Application of DMA in preparation of preparation for improving transient expression quantity of CHO-S cells

Abstract

The invention discloses application of DMA in preparation of a preparation for improving transient expression quantity of CHO-S cells. In the transient transfection process of CHO-S cells, 0.25% N, N-dimethylacetamide solution (DMA) is added and optimized plasmids are used: a section of DNA sequence as shown in SEQ ID No.1 is additionally added behind a promoter of conventionally used pCMV plasmids, so that the expression level of the transient transfected CHO cells can be improved, and the performance of an antibody is not changed. From the aspect of economic value, the production cost of antibody raw materials can be greatly reduced, and the cost performance is relatively high.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of DMA in preparing a preparation for increasing the transient expression amount of CHO-S cells. Background Art

[0002] Recombinant proteins are produced by inserting artificially synthesized DNA fragments into host cells through genetic engineering techniques, causing them to express the target protein. This technology can produce large quantities of high-purity, highly active proteins, providing a valuable resource for research and application in the pharmaceutical field. Currently, the main recombinant protein production systems include prokaryotic cell expression systems, yeast cell expression systems, insect cell expression systems, mammalian cell expression systems, and cell-free protein expression systems. Mammalian cell expression systems offer significant advantages in the production of recombinant human proteins due to their ability to provide near-native post-translational modifications and protein folding. Since the approval of human tissue-type plasminogen activator produced in Chinese hamster ovary cells for clinical use in 1986, the production of recombinant proteins based on mammalian expression systems has become a growing trend. With the increasing application of recombinant proteins in basic life science research, biopharmaceuticals, cellular immunotherapy, in vitro diagnostics, and other fields, the demand for proteins continues to grow.

[0003] Mammalian cell expression systems can be categorized as transient, stable, and inducible expression systems. Transient expression systems involve the introduction of an expression vector into host cells without selective culture. The vector DNA is gradually lost as cells divide, resulting in a brief expression period for the target protein. Their advantages are simplicity, short experimental cycles, and suitability for small-scale experiments and research. However, compared to stable expression systems, the expression level of the same exogenous DNA molecule can be several times higher with stable expression. This necessitates optimization of existing transient expression systems to increase recombinant protein expression, enhance cell line stability, and reduce production costs while ensuring product quality. Summary of the Invention

[0004] The present invention is achieved through the following technical solutions:

[0005] Chinese hamster ovary (CHO) cells are commonly used as the preferred host cell for recombinant protein research because they express target proteins with correct post-translational modifications and closely resemble the biological properties of natural products. In the CHO transient expression system, the target gene is present in the cell as plasmid DNA, which offers advantages such as short time, high throughput, simple operation, and scalability. This allows for the rapid production of different candidate recombinant proteins, making it an increasingly popular cell line for the industrial production of recombinant therapeutic proteins. Therefore, the present invention selects CHO-S cells from Chinese hamster ovary cells as the exogenous expression cell line.

[0006] N,N-dimethylacetamide (DMA) is a non-proton, highly polar solvent with a slight ammonia odor. It has strong dissolving power and can dissolve a wide range of substances. It is miscible with water, aromatic compounds, esters, ketones, alcohols, ethers, benzene, and chloroform, and can activate compound molecules. It is widely used as a solvent and catalyst and has good thermal stability and chemical stability.

[0007] Mechanism of transient transfection: Cationic polymers can bind to negatively charged DNA, forming positively charged complexes. These complexes can enter the cell through electrostatic interactions across the cell membrane. The encapsulated DNA is then released into the cytoplasm and, through various intracellular mechanisms, transcribed into RNA or translated into protein to achieve gene expression. Polar reagents typically have high polarity and hydrophilicity. Adding a certain amount of N,N-dimethylacetamide during transient transfection of CHO cells can alter cell membrane permeability, thereby affecting the efficiency of transfection complex entry into the cell. It can also enhance the utilization of pDNA as a transcription template, thereby increasing the steady-state level of transgenic mRNA and positively impacting the transgenic transcription rate in transfected cells.

[0008] The present invention provides the use of DMA in preparing a preparation for increasing the transient expression of CHO-S cells, and also provides the use of DMA in increasing the transient expression of CHO-S cells. Specifically, the present invention increases the production capacity of recombinant proteins in mammalian cells and promotes antibody expression after transfection by adding an N,N-dimethylacetamide solution to a mass concentration of 0.25% during the transient transfection of CHO-S cells. Compared with traditional transfection methods, this method can achieve higher expression of the target protein in CHO-S cells.

[0009] Furthermore, the present invention adds an additional sequence after the promoter of the conventionally used pCMV plasmid, as shown in SEQ ID No. 1. The specific sequence is shown as follows: TATACAATGCCGCCTATACAATGCCGCCTATACAATTATACAATGCCGCCTATACAATTATACAATGCCGCCTATACAATTATACAATGCCG CCTATACAATGCCGCC, to optimize the plasmid and increase the transcription level of the target gene.

[0010] In order to achieve the above object, the present invention provides a method for increasing the transient expression level of CHO-S cells, which specifically comprises the following steps:

[0011] Construct the antibody gene into a plasmid;

[0012] CHO-S cells were activated and cultured to a cell density of 5×10 6cells / mL, survival rate ≥97%, gently shake the culture flask to mix the cells and wait for transfection;

[0013] Prepare a transfection system by preparing solution A and solution B separately, mixing them and letting them stand at room temperature to obtain a mixed solution AB; the solution A is a solution containing the antibody light chain plasmid and the heavy chain plasmid dissolved in a transfection diluent, and the solution B is a solution of the transfection reagent dissolved in a transfection diluent; the mass ratio of the sum of the mass of the antibody light and heavy chain plasmids to the mass of the transfection reagent in the AB mixed solution is 1:3; the mass ratio of the antibody light chain plasmid to the antibody heavy chain plasmid is 2:1.

[0014] The AB mixture was added dropwise to the CHO-S cell suspension, and then the DMA solution was added, and the cells were cultured according to the cell culture conditions to obtain recombinant CHO-S cells;

[0015] After successful transfection, CHO enhancer and CHO feed were added for culture.

[0016] The present invention has but is not limited to the following beneficial effects:

[0017] The present invention enhances the expression level of transiently transfected CHO cells by adding 0.25% N,N-dimethylacetamide solution (DMA) and using an optimized plasmid: a DNA sequence such as SEQ ID No. 1 is added after the promoter of the conventional pCMV plasmid. This approach does not affect antibody performance. From an economic perspective, the present invention can significantly reduce the production cost of antibody raw materials, offering a high cost-effectiveness ratio. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to clearly illustrate the specific implementation methods of the present invention and certain detection technologies used in the experiments, the implementation methods and the technologies used will be described below, mainly in the form of drawings.

[0019] Figure 1 1 is a comparison chart of viable cell density among Example 1, Example 2, and Comparative Example, Example 3, Example 4, and Example 5;

[0020] Figure 2 1 is a comparison chart of cell survival rates among Example 1, Example 2, Comparative Example, Example 3, Example 4, and Example 5;

[0021] Figure 3 1 is a graph showing the results of SDS-PAGE electrophoresis of Example 1, Example 2 and a comparative example;

[0022] Figure 4 Graphs showing clinical test results for Example 1 and Comparative Example 1;

[0023] Figure 5The figures are the clinical test results of Example 2 and Comparative Example 1.

[0024] Specific implementation methods

[0025] The specific implementation methods of the present invention are explained with the aid of examples. Except that the technology used for detection does not impose any form of limitation on the present invention, some schemes in the described embodiments are part of the embodiments of the invention. The embodiments obtained by ordinary technical operators in this field without creative results are all within the scope of protection of the present invention.

[0026] Example 1

[0027] Use the first group: conventional plasmid + antibody gene, and perform recombinant expression according to the following procedures.

[0028] After the CHO-S cell line was revived and expanded for 2-3 passages, the cells were cultured at 0.5×10 6 cells / mL were inoculated into CHO basal medium supplemented with 6 mmol / L glutamine, with a culture volume of 50 mL in a 250 mL round-bottom cell culture flask, and cultured on a shaker with the shaker setting parameters of 37°C, 8% carbon dioxide concentration, and 120 rpm.

[0029] One day before transfection, CHO-S cells were diluted with subculture medium and the cell density was adjusted to 3×10 6 cells / mL, with a volume of 50 mL, using a 250 mL round-bottom cell culture flask, and cultured on a shaker with the shaker setting parameters of 37°C, 8% carbon dioxide concentration, and 120 rpm.

[0030] On the day of transient transfection, CHO-S cells were counted and viable cell density and survival rate were determined. CHO-S cells were diluted with CHO basal medium supplemented with 6 mmol / L glutamine to adjust the cell density to 5 × 10 6 cells / mL, cell viability ≥97%, volume 50mL, use 250mL round-bottom cell culture flask, place on shaker for culture, and wait for transfection;

[0031] Prepare the transfection system by preparing solution A and solution B respectively. Solution A is a solution containing 33.3 μg of conventional antibody light chain plasmid and 16.7 μg of conventional antibody heavy chain plasmid dissolved in 2 mL of transfection diluent. Solution B is a solution containing 150 μL of transfection reagent dissolved in 2 mL of transfection diluent. Mix solution A and solution B and let it stand at room temperature for 2 minutes to obtain a mixed solution AB.

[0032] The AB mixture was added dropwise to the CHO S cell suspension, and then 125 μL of N,N-dimethylacetamide solution (DMA) was added. The cells were cultured on a shaker with the shaker setting parameters of 37°C, 8% carbon dioxide concentration, and 120 rpm. The transfection time was 11 days.

[0033] On the first day of transfection, 250 μL of CHO enhancer and 7.5 mL of CHO feed were added; on the fifth day of transfection, 7.5 mL of CHO feed were added.

[0034] Comparative Example 1

[0035] Use the same conventional plasmid + antibody gene as the first group

[0036] The difference from Example 1 is that no additional N,N-dimethylacetamide solution (DMA) was added during the transfection process, and the rest of the cell density and reagent dosage were the same as in Example 1.

[0037] Example 2

[0038] The second group (optimized plasmid + antibody gene) was used for recombinant expression according to the following procedures. The optimized plasmid described in this example is a conventionally used pCMV plasmid promoter with an additional sequence of "TATACAATGCCGCCTATACAATGCCGCCTATACAATTATACAATGCCGCCTATACAATTATACAATGCCGCCTATACAATGCC GCC" (as shown in SEQ ID No. 1) added to optimize the plasmid and increase the transcription level of the target gene.

[0039] After the CHO-S cell line was revived and expanded for 2-3 passages, the cells were cultured at 0.5×10 6 cells / mL were inoculated into CHO basal medium supplemented with 6 mmol / L glutamine, with a culture volume of 50 mL in a 250 mL round-bottom cell culture flask and cultured on a shaker with the shaker settings of 37°C, 8% carbon dioxide concentration, and 120 rpm;

[0040] One day before transfection, CHO-S cells were diluted with subculture medium and the cell density was adjusted to 3×10 6 cells / mL, volume 50 mL, use 250 mL round-bottom cell culture flasks, place on a shaker, shaker setting parameters temperature 37 ° C, carbon dioxide concentration 8%, shaker speed set to 120 rpm;

[0041] On the day of transient transfection, CHO-S cells were counted and viable cell density and survival rate were determined. CHO-S cells were diluted with CHO basal medium supplemented with 6 mmol / L glutamine to adjust the cell density to 5 × 10 6 cells / mL, cell viability ≥97%, volume 50mL, use 250mL round-bottom cell culture flask, place on shaker for culture, and wait for transfection;

[0042] Prepare the transfection system by preparing solution A and solution B respectively. Solution A is a solution containing 33.3 μg of antibody light chain optimized plasmid and 16.7 μg of antibody heavy chain optimized plasmid dissolved in 2 mL of transfection diluent. Solution B is a solution containing 150 μL of transfection reagent dissolved in 2 mL of transfection diluent. After mixing solution A and solution B, let it stand at room temperature for 2 minutes to obtain a mixed solution AB.

[0043] The AB mixture was added dropwise to the CHO S cell suspension, and then 125 μL of N,N-dimethylacetamide solution (DMA) was added. The cells were cultured on a shaker with the shaker setting parameters of 37°C, 8% carbon dioxide concentration, and 120 rpm. The transfection time was 11 days.

[0044] On the first day of transfection, 250 μL of CHO enhancer and 7.5 mL of CHO feed were added; on the fifth day of transfection, 7.5 mL of CHO feed were added.

[0045] Example 3

[0046] Use the first set: conventional plasmid + antibody gene, and perform recombinant expression according to the following procedures. The difference is that the cell line is replaced with the 293 cell line.

[0047] After the 293 cell line was revived and expanded for 2-3 times, the cells were cultured at 0.5×10 6 cells / mL were inoculated into 293 medium supplemented with 4 mmol / L glutamine, with a culture volume of 50 mL in a 250 mL round-bottom cell culture flask and cultured on a shaker with the shaker settings of 37°C, 8% carbon dioxide concentration, and 120 rpm.

[0048] One day before transfection, 293 cells were diluted with subculture medium and the cell density was adjusted to 2×10 6 cells / mL, volume 50 mL, use 250 mL round-bottom cell culture flasks, place on a shaker, shaker setting parameters temperature 37 ° C, carbon dioxide concentration 8%, shaker speed set to 120 rpm;

[0049] On the day of transient transfection, count the 293 cells and determine the viable cell density and survival rate. Dilute the 293 cells with 293 culture medium supplemented with 4 mmol / L glutamine to adjust the cell density to 3×10 6 cells / mL, cell viability ≥97%, volume 50mL, use 250mL round-bottom cell culture flask, place on shaker for culture, and wait for transfection;

[0050] Prepare the transfection system by preparing Solution A and Solution B. Solution A consists of 33.3 μg of the conventional antibody light chain plasmid and 16.7 μg of the conventional antibody heavy chain plasmid dissolved in 3 mL of transfection diluent. Solution B consists of 160 μL of transfection reagent dissolved in 2.8 mL of transfection diluent. Mix thoroughly and let stand at room temperature for 5 minutes. Add Solution B to Solution A, mix thoroughly, and let stand at room temperature for 20 minutes to obtain a mixed solution AB.

[0051] Add the AB mixture dropwise to the 293 cell suspension, then add 125uL N,N-dimethylacetamide solution (DMA), and culture on a shaker with the shaker setting parameters of 37°C, 8% carbon dioxide concentration, and 120 rpm. The transfection time is 7 days.

[0052] On the first day of transfection, add 300 μL of enhancer and 3 mL of feed.

[0053] Example 4

[0054] Use the second group: optimized plasmid + antibody gene, and perform recombinant expression according to the following procedures.

[0055] After the 293 cell line was revived and expanded for 2-3 times, the cells were cultured at 0.5×10 6 cells / mL were inoculated into 293 medium supplemented with 4 mmol / L glutamine, with a culture volume of 50 mL in a 250 mL round-bottom cell culture flask and cultured on a shaker with the shaker settings of 37°C, 8% carbon dioxide concentration, and 120 rpm.

[0056] One day before transfection, 293 cells were diluted with subculture medium and the cell density was adjusted to 2×10 6 cells / mL, volume 50 mL, use 250 mL round-bottom cell culture flasks, place on a shaker, shaker setting parameters temperature 37 ° C, carbon dioxide concentration 8%, shaker speed set to 120 rpm;

[0057] On the day of transient transfection, count the 293 cells and determine the viable cell density and survival rate. Dilute the 293 cells with 293 culture medium supplemented with 4 mmol / L glutamine to adjust the cell density to 3×10 6cells / mL, cell viability ≥97%, volume 50mL, use 250mL round-bottom cell culture flask, place on shaker for culture, and wait for transfection;

[0058] Prepare the transfection system by preparing Solution A and Solution B. Solution A consists of 33.3 μg of the conventional antibody light chain plasmid and 16.7 μg of the conventional antibody heavy chain plasmid dissolved in 3 mL of transfection diluent. Solution B consists of 160 μL of transfection reagent dissolved in 2.8 mL of transfection diluent. Mix thoroughly and let stand at room temperature for 5 minutes. Add Solution B to Solution A, mix thoroughly, and let stand at room temperature for 20 minutes to obtain a mixed solution AB.

[0059] Add the AB mixture dropwise to the 293 cell suspension, then add 125uL N,N-dimethylacetamide solution (DMA), and culture on a shaker with the shaker setting parameters of 37°C, 8% carbon dioxide concentration, and 120 rpm. The transfection time is 7 days.

[0060] On the first day of transfection, add 300 μL of enhancer and 3 mL of feed.

[0061] Example 5

[0062] Use the first group: conventional plasmid + antibody gene

[0063] The difference from Example 3 is that no additional N,N-dimethylacetamide solution (DMA) was added during the transfection process, and the rest of the cell density and reagent dosage were the same as in Example 3.

[0064] Example 6

[0065] Results and Testing

[0066] 1. Starting from the first day of transfection, count the cells every other day and record the live cell density and cell survival rate, such as Figure 1 、 Figure 2 shown.

[0067] 2. On the 11th day after CHO-S cell transfection, the cells were removed from the incubator and purified after centrifugation. Protein A affinity chromatography was used. First, a protein A affinity chromatography column was prepared. After balancing the column with PBS, the cell supernatant was passed through the column. The column was then washed with PBS and eluted with 50 nmol / L glycine hydrochloride solution. The eluate was collected and the OD value of each collection tube was measured. The eluate in the peak area was retained. The eluate was collected after dialysis. The antibody yield in Example 1 was 466 mg / L, the antibody yield in Example 2 was 523 mg / L, and the antibody yield in the comparative example was 320 mg / L. Example 1 used the first group: conventional plasmid + antibody gene. 0.25% N, N-dimethylacetamide solution was added during transfection. The antibody yield increased by 45.6% compared to the comparative example. Example 2 used the second group: optimized plasmid + antibody gene. The antibody yield increased by 12.2% compared to Example 1 using conventional plasmid.

[0068] Seven days after transfection, the 293 cells were removed from the incubator, centrifuged, and purified according to the above steps. The antibody yields obtained for Example 3 were 175 mg / L, for Example 4, 201 mg / L, and for Example 5, 158 mg / L. Compared to Example 3 and Example 5, the addition of 0.25% N,N-dimethylacetamide solution did not significantly increase antibody yield. However, compared to Example 4, the optimized plasmid in Example 3 increased antibody yield by 12.9% compared to the conventional plasmid.

[0069] 3. The three groups of antibodies were identified as purified recombinant antibodies by reducing and non-reducing SDS-PAGE electrophoresis, with a purity of more than 98%. Figure 3 As shown, specifically, (the left side is reducing SDS-PAGE, the middle is protein Marker reagent, and the right side is non-reducing SDS-PAGE; the sample order is: Example 1, Example 2, Comparative Example 1).

[0070] 4. The antibody titer was detected by indirect ELISA method. The antibody dilution concentrations were 1 ug / mL, 0.33 ug / mL, 0.11 ug / mL, 0.036 ug / mL, 0.012 ug / mL, and 0.004 ug / mL. The test results showed that the titers of the ELISA tests of the six groups of antibodies in Example 1, Example 2, the comparative example, Example 3, Example 4, and Example 5 were similar. The specific test results are shown in Table 1.

[0071] Table 1 Antibody Elisa test results

[0072]

[0073] 5. 50 clinical samples were tested using the chemiluminescence platform using the antibody in Example 1, the antibody in Example 2, and the antibody in Comparative Example 1. The test results showed that the test results in Example 1, Example 2, and Comparative Example 1 were consistent. The specific results are as follows: Figure 4 、 Figure 5 shown.

Claims

1. Application of DMA in the preparation of preparations for improving transient expression of CHO-S cells.

2. The use according to claim 1, characterized in that The concentration of the DMA is 0.25% by mass.

3. The use according to claim 1, characterized in that The CHO-S cells contain an exogenous recombinant expression plasmid, and the exogenous recombinant expression plasmid contains the DNA sequence shown as SEQ ID No.

1.

4. The use according to claim 3, characterized in that The exogenous recombinant expression plasmid is a pCMV plasmid.

5. The use according to claim 4, characterized in that: The DNA sequence is inserted after the promoter.

6. A method for increasing the transient expression level of CHO-S cells, comprising the following steps: Construct the antibody gene into a plasmid; CHO-S cells were activated and cultured to a cell density of 5×10 6 cells / mL, survival rate ≥97%, gently shake the culture flask to mix the cells and wait for transfection; Prepare a transfection system by preparing Solution A and Solution B separately, mixing them and letting them stand at room temperature to obtain a mixed solution AB; Solution A is a solution containing the antibody light chain plasmid and heavy chain plasmid dissolved in transfection diluent, and Solution B is a solution of the transfection reagent dissolved in transfection diluent; The AB mixture was added dropwise to the CHO-S cell suspension, and then the DMA solution was added, and the cells were cultured according to the cell culture conditions to obtain recombinant CHO-S cells; After successful transfection, CHO enhancer and CHO feed were added for culture.

7. The method according to claim 6, wherein: The mass ratio of the sum of the mass of the antibody light and heavy chain plasmids to the mass of the transfection reagent in the AB mixed solution is 1:3; the mass ratio of the antibody light chain plasmid to the antibody heavy chain plasmid is 2:1.

Images