Application of CsHCT1 gene in improving flavonoid content of citrus

Abstract

The present invention discloses CsHCT1 The application of genes in increasing the content of citrus flavonoid compounds belongs to the field of agricultural biological genetic engineering technology and provides CsHCT1 Application of genes in increasing the content of citrus flavonoid compounds, the CsHCT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. CsHCT1 A method for genetically increasing flavonoid compounds in citrus peel comprises the following steps: cloning citrus CsHCT1 Gene; Construction CsHCT1 Overexpression vector; transform the overexpression vector into Agrobacterium to obtain Agrobacterium liquid; inject it into citrus fruit to obtain CsHCT1 Gene overexpression in citrus fruit. The present invention provides a new option for increasing the flavonoid content in citrus peel, effectively increasing the content of vetamine-2 and / or hesperidin in citrus peel. This has significant application value for cultivating new functional citrus varieties and accelerating the breeding process.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of agricultural bioengineering technology, and particularly relates to CsHCT1 Application of a gene in increasing the content of flavonoid compounds in citrus. BACKGROUND

[0002] Citrus is the largest fruit category in China, with the largest cultivation area and yield in the world, and plays an important role in agricultural economy and food industry. Citrus fruits are rich in various nutritional and functional ingredients and bioactive secondary metabolites. These ingredients not only endow citrus with unique flavor and health value, but also exhibit significant effects in antioxidant, anti-inflammatory, and anticancer aspects. Among them, taxifolin-2 (flavonoid glycosides) and hesperidin (flavanone glycosides) are two types of substances with important biological activities, which function in multiple aspects: in plant self-defense, they can resist pathogen and pest invasion and play a role in stress resistance; in physiological activity, they can scavenge reactive oxygen species and free radicals to reduce oxidative damage, have antioxidant and photoprotective functions, and can also play an anti-inflammatory role by inhibiting pro-inflammatory factors; in the field of human health, they can help reduce the risk of cardiovascular disease mortality and reduce the risk of various cancer incidence, and can also regulate gut microbiota balance, improve metabolism and anti-obesity, and reduce the use of synthetic chemicals in food processing and improve the health value of products.

[0003] However, the molecular mechanisms of taxifolin-2 and hesperidin biosynthesis in citrus have not been fully elucidated, and the key functional genes regulating their content have not been identified. In the prior art, there is a lack of effective target for directedly increasing the content of taxifolin-2 and / or hesperidin in citrus fruit peel through genetic engineering, which makes it difficult to efficiently cultivate new citrus varieties rich in the above functional ingredients, and limits the improvement of citrus comprehensive utilization rate and the development of functional citrus industry. Therefore, it is of great significance to elucidate the mechanism of key genes regulating the synthesis of taxifolin-2 and hesperidin for promoting citrus functional breeding. SUMMARY

[0004] The application aims to provide CsHCT1 Application of a gene in increasing the content of flavonoid compounds in citrus, which provides a new option for increasing flavonoid compounds in citrus fruit peel. The application is to integrate the gene into citrus through an expression vector to effectively increase the content of taxifolin-2 and / or hesperidin in citrus fruit peel, which has great application value for cultivating new functional citrus varieties and accelerating the breeding process. CsHCT1

[0005] To solve the above technical problems, the technical solutions adopted by the application are as follows:

[0006] CsHCT1 Application of a gene in increasing the content of flavonoid compounds in citrus fruit peel, wherein the gene is a gene selected from the group consisting of SEQ ID NO: 1-4. CsHCT1 ​The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

[0007] Preferably, the content of the flavonoid compounds in the citrus peel is increased by regulating the expression level of the gene. CsHCT1 Preferably, the content of the flavonoid compounds in the citrus peel is increased by regulating the expression level of the gene.

[0008] Preferably, the flavonoid compounds in the citrus peel include tangeritin-2 and / or hesperidin.

[0009] The application also provides an overexpression vector for increasing the content of the flavonoid compounds in the citrus peel, wherein the overexpression vector comprises the gene. CsHCT1 The application also provides an overexpression vector for increasing the content of the flavonoid compounds in the citrus peel, wherein the overexpression vector comprises the gene.

[0010] The application also provides a strain for increasing the content of the flavonoid compounds in the citrus peel, wherein the strain comprises the overexpression vector.

[0011] The application also provides a method for increasing the content of the flavonoid compounds in the citrus peel by using the gene, comprising the following steps: CsHCT1 S1, cloning the gene of the citrus;

[0012] CsHCT1 S2, constructing an overexpression vector;

[0013] S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial liquid; and injecting the Agrobacterium bacterial liquid into the citrus fruit to obtain the gene overexpression citrus fruit. CsHCT1 Preferably, in S1, the cloning of the gene of the citrus is specifically as follows:

[0014] CsHCT1 Extracting total RNA of the citrus, reverse transcribing the total RNA into cDNA as a template, and performing PCR amplification by using primers OE-F and OE-R to obtain the gene of the citrus.

[0015] Preferably, the nucleotide sequence of the primer OE-F is shown as SEQ ID NO. 2, and the nucleotide sequence of the primer OE-R is shown as SEQ ID NO. 3. CsHCT1 Preferably, in S2, the construction of the overexpression vector is specifically as follows:

[0016] CsHCT1 Connecting the gene obtained in S1 to the pLGNe vector recovered by Kpn I and EcoR I enzyme digestion, transforming Escherichia coli DH5α, and constructing the overexpression vector pLGNe-. CsHCT1 CsHCT1 Preferably, in S3, the transformation of the overexpression vector into Agrobacterium is specifically as follows:

[0017] Preferably, in S3, the injection of the Agrobacterium bacterial liquid into the citrus fruit is specifically as follows: CsHCT1 CsHCT1 Preferably, in S3, the injection of the Agrobacterium bacterial liquid into the citrus fruit is specifically as follows:

[0018] Preferably, in S3, the injection of the Agrobacterium bacterial liquid into the citrus fruit is specifically as follows: CsHCT1 CsHCT1 Preferably, in S3, the injection of the Agrobacterium bacterial liquid into the citrus fruit is specifically as follows: CsHCT1 Preferably, in S3, the injection of the Agrobacterium bacterial liquid into the citrus fruit is specifically as follows:​​​​​.

[0019] Preferably, S3 further includes performing PCR identification and qRT-PCR identification after the Agrobacterium liquid is injected into the citrus fruit.

[0020] Compared with the prior art, the present invention has the following advantages and technical effects:

[0021] The present invention provides a CsHCT1 The application of genes in increasing the content of citrus flavonoid compounds was first discovered in this invention. CsHCT1 The gene expression level was positively correlated with the content of citrus venetianine-2 and / or hesperidin. CsHCT1 The higher the gene expression level, the higher the content of vetlanin-2 and / or hesperidin in citrus peel. CsHCT1 The gene was expressed in a vector, and then transformed into citrus fruit. The flavonoid content of the transgenic material was as high as 22.65% higher than that of the citrus fruit transformed with the empty vector. Figure 1 The gene can be used as a candidate gene for the breeding of new citrus varieties with increased vetamine-2 and / or hesperidin content, and is of great significance for the use of genetic engineering methods to cultivate new functional citrus varieties, accelerate the breeding process, reduce the breeding workload and improve the comprehensive utilization rate of citrus.

[0022] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] CsHCT1 In Example 1 of the present invention Figure 1 Bioinformatics analysis results of genes; among them, CsHCT1 The A in the sentence stands for Late Jincheng Figure 1 Chromosomal location of the gene, bp is base; CsHCT1 B in the sentence stands for Wanjincheng Figure 1 The structure of the gene, Exon1-2 are exons; CsHCT1 The C in it stands for Wanjincheng Figure 2 Conserved domain of the gene, aa represents amino acid;

[0024] CsHCT1 The cloned CsHCT1 Electrophoresis of PCR amplification products of gene coding sequences; CDS stands for Figure 3 gene coding sequence; M represents DNA molecular weight standard;

[0025] CsHCT1 For the present invention Figure 4 The structure of the gene overexpression vector; GUS:NPTII represents the β-glucosidase gene; P 35ST represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the opine synthase gene terminator;

[0026] Figure 4 These are photos of fruits on the day of transient transformation and 5 days after transient transformation; wherein, Figure 4 A in the figure is a photo of the fruit on the day of instantaneous transformation; Figure 4 Panel B is a photograph of the fruit cultured 5 days after transient transformation; Figure 5 C in the figure is a photo of some samples when total RNA was extracted;

[0027] CsHCT1 For the present invention Figure 6 Gene relative expression analysis results;

[0028] Figure 6 The results of the detection of the content of vecinin-2 and / or hesperidin in the peel of the Wanjin orange of the present invention are as follows: Figure 6 A in the table is the test result of the content of Vetsenin-2. CsHCT1 B in the figure is the result of hesperidin content test. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0030] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0031] Source of test materials:

[0032] In this example, Wanjin Orange was used as the experimental object.

[0033] In the present invention, unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.

[0034] Example 1

[0035] 1. Late Jincheng Orange CsHCT1 Bioinformatics analysis results of genes

[0036] Late Golden Orange Figure 1 The structure of genes CsHCT1 As shown, it is located between 21,575,941bp and 21,578,124bp on chromosome 5 of Wanjincheng, contains 2 exons, and encodes 435 amino acids.

[0037] CsHCT1 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0038] SEQ ID NO. 1:

[0039]

[0040] 2. Late Jincheng Orange CsHCT1 Cloning of gene coding sequences

[0041] 1. RNA Extraction and cDNA Synthesis

[0042] Total RNA was extracted from citrus (Wanjincheng) leaves using a plant total RNA extraction kit (Adlai, Cat: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was measured using a concentration meter. cDNA was synthesized using the reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, Cat: RR036A).

[0043] 2. CsHCT1 PCR amplification of coding sequences

[0044] Using primers OE- CsHCT1 -F (SEQ ID No. 2), OE- CsHCT1 -R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045A), with the obtained Wanjin orange cDNA as the template, and the amplification system was configured according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase.

[0045] The PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; and 72°C extension for 10 min. Figure 2 The DNA fragment of the coding sequence has a length of 1314bp (CDS sequence 1305bp-terminator 3bp+previous and next restriction enzyme cutting site bases, a total of 12bp).

[0046] Agarose gel electrophoresis results CsHCT1 As shown, the amplified fragment size results were consistent with expectations. Under ultraviolet light, a clean blade was used to cut the agarose gel containing the target fragment, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to the company for sequencing. After comparison and analysis of the sequencing results, it was determined that the obtained DNA fragment was Late Jin Orange CsHCT1 Gene coding sequence (SEQ ID NO.1).

[0047] SEQ ID No. 2:

[0048] GGTACCATGGAAATTCACATAAAAGAGTCAACACTG.

[0049] SEQ ID No.3:

[0050] GAATTCATGTTGAAGAAAAATATCATAAAATAACTTC.

[0051] III. Construction CsHCT1 Construction of overexpression vector and transformation of Agrobacterium

[0052] 1. Construction of overexpression vector

[0053] The obtained recovered DNA fragment and overexpression vector pLGNe were double-digested with restriction enzymes Kpnl and EcoRI (Thermo Fisher) and then gel-recovered and ligated at 16°C overnight. The enzyme digestion system and reaction conditions were performed according to the attached instructions (configuration). The ligation used a T4 DNA Ligase kit (Promega, CAT: M1801), and the ligation system and reaction conditions were performed according to the attached instructions of the T4 DNA Ligase kit (configuration).

[0054] The obtained ligation product was transformed into E. coli DH5a, and the transformation method used the method recorded in the attached instructions of E. coli DH5a. The plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe- CsHCT1 Figure 3 , and the vector structure is shown in CsHCT1 .

[0055] 2. Transformation of Agrobacterium with overexpression vector

[0056] The Agrobacterium competent cells EHA105 (50 μL) stored in a 2 mL centrifuge tube were thawed on ice in advance; 2 μL of the plasmid of the overexpression vector was added to the competent cells, mixed well by blowing, and then the mixture was sequentially placed on ice for 5 min, frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and placed on ice for 5 min. Then 800 μL of LB liquid medium was added to the 2 mL centrifuge tube, mixed well by blowing with a pipette, and cultured at 260 r / min and 28°C for 2 h. After the time, the bacterial solution was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial body was resuspended with 50 μL of LB liquid medium. After resuspension, it was plated on LB solid medium containing 50 mg / L kanamycin, and cultured at 28°C for 2 days. After the bacterial colonies grew, the colonies were picked and used primers ID- CsHCT1 -F (SEQ ID NO. 4) and ID- CsHCT1 ​-R (SEQ ID NO. 5), high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) was used to verify the single colony by PCR, and the amplification system was configured according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0057] SEQ ID NO. 4: TCGTTGAAGATGCCTCTGCCGACAG.

[0058] SEQ ID NO. 5: ATGTTGAAGAAAAATATCATAAAATAACTTC.

[0059] Four, the overexpression vector pLGNe- CsHCT1 was transiently transformed CsHCT1

[0060] 1. Agrobacterium infection

[0061] Select the late Jin orange fruits with consistent growth state, and disinfect them with 75% alcohol in the clean bench for standby; add 500 μL of Agrobacterium containing pLGNe and pLGNe- CsHCT1 plasmid into 50 mL of liquid LB medium (containing 50 mg / L kanamycin), and culture at 28℃, 200 r / min until OD600=0.5. Centrifuge to obtain the precipitate, resuspend the Agrobacterium in 1 / 2MS liquid medium, then randomly select four injection points on the diagonal of the equatorial surface of the disinfected late Jin orange fruits, and mark them, and inject 1 mL of Agrobacterium containing pLGNe- Figure 4 plasmid resuspension liquid into the late Jin orange peel, 1 mL per region, and mark it as the experimental group. The late Jin orange fruits injected with the same method and the same amount of Agrobacterium containing pLGNe plasmid resuspension liquid were used as the control group. The experimental group and the control group were repeated three times, and the late Jin orange fruits injected with Agrobacterium resuspension liquid were placed in a 28℃ incubator for dark culture for 5 days, and the photographs of the fruits on the day of transient transformation and after 5 days of culture are shown in CsHCT1 .

[0062] 2. qRT-PCR analysis of the late Jin orange fruits cultured for 5 days

[0063] ​Total RNA (Adlai, CAT No: RN09) was extracted from the peel of the injected area of ​​the Wanjin orange cultured in the dark at 28°C for 5 days, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT- CsHCT1 -F (SEQ ID NO. 6) and RT- CsHCT1 -R (SEQ ID NO.7). The experimental group and the control group were calculated by CsHCT1 Relative expression of genes: define the control group samples as the reference factor, that is, Figure 5 The expression level of the reference factor gene is 1, and then the expression of the experimental group samples relative to the reference factor gene is calculated. , which is the relative expression level. CsHCT1 As shown, in the experimental group CsHCT1 The gene expression level was significantly higher than that of the control group, with the highest being more than 10 times that of the control.

[0064] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0065] SEQ ID NO.6: CCCTTTCTTCATGATGGCGTAGTA;

[0066] SEQ ID NO.7: AACTTCTTAAAGAGCTGCAAGTG.

[0067] five, Figure 6 Evaluation of flavonoid content in the peel of overexpression materials

[0068] The content of vetamine-2 and / or hesperidin components in the peels of the experimental group and the control group after 5 days of culture in the above experiment was determined by UPLC-MS. The statistical results are as follows CsHCT1 As shown, compared with the control group of pLGNe cultured for 5 days, the fruits of pLGNe- CsHCT1 The contents of vecinin-2 and / or hesperidin in the peel of CsHCT1 Transient overexpression of the gene can significantly increase the content of vetacnin-2 and / or hesperidin in Wanjin orange fruit.

[0069] Therefore, the present invention first discovered CsHCT1 The gene expression level was positively correlated with the content of citrus venetianine-2 and / or hesperidin. CsHCT1The higher the expression amount of the gene is, the higher the content of the vitamin C-2 and / or hesperidin in the citrus peel is, and the culture time in the experiment is 5 days CsHCT1 The citrus with the gene overexpression vector is 22.65% higher than the citrus with the empty vector; ​ The gene can be used as a candidate gene for breeding new citrus varieties with high content of vitamin C-2 and / or hesperidin, and has important significance for cultivating functional new citrus varieties by using genetic engineering method, speeding up the breeding process, reducing the workload of breeding and improving the comprehensive utilization rate of citrus.

[0070] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application rather than limit it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: the technical solutions of the present application can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. CsHCT1 The application of the gene in increasing the content of vetamine-2 and / or hesperidin in citrus peel is characterized in that: described CsHCT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1; Improvement of citrus by overexpression CsHCT1 The expression level of the gene is increased, and the content of hesperidin-2 and / or hesperidin in citrus peel is increased.

2. An overexpression vector for increasing the content of citrus peel vecrin-2 and / or hesperidin, characterized in that: The overexpression vector comprises the CsHCT1 Gene.

3. An Agrobacterium for increasing the content of vetacnin-2 and / or hesperidin in citrus peel, characterized in that: The Agrobacterium comprises the overexpression vector according to claim 2.

4. A method of using the method according to claim 1 CsHCT1 The method for genetically increasing the production of citrus peel hesperidin-2 and / or hesperidin is characterized in that: The following steps are involved: S1. Cloned citrus CsHCT1 Gene; S2. Build CsHCT1 Overexpression vector; S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial solution; injecting the Agrobacterium bacterial solution into citrus fruits to obtain CsHCT1 Gene overexpression in citrus fruit.

5. The method according to claim 4, characterized in that: S1, the cloned citrus CsHCT1 The genes are: Total RNA was extracted from citrus and reverse transcribed into cDNA as template. CsHCT1 -F and OE- CsHCT1 -R was used for PCR amplification to obtain citrus CsHCT1 Gene; the primer OE- CsHCT1 -F nucleotide sequence is shown in SEQ ID NO.2, the primer OE- CsHCT1 The nucleotide sequence of -R is shown in SEQ ID NO.

3.

6. The method according to claim 4, characterized in that: In S2, the construction CsHCT1 The specific overexpression vector is: CsHCT1 The gene was connected to the pLGNe vector recovered by KpnⅠ and EcoRⅠ digestion and transformed into Escherichia coli DH5α to construct the overexpression vector pLGNe- CsHCT1 .

7. The method according to claim 4, characterized in that: S3 further includes performing PCR identification and qRT-PCR identification after the Agrobacterium liquid is injected into the citrus fruit.

Images