A primer set for simultaneously detecting 34 pathogenic microorganisms and 39 drug resistance genes in aquaculture and application thereof
By designing primer sets and high-throughput sequencing technology, the problem of simultaneous detection of multiple pathogenic microorganisms and drug-resistant genes in aquaculture has been solved, and rapid and accurate detection results have been achieved, supporting early diagnosis and prevention and control of aquaculture.
Patent Information
- Application Number
- CN202511126895.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-13
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2045-08-13
AI Technical Summary
Existing technologies make it difficult to simultaneously detect multiple pathogenic microorganisms and drug-resistant genes in aquaculture efficiently and at low cost, resulting in low detection efficiency and high cost, making it difficult to meet the needs of rapid diagnosis and prevention and control.
A primer set was designed to simultaneously detect 34 pathogenic microorganisms and 39 drug resistance genes in aquaculture using PCR amplification and high-throughput sequencing technologies. The set includes specific primers and a kit, and combines ATOPlex single-tag for multiple rounds of PCR amplification and library construction, followed by sequencing analysis.
It has achieved rapid and accurate detection of aquaculture pathogens and drug-resistant genes, improved detection efficiency, and provided technical support for early diagnosis and rational use of drugs.
Smart Images

Figure CN120624691B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to a primer set for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture and an application thereof. Background Art
[0002] Aquaculture plays an important role in food supply and economic development. However, the frequent occurrence of diseases seriously restricts the sustainable development of the industry. Aquaculture animals are susceptible to a variety of pathogens, including viruses (such as white spot syndrome virus, White spot syndrome virus ), bacteria (such as Vibrio parahaemolyticus, Vibrio parahaemolyticus ), parasites (such as Cryptocaryon irritans, Cryptocaryon irritans ), etc., which often have a wide epidemic area, spread quickly, are easy to mix and cross-infect, and often lead to large-scale deaths and serious economic losses.
[0003] Antimicrobial drugs are widely used in aquaculture disease prevention and control. However, the emergence and spread of bacterial resistance presents new challenges. The development of resistance not only reduces clinical efficacy but also forces farmers to increase drug dosages or frequently change medications, further exacerbating the selective accumulation of resistance genes. More seriously, unmetabolized antimicrobial drugs and their resistance genes remain in the environment for long periods of time and spread among different microbial populations through horizontal gene transfer, forming a resistance gene pool that poses a potential threat to the ecological environment and public health. Timely monitoring of pathogen resistance in aquaculture environments is crucial for guiding rational drug use and delaying the development of resistance.
[0004] Currently, the main methods for detecting pathogens include bacterial isolation and identification, polymerase chain reaction (PCR), gene chips, gene sequencing technology, etc. However, these methods have a long detection process, low detection efficiency, and high detection cost, and it is difficult to meet the needs of simultaneous detection of multiple pathogens. Summary of the Invention
[0005] The purpose of the present invention is to provide a primer set for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture. The primer set is used for clinical sample testing to achieve rapid and accurate detection of aquaculture pathogens and drug-resistant genes.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0007] The present invention provides a primer set for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, including the primer set sequences shown in Table 2.
[0008] Preferably, the 5' end of the specific upstream primer of the primer set is connected to specific sequence 1, and the 5' end of the specific downstream primer is connected to specific sequence 2; the sequence of the specific sequence 1 is GACATGGCTACGATCCGACTT, and the sequence of the specific sequence 2 is CGCTTGGCCTCCGACTTGC.
[0009] The present invention also provides the use of the primer set in preparing a product for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture.
[0010] The present invention also provides a kit for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, comprising the above primer set.
[0011] The present invention also provides the use of the primer set in detecting aquaculture pathogenic microorganisms and drug-resistant genes for the purpose of non-disease diagnosis and / or treatment.
[0012] The present invention also provides a method for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture for the purpose of non-disease diagnosis and / or treatment, comprising the following steps:
[0013] (1) Extracting nucleic acid from the sample to be tested to obtain a nucleic acid sample;
[0014] (2) performing a first round of PCR amplification and purification on the nucleic acid sample of step (1) using the primer set;
[0015] (3) The purified product from step (2) was subjected to a second round of PCR amplification with the ATOPlex single tag and purified again to obtain a ds DNA library;
[0016] (4) Use endonucleases to construct ssDNA libraries from the circularized dsDNA libraries, and then sequence and analyze them.
[0017] By adopting the above technical solution, the present invention has the following beneficial effects:
[0018] The present invention designs specific primer sets that utilize high-throughput sequencing technology to simultaneously detect multiple pathogens and drug-resistance genes, significantly improving detection efficiency and providing strong technical support for the early diagnosis, precise prevention and control, and rational use of drugs for aquaculture diseases. The primer sets described in the present invention can also be used for clinical sample testing, enabling rapid and accurate detection of aquaculture pathogens and drug-resistance genes. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is a flow chart of the detection method of Example 4 of the present invention;
[0020] Figure 2The target gene distribution results detected in Example 4 of the present invention;
[0021] Figure 3 This is the pathogen detection result in Example 4 of the present invention. DETAILED DESCRIPTION
[0022] The present invention provides a primer set for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, wherein the 34 pathogenic microorganisms include 17 bacterial pathogens, 10 viral pathogens and 7 parasitic pathogens; the 39 drug-resistant genes include 12 aminoglycoside resistance genes, 3 sulfonamide resistance genes, 4 trimethoprim resistance genes, 4 quinolone resistance genes, 9 tetracycline resistance genes and 7 chloramphenicol resistance genes.
[0023] In the present invention, the 17 bacterial pathogens include Edwardsiella tarda ( Edwardsiella tarda ), Edwardsiella piscicidalis ( Edwardsiella piscicida ), Pseudomonas aeruginosa ( Pseudomonas plecoglossicida )、Vibrio vulnificus( Vibrio vulnificus ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus harveyi ( Vibrio harveyi )、Vibrio fluvibrios( Vibrio fluvialis ), Vibrio cannerii ( Vibrio campbellii )、Vibrio splendens( Vibrio splendidus )、Vibrio anguillarum( Vibrio anguillarum ), Nocardia asteroides ( Nocardia asteroide ), Nocardia sphenocardia ( Nocardia seriolae )、Vibrio corallilyticus( Vibrio coralliilyticus )、Vibrio alginolyticus( Vibrio alginolyticus ), Aeromonas hydrophila ( Aeromonas hydrophila ), Pseudomonas fluorescens ( Pseudomonas fluorescens ) and Flavobacterium columnaris ( Flavobacterium columnare ); The 10 viral pathogens include white spot syndrome virus ( White spot syndrome virus )、Red sea bream iridovirus( Red seabream iridovirus ), infectious spleen and kidney necrosis virus ( Infectious spleen and kidney necrosis virus ), Lymphocystis virus ( Lymphocystivirus ), eel herpes virus ( Anguillid herpesvirus ), Epinephelus erythematosus neuronecrosis virus ( Redspotted grouper nervous necrosis virus ), shrimp hemocyte iridovirus ( Shrimp hemocyte iridescent virus ), Taura syndrome virus ( Taura syndrome virus )、Steal Nodama virus( Covert mortality nodavirus ) and shrimp infectious myonecrosis virus ( Penaeid shrimp infectious myonecrosis virus); The 7 parasitic pathogens include Trichodina ( Trichodina ), Cryptocaryon irritans ( Cryptocaryon irritans )、Shrimp Hepatocellular Carcinoma ( Enterocytozoon hepatopenaei ), marine filaria ( Uronema marinum )、Waterdrop Pseudocerma ( Pseudocohnilembus persalinus ), Gluttonous Miami Bug ( Miamiensis avidus ) and Dactylorhiza anguilla ( Pseudodactylogyrus anguillae ).
[0024] In the present invention, the 12 aminoglycoside resistance genes include aac(3)-II 、 aac(6')-Ib 、 aadA 、 aadB 、 aadE 、 aph3 、 aph(2'')-Ig 、 ant(6)-Ib 、 ant(4')-Ia 、 rmtB2 、 strA as well as strB ; Four sulfonamide resistance genes include sul1 、 sul2 、 sul3 3 other types; trimethoprim-resistant genes dfrA1 、 dfrA5 、 dfrA12 as well as dfrA17 ; Four quinolone resistance genes include qnrA 、 qnrB 、 qnrD ,as well as qnrS ; 9 tetracycline resistance genes include tetA 、 tetB 、 tetG 、 tetM 、 tetO 、 tetQ 、 tetS 、 tetW 、 tetX ; 7 chloramphenicol resistance genes include catA 、 catB 、 cmlA 、 floR 、 cmx 、 fexA as well as optrA .
[0025] In the present invention, the primer set sequences for the 34 pathogenic microorganisms and 39 drug-resistant genes are shown in Table 2.
[0026] In the present invention, the 5' end of the specific upstream primer of the primer set is connected to the specific sequence 1, the sequence of which is GACATGGCTACGATCCGACTT. The 5' end of the specific downstream primer of the primer set is connected to the specific sequence 2, the sequence of which is CGCTTGGCCTCCGACTTGC.
[0027] The present invention also provides the use of the primer set in preparing a product for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture.
[0028] The present invention also provides a kit for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, comprising the primer set.
[0029] The present invention also provides the use of the primer set in detecting aquaculture pathogenic microorganisms and drug-resistant genes for the purpose of non-disease diagnosis and / or treatment.
[0030] The present invention also provides a method for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture for the purpose of non-disease diagnosis and / or treatment, comprising the following steps:
[0031] (1) Extracting nucleic acid from the sample to be tested to obtain a nucleic acid sample;
[0032] (2) performing a first round of PCR amplification and purification on the nucleic acid sample of step (1) using the primer set;
[0033] (3) The purified product from step (2) was subjected to a second round of PCR amplification with the ATOPlex single tag and purified again to obtain a ds DNA library;
[0034] (4) Use endonucleases to construct ssDNA libraries from the circularized dsDNA libraries, and then sequence and analyze them.
[0035] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0036] Example 1
[0037] By consulting relevant literature and reports, 34 common pathogens and 39 common drug-resistant genes in aquaculture were statistically analyzed and screened out. The 34 pathogenic microorganisms include 17 bacterial pathogens, 10 viral pathogens and 7 parasitic pathogens; the 39 drug-resistant genes include 12 aminoglycoside resistance genes, 3 sulfonamide resistance genes, 4 trimethoprim resistance genes, 4 quinolone resistance genes, 9 tetracycline resistance genes and 7 chloramphenicol resistance genes.
[0038] Two methods were used to screen pathogen target genes: 1. Target genes that had been experimentally validated in screening literature were searched and, based on the target gene name, the complete sequence of the target gene was downloaded from the NCBI public database (https: / / www.ncbi.nlm.nih.gov / ); 2. Target genes with high specificity were screened using bioinformatics methods, such as Blastn and Prokka, and customized scripts. Target genes identified by these two methods were further validated using Blastn software within NCBI Blast, ultimately identifying pathogen target genes. A total of 99 target genes were identified. The gene IDs of the pathogen target genes and the corresponding target sequence intervals (target regions) are shown in Table 1.
[0039] Table 1 Gene numbers of pathogenic target genes and corresponding target sequence intervals
[0040]
[0041]
[0042]
[0043] In Table 1, "_1" and "_2" for the same pathogen indicate that different target gene sequences of the pathogen or different regions of the same gene are used.
[0044] Primer design software was used to design primers. Multiple designs, analyses, and comparisons were performed for pathogen target genes. 1-3 pairs of primers were designed for different target genes. The amplicon length ranged from 100-200 bp. A total of 118 primer pairs were designed. The primer sequences are as follows:
[0045] Table 2 Primer sequences for 34 pathogenic microorganisms and 39 drug-resistant genes
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053] Primer Vibrio_1 can match multiple Vibrio species in the genus Vibrio, not just Vibrio parahaemolyticus.
[0054] Based on the MGISEQ-200RS sequencing platform of Shenzhen MGI Intelligent Manufacturing Co., Ltd., specific adapters were added to the 5' end of the primer sequences. Specifically, the specific sequence "GACATGGCTACGATCCGACTT" was added to the 5' end of the specific upstream primer, and the specific sequence "CGCTTGGCCTCCGACTTGC" was added to the 5' end of the specific downstream primer, ultimately forming the specific primer pool required for constructing the amplicon sequencing library.
[0055] Example 2
[0056] (1) Sample nucleic acid extraction
[0057] The samples used in this experiment were strains and plasmids containing synthetic pathogen sequences. A bacterial DNA extraction kit (purchased from Magen, product number D3146-03) was used to extract the microbial genome for subsequent PCR amplification. TM 4. Use a Fluorometer to quantify the ds DNA of the extracted sample and control the sample concentration within 10 ng / μL.
[0058] For water samples: first use a water-based PES polyethersulfone ultrafiltration membrane with a pore size of 0.02 μm to enrich pathogens, and then use an extraction kit (TIANamp Virus DNA / RNA Fast Kit, purchased from TIANGEN, product number DP315-F) to co-extract total DNA / RNA nucleic acids.
[0059] For tissue or whole blood samples: DNA and RNA are extracted directly using extraction kits. The extracted RNA is reverse transcribed into cDNA, and the extracted microbial genome is used for subsequent PCR amplification.
[0060] (II) Amplification and purification of target gene fragments
[0061] 1. Target region amplification
[0062] Using the nucleic acids from the different samples extracted in step (1) as templates, primers from the primer pool constructed in Example 1 were used to amplify the target regions in the samples. The kit used was the ATOPlex DNA Multiplex PCR Universal Library Construction Module (purchased from MGI, catalog number 1000021191). The specific reaction system and reaction procedures are shown in Tables 3 and 4. The concentration of each primer in the reaction system was 10 nM.
[0063] Table 3 Target region amplification reaction system
[0064]
[0065] Table 4 Target region amplification reaction procedure
[0066]
[0067] 2. Purification of target region amplification products
[0068] After the PCR reaction is completed, centrifuge briefly to collect the reaction solution at the bottom of the tube and transfer it to a new 1.5ml centrifuge tube. Purify the product using the MGIEasy DNA Purification Magnetic Bead Kit. The specific steps are as follows:
[0069] ① Place the DNA Clean Beads at room temperature for 30 minutes in advance and equilibrate them thoroughly before use.
[0070] ②Pipette 30 μL of the above magnetic beads into the PCR reaction solution, gently pipette at least 10 times to mix thoroughly, and incubate at room temperature for 5 minutes;
[0071] ③After instant centrifugation, place the 1.5ml centrifuge tube on a magnetic stand for 2-5 minutes until the liquid becomes clear, and discard the supernatant;
[0072] ④ Place the 1.5ml centrifuge tube on the magnetic stand, add 200μL of freshly prepared 80% ethanol to rinse the magnetic beads and the tube wall, let it stand for 30 seconds, and then discard the supernatant;
[0073] ⑤Repeat step ④ once and try to drain the liquid in the tube;
[0074] ⑥ Keep the 1.5ml centrifuge tube fixed on the magnetic stand, open the tube cover and dry at room temperature until the surface of the magnetic beads is free of reflection and cracks;
[0075] ⑦ Remove the centrifuge tube and add 6.5 μL TE Buffer to elute the DNA. Gently pipette to mix. Incubate at room temperature for 5 minutes. Centrifuge briefly for the second round of PCR amplification. If subsequent reactions are not performed immediately, the product can be stored in a -20°C refrigerator.
[0076] 3. Target region adapter and single tag connection
[0077] The product obtained after purification in step 2 was used as a template for the second round of PCR amplification using the ATOPlex DNA Multiplex PCR Universal Library Construction Module and the ATOPlex Single Index Primer Module (01-96) (purchased from MGI, catalog number 1000024934). The specific reaction system and reaction procedure are shown in Tables 5 and 6.
[0078] Table 5 Target region linker and single tag ligation reaction system
[0079]
[0080] Table 6 Target region linker and single tag ligation reaction procedures
[0081]
[0082] 4. Purification of the Second Round PCR Product
[0083] After the PCR reaction was completed, the reaction solution was collected to the bottom of the tube by instant centrifugation and then transferred to a new 1.5 ml centrifuge tube. The product was purified using the MGIEasy DNA Purification Magnetic Bead Kit (purchased from MGI, catalog number 1000007325). (three)
[0085] 1. ds DNA library quality inspection and mixed library construction
[0086] Leveraging Qubit TM 4. Perform a quality check on the dsDNA library obtained in step (2) using a Fluorometer. All sample concentrations should be no less than 5 ng / μL. Mix the samples to be sequenced based on their barcode numbers and other qualities. The total volume after library mixing should be 400 ng, and the total volume should be ≤ 48 μL. If the volume is less than 48 μL, use TE Buffer to make up the difference. Ensure that each sample library is mixed with equal quality. The sample volume for each library should be ≥ 1 μL. If the volume is less than 1 μL, dilute the library before sampling and mixing.
[0087] 2. Denaturation and circularization of ds DNA pooled libraries
[0088] The 48 μL mixed library was placed in a PCR instrument for denaturation. The reaction procedure was as follows: heated lid at 105°C, incubated at 95°C for 3 min, and held at 95°C. After the reaction, the PCR tube was quickly placed on ice and ice-bathed for 2 min before centrifugation to prepare the template for the subsequent circularization reaction. The amplicon library was circularized using the MGIEasy Circularization Kit. The reaction system is shown in Table 7. The prepared circularization reaction solution was vortexed three times for 3 s each time and centrifuged briefly to collect the reaction solution at the bottom of the tube. The PCR reaction was then performed using the following procedure: heated lid at 105°C, incubated at 37°C for 30 min, and held at 4°C. After the reaction, the PCR tube was centrifuged briefly and placed on ice immediately for subsequent steps.
[0089] Table 7 Library cyclization reaction system
[0090]
[0091] (IV) Enzyme digestion of ss DNA library and product purification
[0092] Using the circularized library as a template, add the enzyme digestion reaction solution: 1.4 μL Digestion Buffer, 2.6 μL Digestion Enzyme, and 60 μL ss DNA, for a total of 64 μL. Vortex the reaction mixture and centrifuge briefly. Follow the reaction schedule in Table 8. After the reaction is complete, centrifuge briefly and immediately add 7.5 μL Digestion Stop Buffer. Vortex the reaction mixture and collect the reaction mixture into a 1.5 ml centrifuge tube.
[0093] Table 8 Enzyme digestion reaction program
[0094]
[0095] The enzyme digestion products were purified using the MGIEasy DNA Purification Magnetic Bead Kit to obtain the ssDNA library, which was then stored at -20°C for future use.
[0096] Example 3
[0097] Using the Qubit kit TM The ssDNA library constructed in Example 2 was quantified using a 4-fluorometer. The concentration of the ssDNA library was ≥ 2 fmol / μL, meeting quality control requirements. The reaction was performed using this library as a template, with the specific steps involving DNB preparation and sequencing.
[0098] (1) DNB preparation
[0099] This reaction requires the addition of a balanced library. The input volumes of the ssDNA library and the balanced library are calculated according to the following formula:
[0100] Concentration conversion: C (fmol / μL) = 3030 C (ng / μL) / N, where N represents the average number of nucleotides; input volume (μL) = 20 / C (fmol / μL);
[0101] ssDNA and the balanced library were added at a 1:1 ratio, for a total of 40 fmol. The mixture served as the library template and a DNB preparation reaction was performed using the MGISEQ-200RS High-Throughput Sequencing Reagent Set (FCL PE150). The specific reaction system and procedure for DNB Preparation Reaction 1 are shown in Tables 9 and 10; the specific reaction system and procedure for DNB Preparation Reaction 2 are shown in Tables 11 and 12. After DNB Preparation Reaction 1, the DNB Preparation Reaction 2 system was prepared on ice and continued with DNB Preparation Reaction 2. Immediately after DNB Preparation Reaction 2, 20 μL of DNB Stop Buffer was added using a wide-bore pipette tip. Mix thoroughly by gently pipetting, avoiding turbulence.
[0102] Table 9 DNB Preparation 1 Reaction System
[0103]
[0104] Table 10 DNB Preparation 1 Reaction Procedure
[0105]
[0106] Table 11 DNB Preparation 2 Reaction System
[0107]
[0108] Table 12 DNB Preparation 2 Reaction Procedure
[0109]
[0110] After the DNB reaction, use Qubit ® ssDNA Assay Kit and Qubit ® The ssDNA library was quality checked using a Fluorometer instrument. The DNB concentration was ≥8 ng / μL. If the quality inspection was qualified, it was placed on ice and prepared for sequencing.
[0111] (2) Sequencing
[0112] The prepared DNB was prepared for sequencing according to the instructions of the MGI high-throughput (rapid) sequencing reagent set. The sequencing kit used was the MGISEQ-200RS high-throughput rapid sequencing reagent set (FCL PE100).
[0113] Example 4
[0114] The genomes or plasmids of some pathogens and drug resistance genes shown in Example 1 were selected and mixed to prepare sample 1 (sample_1), sample 2 (sample_2) and sample 3 (sample_3) to simulate clinical samples, as shown in Table 13. The methods of Examples 2 and 3 were used for library construction and sequencing analysis. After sequencing was completed, the sequencing sample quality test report and the original sequencing data of all samples were copied for analysis, test result statistics and result visualization. The test results are shown in Table 13. Figure 2 and Figure 3 .
[0115] Table 13 Selected sample information and test results
[0116]
[0117] The sample quality test report indicated high sequencing quality, with over 90% of results ≥Q30, demonstrating reliable barcode recognition and accurate differentiation across all samples. The primer sets used in this study amplify and sequence specific pathogenic gene regions with high specificity. The capture rate of the target pathogenic gene region varied depending on the pathogen load in the sample.
[0118] Practice has shown that the pathogen target genes in the panel were detected in all four samples, while no pathogen targets were detected in the negative control group. The implementation results show that the sequencing results are accurate and reliable, and multiple related pathogens can be detected in one experiment, thus proving that the present invention successfully achieves rapid, accurate and simultaneous diagnosis of 34 pathogens and 39 drug-resistant genes in aquaculture.
[0119] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A primer set for simultaneous detection of 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, characterized in that: The primer set sequences include the following: The 5' end of the specific upstream primer of the primer set is connected to specific sequence 1, and the 5' end of the specific downstream primer is connected to specific sequence 2; The sequence of the specific sequence 1 is GACATGGCTACGATCCGACTT, and the sequence of the specific sequence 2 is CGCTTGGCCTCCGACTTGC.
2. Use of the primer set according to claim 1 in preparing a product for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, characterized in that: The 34 pathogenic microorganisms include Edwardsiella tarda ( Edwardsiella tarda ), Edwardsiella piscicidalis ( Edwardsiella piscicida ), Pseudomonas aeruginosa ( Pseudomonas plecoglossicida )、Vibrio vulnificus( Vibrio vulnificus ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus harveyi ( Vibrio harveyi )、Vibrio fluvibrios( Vibrio fluvialis ), Vibrio cannerii ( Vibrio campbellii )、Vibrio splendens( Vibrio splendidus )、Vibrio anguillarum( Vibrio anguillarum ), Nocardia asteroides ( Nocardia asteroide ), Nocardia sphenocardia ( Nocardia seriolae )、Vibrio corallilyticus( Vibrio coralliilyticus )、Vibrio alginolyticus( Vibrio alginolyticus ), Aeromonas hydrophila ( Aeromonas hydrophila ), Pseudomonas fluorescens ( Pseudomonas fluorescens ), Flavobacterium columnaris ( Flavobacterium columnare ), white spot syndrome virus ( White spot syndrome virus )、Red sea bream iridovirus( Red seabream iridovirus ), infectious spleen and kidney necrosis virus ( Infectious spleen and kidney necrosis virus ), Lymphocystis virus ( Lymphocystivirus ), eel herpes virus ( Anguillid herpesvirus ), Epinephelus erythematosus neuronecrosis virus ( Redspotted grouper nervous necrosis virus ), shrimp hemocyte iridovirus ( Shrimp hemocyte iridescent virus ), Taura syndrome virus ( Taura syndrome virus )、Steal Nodama virus( Covert mortality nodavirus ), shrimp infectious myonecrosis virus ( Penaeid shrimp infectious myonecrosis virus )、Trichodina( Trichodina ), Cryptocaryon irritans ( Cryptocaryon irritans )、Shrimp Hepatocellular Carcinoma ( Enterocytozoon hepatopenaei ), marine filaria ( Uronema marinum )、Waterdrop Pseudocerma ( Pseudocohnilembus persalinus ), Gluttonous Miami Bug ( Miamiensis avidus ) and Dactylorhiza anguilla ( Pseudodactylogyrus anguillae ); The 39 drug-resistant genes include aac3-II, aac6'-Ib, aadA, aadB, aadE, ant4'-Ia, ant6-Ib, aph2''-Ig, aph3, catA, catB, cmlA, cmx, dfrA1, dfrA12, dfrA17, dfrA5, fexA, floR, optrA, qnrA, qnrB, qnrD, qnrS, rmtB2, strA, strB, sul1, sul2, sul3, tetA, tetB, tetG, tetM, tetO, tetQ, tetS, tetW, and tetX.
3. A kit for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture, characterized in that: including the primer set described in claim 1.
4. Use of the primer set according to claim 1 in detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture for the purpose of non-disease diagnosis and / or treatment, characterized in that: The 34 pathogenic microorganisms include Edwardsiella tarda ( Edwardsiella tarda ), Edwardsiella piscicidalis ( Edwardsiella piscicida ), Pseudomonas aeruginosa ( Pseudomonas plecoglossicida )、Vibrio vulnificus( Vibrio vulnificus ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus harveyi ( Vibrio harveyi )、Vibrio fluvibrios( Vibrio fluvialis ), Vibrio cannerii ( Vibrio campbellii )、Vibrio splendens( Vibrio splendidus )、Vibrio anguillarum( Vibrio anguillarum ), Nocardia asteroides ( Nocardia asteroide ), Nocardia sphenocardia ( Nocardia seriolae )、Vibrio corallilyticus( Vibrio coralliilyticus )、Vibrio alginolyticus( Vibrio alginolyticus ), Aeromonas hydrophila ( Aeromonas hydrophila ), Pseudomonas fluorescens ( Pseudomonas fluorescens ), Flavobacterium columnaris ( Flavobacterium columnare ), white spot syndrome virus ( White spot syndrome virus )、Red sea bream iridovirus( Red seabream iridovirus ), infectious spleen and kidney necrosis virus ( Infectious spleen and kidney necrosis virus ), Lymphocystis virus ( Lymphocystivirus ), eel herpes virus ( Anguillid herpesvirus ), Epinephelus erythematosus neuronecrosis virus ( Redspotted grouper nervous necrosis virus ), shrimp hemocyte iridovirus ( Shrimp hemocyte iridescent virus ), Taura syndrome virus ( Taura syndrome virus )、Steal Nodama virus( Covert mortality nodavirus ), shrimp infectious myonecrosis virus ( Penaeid shrimp infectious myonecrosis virus )、Trichodina( Trichodina ), Cryptocaryon irritans ( Cryptocaryon irritans )、Shrimp Hepatocellular Carcinoma ( Enterocytozoon hepatopenaei ), marine filaria ( Uronema marinum )、Waterdrop Pseudocerma ( Pseudocohnilembus persalinus ), Gluttonous Miami Bug ( Miamiensis avidus ) and Dactylorhiza anguilla ( Pseudodactylogyrus anguillae ); The 39 drug-resistant genes include aac3-II, aac6'-Ib, aadA, aadB, aadE, ant4'-Ia, ant6-Ib, aph2''-Ig, aph3, catA, catB, cmlA, cmx, dfrA1, dfrA12, dfrA17, dfrA5, fexA, floR, optrA, qnrA, qnrB, qnrD, qnrS, rmtB2, strA, strB, sul1, sul2, sul3, tetA, tetB, tetG, tetM, tetO, tetQ, tetS, tetW and tetX.
5. A method for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture for the purpose of non-disease diagnosis and / or treatment, characterized in that: The steps include: (1) Extracting nucleic acid from the sample to be tested to obtain a nucleic acid sample; (2) performing a first round of PCR amplification and purification on the nucleic acid sample of step (1) using the primer set of claim 1; (3) The purified product from step (2) was subjected to a second round of PCR amplification with the ATOPlex single tag and purified again to obtain a ds DNA library; (4) Use endonucleases to construct ssDNA libraries from the circularized dsDNA libraries, followed by sequencing and analysis; The 34 pathogenic microorganisms include Edwardsiella tarda ( Edwardsiella tarda ), Edwardsiella piscicidalis ( Edwardsiella piscicida ), Pseudomonas aeruginosa ( Pseudomonas plecoglossicida )、Vibrio vulnificus( Vibrio vulnificus ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus harveyi ( Vibrio harveyi )、Vibrio fluvibrios( Vibrio fluvialis ), Vibrio cannerii ( Vibrio campbellii )、Vibrio splendens( Vibrio splendidus )、Vibrio anguillarum( Vibrio anguillarum ), Nocardia asteroides ( Nocardia asteroide ), Nocardia sphenocardia ( Nocardia seriolae )、Vibrio corallilyticus( Vibrio coralliilyticus )、Vibrio alginolyticus( Vibrio alginolyticus ), Aeromonas hydrophila ( Aeromonas hydrophila ), Pseudomonas fluorescens ( Pseudomonas fluorescens ), Flavobacterium columnaris ( Flavobacterium columnare ), white spot syndrome virus ( White spot syndrome virus )、Red sea bream iridovirus( Red seabream iridovirus ), infectious spleen and kidney necrosis virus ( Infectious spleen and kidney necrosis virus ), Lymphocystis virus ( Lymphocystivirus ), eel herpes virus ( Anguillid herpesvirus ), Epinephelus erythematosus neuronecrosis virus ( Redspotted grouper nervous necrosis virus ), shrimp hemocyte iridovirus ( Shrimp hemocyte iridescent virus ), Taura syndrome virus ( Taura syndrome virus )、Steal Nodama virus( Covert mortality nodavirus ), shrimp infectious myonecrosis virus ( Penaeid shrimp infectious myonecrosis virus )、Trichodina( Trichodin ), Cryptocaryon irritans ( Cryptocaryon irritation )、Shrimp Hepatocellular Carcinoma ( Enterocytozoon hepatopenaei ), marine filaria ( Uronema marinum )、Waterdrop Pseudocerma ( Pseudocohnilembus persalinus ), Gluttonous Miami Bug ( Miamiensis avidus ) and Dactylorhiza anguilla ( Pseudodactylogyrus eels ); Compound 39 contains the compounds aac3-II, aac6'-Ib, aadA, aadB, aadE, ant4'-Ia, ant6-I b, aph2''-Ig, aph3, catA, catB, cmlA, cmx, dfrA1, dfrA12, dfrA17, df rA5, fexA, floR, optrA, qnrA, qnrB, qnrD, qnrS, rmtB2, strA, strB, su l1, sul2, sul3, tetA, tetB, tetG, tetM, tetO, tetQ, tetS, tetW and tetX.
Citation Information
Patent Citations
Primer combination and amplicon targeting sequencing method for detecting 6 pathogenic microorganisms and 20 drug-resistant genes thereof
CN115992269A
Primer group for targeted simultaneous detection of multiple bacterial pathogens based on multiple amplicons and application of primer group
CN120272623A