. The mutant number is Kronos3147. gal-5b The relevant mutation information of the mutant can be found at the following website: http: / / plants.ensembl.org / Triticum_aestivum / Variation / Explore?db=core;r=5B:11515909-11516909;v=Kronos3147.chr5B.11516409;vdb=variation;vf=57902380.

[0059] Compared with the wild-type wheat Kronos genome sequence, gal-5b The only difference between the mutants is that a base mutation occurs in the gene sequence encoding the GAL-5B protein on wheat chromosome 5B (sequence 1). The base mutation is from base G to base A at position 830 of sequence 1 (corresponding to the mutation from base G to base A at position 11516409 on chromosome 5 in the wild-type wheat Kronos genome sequence). This mutation causes positions 829-831 to mutate from TGG to TAG, causing premature termination of protein translation.

[0060] gal-5b The sequencing results and grain phenotypes of the mutants were as follows Figure 1 shown.

[0061] 2. Transfer GAL-5B Preparation of wheat 1. Recombinant vector pGWB18-Ubi:: GAL-5B Construction Use the Gateway method to convert the sequence shown in sequence 1 GAL-5B The gene sequence was connected into the pDONR207 vector (Invitrogen, CAT#: 12535035) to obtain the recombinant vector pDONR207- GAL-5B , and sequenced it for verification. Sequencing showed that: GAL-5B The gene does not have any spikes.

[0062] The recombinant vector pDONR207- GAL-5B, pGWB18 vector (NCBI: txid419562) and recombinase (ThermoFisher Scientific, Cat. No. 11789100) were mixed and reacted at 22°C overnight to make the sequence shown in 1 GAL-5B The gene was recombined between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector to obtain the recombinant vector pGWB18-Ubi:: GAL-5B . Recombinant vector pGWB18-Ubi:: GAL-5B Can express GAL-5B protein.

[0063] 2. Obtaining recombinant bacteria The recombinant vector pGWB18-Ubi:: GAL-5B Transformed into Agrobacterium EHA105 (Weidi Biotechnology, CAT#: AC1010) to obtain the recombinant bacterium pGWB18-Ubi:: GAL-5B / EHA105.

[0064] 3. Transfer GAL-5B Obtaining wheat Wild-type wheat Kronos with good growth status was selected as the recipient and genetic transformation was carried out by embryo stripping method. Agrobacterium pGWB18-Ubi:: GAL-5B After infection and differentiation, screening was performed to obtain the transformed GAL-5B wheat lines, and the transgenic line Kronos, which was identified to have a significantly higher GAL-5B expression level than the wild-type wheat line GAL-5B The wheat line was designated GAL-5BOE.

[0065] Example 2: Analysis of agronomic and quality traits of GAL-5B related genetic materials 1. Analysis of agronomic traits of GAL-5B-related genetic materials Test materials: Wild tetraploid Durum wheat (Kronos), gal-5b Mutant (homozygous), transgenic GAL-5B wheat GAL-5B OE.

[0066] 1. Field planting In March 2023, the seeds were sown in the experimental field of Shangzhuang Experimental Station of China Agricultural University according to conventional methods, with a plant spacing of 5 cm and a row spacing of 20 cm. Weeding and fertilization were carried out regularly. In June, when the plants were fully mature, individual plants were harvested and threshed.

[0067] 2. Agronomic trait statistics An automatic seed analysis and thousand-kernel weight instrument (model SC-A) was used to non-destructively measure phenotypes such as thousand-kernel weight and number of kernels per plant.

[0068] The results are as follows Figure 2 The results showed that the average thousand-grain weight of wild-type wheat Kronos was 36.73±0.75 g. gal-5b The average thousand-grain weight of the mutant was 37.01±0.26 g. GAL-5B The average thousand-grain weight of wheat was 35.83±0.85 g, with no significant difference among the three varieties. The average number of grains per plant of wild-type wheat Kronos was 164±5. gal-5b The average number of grains per plant of the mutant was 168±7. GAL-5B The average number of grains per wheat plant was 159±3, and there was no significant difference among the three varieties.

[0069] 2. Analysis of quality traits of GAL-5B related genetic materials Test materials: Wild tetraploid Durum wheat (Kronos), gal-5b Mutant (homozygous), transgenic GAL-5B wheat GAL-5B OE.

[0070] 1. Field planting Same as step 1 in step 1.

[0071] 2. Quality trait statistics The starch content, protein content and raffinose content in the grains were tested.

[0072] The starch and protein content of wheat grains was determined as follows: Harvested wheat grains were stored in a dry environment for 10 months without damage. Starch and protein content was then determined using a multifunctional near-infrared analyzer (Perten, model DA7200). Simplicity software was used for routine analysis, and chemical dosimetry software was used to establish a proofreading model.

[0073] The raffinose content in the grains was determined by HPLC and calculated according to the following standard curve: y = 1.028e5x + 2.71e7 (R 2 =0.9945). The HPLC method used the following equipment: analytical balance; 0.22µm micromembrane filter; oscillating mixer; ball mill; metal bath; vacuum dessicator; Waters HPLC-QDa. The specific steps are as follows: Wheat grains (0.1g sample) were ground into powder using a ball mill. Weigh 100mg of sample. Add 1.4mL of pre-frozen 75% methanol in water and vortex. Heat at 70°C for 10 minutes, centrifuge for 10 minutes, and transfer the supernatant to a fresh centrifuge tube. Add 0.75mL of chloroform and 1.4mL of high-purity water, vortex, and centrifuge. Transfer 0.8mL of the supernatant to a 1.5mL reaction tube and dry under vacuum. Reconstitute the mixture with 0.15mL of 80% methanol and analyze on the HPLC. Gradient elution conditions are as follows: chromatographic column: Waters Amide column, injection volume: 10 μL; column temperature: 35°C; gradient elution settings (flow rate: 0.6 mL / min) as shown in Table 1; mass spectrometry monitoring ion: m / z = 503.1 (negative ion mode). The sample chromatogram is shown in Figure 4 shown.

[0074] Table 1

[0075] The results are as follows Figure 3 The results showed that the average protein content in wild-type wheat grains was 13.62±0.23%, while that in transgenic wheat grains was GAL-5B The average protein content in wheat grains is 13.22±0.54%, but gal-5b The average protein content in the mutant grains was 15.88±0.42%. gal-5b The protein content in the mutant grains was significantly increased, by more than 2%. The average starch content in wild-type wheat grains was 76.99±0.17%, and that in transgenic wheat grains was 1. GAL-5B The average starch content in wheat grains is 77.21±0.28%, but gal-5b The average starch content in the mutant grains was 74.67±0.28%. gal-5bThe starch content in the mutant grains was significantly reduced, by nearly 2%.

[0076] The average raffinose content in wild-type wheat grains was 0.3488±0.0012 μg / g, and that in transgenic wheat grains was GAL-5B The average raffinose content in wheat grains is 0.2879±0.00028 μg / g, but gal-5b The average raffinose content in the mutant grains was 1.0474±1655 μg / g. gal-5b The raffinose content in the mutant's grains was significantly increased, by 200%.

[0077] The above yield data and nutrient determination results show that interference GAL-5B, On the one hand, changing the metabolic flow of grain sugars can significantly reduce the starch content of wheat grains and reduce the sugar intake of consumers, which is expected to lower blood sugar and promote health through a mechanism similar to "sugar starvation"; on the other hand, gal-5b The raffinose content in the mutant seeds increased by 200%. As a prebiotic, it has the potential to increase the abundance of probiotics such as intestinal bifidobacteria, and is expected to achieve the reported phenomenon of enhancing the synthesis of short-chain fatty acids by intestinal microorganisms or the metabolism of human bile acids, promote human heat production, regulate blood sugar levels, and reduce the risk of obesity.

[0078] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Use of a protein or a substance for regulating the content and / or activity of the protein in any of the following A1) to A5): A1) Regulating the raffinose content in plant seeds; A2) Regulate starch content in plant grains; A3) Regulate the protein content in plant seeds; A4) breeding plants with altered raffinose and / or starch and / or protein content in their grain; A5) Plant breeding or plant variety improvement; The protein is any one of the following B1) to B4): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; B3) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

2. Use of a biomaterial related to the protein of claim 1 in any of the following A1) to A5): A1) Regulating the raffinose content in plant seeds; A2) Regulate starch content in plant grains; A3) Regulate the protein content in plant seeds; A4) breeding plants with altered raffinose and / or starch and / or protein content in their grain; A5) Plant breeding or plant variety improvement; The biological material is any one of the following E1) to E5): E1) a nucleic acid molecule encoding the protein according to claim 1; E2) a nucleic acid molecule that inhibits the expression of the gene encoding the protein according to claim 1; E3) an expression cassette containing the nucleic acid molecule described in E1) or E2); E4) a recombinant vector containing the nucleic acid molecule described in E1) or E2); E5) A recombinant microorganism containing the nucleic acid molecule described in E1) or E2).

3. The use according to claim 2, characterized in that: E1) The nucleic acid molecule is any one of the following: F1) DNA molecule shown in sequence 1; F2) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in F1) and encodes the protein.

4. The use according to any one of claims 1 to 3, characterized in that: The plant is a monocotyledonous plant.

5. The use according to claim 4, characterized in that: The monocotyledonous plant is wheat.

6. A method for cultivating transgenic plants having increased raffinose content and / or decreased starch content and / or increased protein content in their seeds, comprising the following steps: reducing the content and / or activity of the protein according to claim 1 in a target plant to obtain a transgenic plant; the raffinose content and / or protein content in the seeds of the transgenic plant is higher than that of the target plant, and the starch content is lower than that of the target plant.

7. A method for cultivating a transgenic plant having increased raffinose content and / or decreased starch content and / or increased protein content in its seeds, comprising the following steps: replacing base G at position 830 in the GAL-5B gene in the plant genome with base A to obtain a transgenic plant; the raffinose content and / or protein content in the seeds of the transgenic plant being higher than that of the target plant, and the starch content being lower than that of the target plant.

8. A method for cultivating a transgenic plant with reduced raffinose content in its seeds, comprising the steps of: increasing the content and / or activity of the protein of claim 1 in a target plant to obtain a transgenic plant; the raffinose content in the seeds of the transgenic plant is lower than that of the target plant.

9. The method according to any one of claims 6 to 8, characterized in that: The plant is a monocotyledonous plant.

10. The method according to claim 9, characterized in that: The monocotyledonous plant is wheat.

Images