Application of idometasine in preparation of cellular immunomodulator

Abstract

The invention discloses an application of idometacin in preparation of a cellular immunomodulator. According to the present invention, the endophytic fungus Endomelanconiopsis sp. GLQ07 of Ganoderma lucidum is subjected to separation and identification so as to obtain the endophytic fungus Endomelanconiopsis sp. On the premise of not influencing differentiation of other T cell subpopulations, the EpA can selectively enhance Th9 cell differentiation, significantly promote cytotoxic phenotype formation, improve mitochondrial functions and improve metabolic adaptability. Mechanism research shows that EpA acts on ZAP70 (TCR signal transduction key kinase) and SREBP1 (lipid metabolism main regulatory factor) through double-target synergistic action, and functional integration of TCR signal amplification and fatty acid synthesis inhibition is realized jointly. Functionally, the Th9 cell treated by EpA induces a strong CD8 + T cell dependent anti-tumor immune response in a preclinical model, and the treatment effect of the human Th9CAR-T cell is remarkably improved. The research results clearly show that EpA is a T cell immunomodulator with clinical application prospects and has remarkable technical value and industrialization potential.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and particularly relates to the application of indometine in the preparation of a cellular immune regulator. Background Art

[0002] Adoptive Cell Therapy (ACT) significantly enhances the ability of T cells to recognize and eliminate tumor cells by expanding or genetically modifying T cells in vitro and then infusing them into the body. It has become an important breakthrough in the field of tumor immunotherapy, especially in hematological malignancies. + Cytotoxic T lymphocytes (CTLs) have been the main research and application objects in ACT. However, more and more evidence shows that CD4 + T cell subsets also play an irreplaceable role in coordinating a lasting and effective anti-tumor immune response. + T cells can not only enhance CD8 + T cell function, some subsets themselves also have direct cytotoxic activity.

[0003] In a variety of CD4 + Among T cell subtypes, Th1 cells secrete cytokines such as IFN-γ, TNF-α, and IL-2, which activate dendritic cells (DCs) and promote CD8 + CTLs recruitment and effects have been widely studied and applied. However, Th1 cells are prone to functional exhaustion and apoptosis in tumor-related metabolic stress and immunosuppressive microenvironment, which seriously affects their survival and therapeutic persistence in vivo. Therefore, it is urgent to develop CD4 + T cell replacement subsets is one of the key scientific issues in current ACT research.

[0004] In this context, Th9 cells are a type of CD4 + T cell subtypes, due to their good in vivo persistence, anti-exhaustion ability and stem cell-like characteristics, have shown excellent anti-tumor activity in various tumor models. Despite this, the direct cytotoxic effect of Th9 cells themselves is limited, and their anti-tumor effect still mainly relies on indirect mechanisms and CD8 + The auxiliary effect of T cells has not yet reached its optimal state. Therefore, it is necessary to enhance the cytotoxic function of Th9 cells and their interaction with CD8 + The synergistic ability of T cells is the key direction to promote their widespread application in clinical practice.

[0005] As an important resource for drug discovery, natural products have long provided a large number of small molecule compounds with novel structures and unique mechanisms of action for tumor treatment and immune regulation. Among them, cyclic peptide natural products have become a class of functional molecules that have attracted much attention due to their excellent structural stability and ability to target intracellular protein-protein interactions. Classical cyclic peptides such as cyclosporine A and FK506 have been widely used in immunosuppressive therapy. In recent years, artificially synthesized cyclic peptides have also been used to target immune checkpoints (such as PD-1, CTLA-4, and LAG-3) to activate anti-tumor immune responses. However, in the context of adoptive cell therapy, the potential of natural cyclic peptides to positively regulate T cell differentiation and function has not been systematically explored. Summary of the Invention

[0006] The purpose of the present invention is to provide the use of indometine or its pharmaceutically acceptable salt in the preparation of a cellular immune regulator.

[0007] The structural formula of the Indometine is as follows:

[0008]

[0009] Preferably, the cellular immunomodulator is an enhancer of the anti-tumor activity of Th9 cells.

[0010] Preferably, it is a therapeutic enhancer of human Th9 CAR-T cells.

[0011] More preferably, the anti-tumor agent is an anti-melanoma agent.

[0012] Preferably, the cellular immunomodulator further contains a pharmaceutically acceptable carrier.

[0013] Preferably, the cellular immune modulator can be in any pharmaceutically acceptable dosage form, such as injection, oral administration, inhalation, transdermal administration, topical cream or gel or powder, or rectal administration.

[0014] The second object of the present invention is to provide a cellular immune regulator containing the above-mentioned indometine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0015] The third aspect of the present invention is to provide a method for preparing Endomelanconiopsis, which is isolated from the fermentation culture of the endophytic fungus Endomelanconiopsis sp. GLQ07 with a deposit number of GDMCC NO: 66086.

[0016] Preferably, the specific steps are:

[0017] First, the seed liquid of the strain Endomelanconiopsis sp.GLQ07 was inoculated into rice culture medium for cultivation. After cultivation, the bacteria were broken and soaked in methanol overnight. The supernatant was taken out, and the extract was concentrated under reduced pressure to remove methanol. The aqueous phase was extracted with ethyl acetate, and the extract was concentrated under reduced pressure to obtain an ethyl acetate extract. It was then separated by a normal phase silica gel column and eluted according to an isocratic solvent (dichloromethane:methanol = 95:5 v / v). According to the TLC thin layer plate display results, a TLC thin layer plate was obtained, and the developing solvent was dichloromethane:methanol = 90:10 v / v, R f =0.8 of Fr.B, the Fr.B component was purified by high performance liquid chromatography to obtain Indometyl cyclotide.

[0018] Preferably, the chromatographic conditions of the high performance liquid chromatography are as follows: an eluent volume fraction of 91% methanol-water solvent containing 0.1% formic acid, a flow rate of 2.5 mL / min, and a retention time of 30.0 min.

[0019] The present invention isolated and identified a cyclic peptide natural product, endomelipeptide A (EpA for short), from the endophytic fungus Endomelanconiopsis sp.GLQ07 of Ganoderma lucidum. EpA can selectively enhance the differentiation of Th9 cells without affecting the differentiation of other T cell subsets, and significantly promote the formation of their cytotoxic phenotype, improve mitochondrial function and enhance metabolic adaptability. Mechanism studies have shown that EpA synergistically acts on ZAP70 (a key kinase for TCR signal transduction) and SREBP1 (a major regulator of lipid metabolism) through dual targets, thereby achieving the functional integration of TCR signal amplification and fatty acid synthesis inhibition. Functionally, EpA-treated Th9 cells induced strong CD8 + The study also found that EpA can stimulate T cell-dependent anti-tumor immune responses and significantly enhance the therapeutic efficacy of human Th9 CAR-T cells. These research results clearly demonstrate that EpA is a T cell immunomodulator with promising clinical applications and significant technical value and industrial potential.

[0020] Endomelanconiopsis sp.GLQ07 was deposited on April 2, 2025 in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC, address: Guangdong Provincial Microbiological Culture Collection Center, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code 510070), with the deposit number GDMCC NO: 66086. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 EpA promotes Th9 cell differentiation in a concentration-dependent manner;

[0022] Figure 2EpA enhances Th9 cell anti-tumor response;

[0023] Figure 3 EpA promotes human Th9 differentiation and enhances the anti-tumor activity of Th9 CAR-T cells. DETAILED DESCRIPTION

[0024] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0025] Example 1:

[0026] 1. Isolation of Endomelanconiopsis sp. GLQ07 and Isolation and Identification of Endomelipeptide A

[0027] 1. Identification of the 16s rDNA gene sequence of Endomelanconiopsis sp. GLQ07

[0028] Fresh Ganoderma lucidum fruiting bodies were obtained from the Tianren planting base in Baiyun District, Guangzhou. The strain Endomelanconiopsis sp.GLQ07 was successfully isolated by tissue block isolation and culture method. The ITS sequence was identified and the ITS sequence was: AGGCGTCACGGGTCTTCGGACCTCTTCTCTCACACCCTATGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCGGCCGGCCCCCTAACCGGGGCTGGCCAGCGCCCGCC AGAGGACTACCAAAACTCCAGTCAGTAAACGTAGCTGTCTGATCAAAAGTTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACT CAAGCTCTGCTTGGTATTGGGCGCCGTCCTTCACCGGACGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAAAACACCTCGCTTTGGAGGACGGGACGTTCGCTCGCCGGACGAACCTTCTGAATTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCATAGGGCGGGAGGAAGCCCCAGGACGA(SEQ ID NO.1).

[0029] By submitting the ITS sequence to GenBank and performing homology comparison using NCBI, similar sequence information was obtained, and it was finally determined that Endomelanconiopsis sp was an endomelanconiopsis fungus with a homology score of 99.45%.

[0030] Based on the above identification results, it was determined that the Endomelanconiopsis sp.GLQ07 strain was an endomelanopsis. The strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC for short, address: Guangdong Provincial Microbiological Culture Collection Center, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou) on April 2, 2025, with the deposit number GDMCC NO: 66086.

[0031] 2. Isolation and identification of Endomelipeptide A

[0032] First, the strain Endomelanconiopsis sp. GLQ07 was inoculated into a Petri dish containing potato solid medium (2% glucose, 2% agar, and 20% potato, by mass) and cultured at 28°C for 4 days. Subsequently, an appropriate amount of mycelium was inoculated into 200 mL of potato liquid medium (2% glucose and 20% potato, by mass) containing 2% glucose. The culture was shaken in a shaker at 28°C and 220 rpm for 3 days to obtain seed solution.

[0033] Prepare 50 bottles of rice culture medium (60g rice, 0.3g glucose, 0.3g yeast extract, 80mL water), inoculate 3mL seed liquid in each bottle, and culture at 26℃. On the 30th day of culture, break the bacteria, soak them in methanol overnight, and take out the supernatant. After leaching 3 times, concentrate under reduced pressure to remove methanol. After the aqueous phase is extracted 3 times with ethyl acetate, combine and concentrate under reduced pressure to obtain ethyl acetate extract. Then separate through normal phase silica gel column, elute according to isocratic solvent (dichloromethane: methanol = 95:5), elute with 600ml solvent at each concentration. According to TLC thin layer plate (dichloromethane: methanol = 90:10, R f =0.8) to display the results, and merged into two segments Fr.A and Fr.B (TLC thin layer plate, developing solvent dichloromethane: methanol = 90:10 v / v, R f =0.8). The Fr.B component (1.46 g) was purified by HPLC (column model: YMC-Pack-ODS-A (250 mm × 10 mm, ID, 5 μm), flow rate 2.5 mL / min) under the following chromatographic conditions: 91% methanol in water containing 0.1% formic acid, to obtain the compound Endomelipeptide A (8.0 mg, retention time: 30.0 min). The tested NMR data were consistent with the literature data for anteiso-C15 Leu7surfactin. Its C NMR data were as follows: 13 C NMR (150 MH Z ,DMSO-d6)δ C171.1(Glu1 C=O), 52.6(Glu1α-C), 27.2(Glu1β-C), 29.8(Glu1γ-C), 174.1(Glu1δ-C=O), 173.0(Leu2 C=O),52.0(Leu2α-C),39.5(Leu2β-C),24.4(Leu2γ-C),23.0(Leu2δ-C),172.8(Leu3 C=O),51.9(Leu3α-C),39.0(Leu3β-C),24.4(Leu3γ-C),22.8(Leu3δ-C),170.9(Val4 C=O),58.7(Val4α-C),30.2(Val4β-C),18.0(Val4γ-C),170.1(Asp5 C=O),49.7(Asp5α-C),35.8(Asp5β-C),171.8(Asp5δ-C=O),171.7(Leu6 C=O),50.9(Leu6α-C),41.7(Leu6β-C),24.3(Leu6γ-C),22.6(Leu6δ-C),171.8(Leu7 C=O),50.9(Leu7α-C),38.9(Leu7β-C),24.2(Leu7γ-C),21.2(Leu7δ-C),170.1(Fatty acid-C1),41.3(Fatty acid-C2),71.5(Fatty acid-C3),33.7(Fatty acid-C4),24.4(Fatty acid-C5),28.7-29.5(Fatty acid-C6-C10), 36.1(Fatty acid-C11), 33.8(Fatty acid-C12), 26.6(Fatty acid-C13), 11.3(Fatty acid-C14), 19.2(Fatty acid-C15), so it is named endomelipeptide A (abbreviated as EpA), and its structural formula is shown in Formula I.

[0034]

[0035] Formula 1 Chemical structure of endomelipeptide A

[0036] 2. Cellular Immunomodulatory Effects of Endomelipeptide A

[0037] 1. Source and Treatment of Mice and Cell Lines

[0038] C57BL / 6 mice were purchased from the SPF animal facility of the Experimental Animal Center of Southern Medical University. M-NSG mice (model: NM-NSG-001) were purchased from Shanghai Model Organisms Technology Co., Ltd. OT-II transgenic mice (C57BL / 6-Tg(TcraTcrb)425Cbn / J, https: / / www.jax.org / strain / 004194) and CD45.1 congenic mice (B6.SJL-Ptprca-Pepcb / BoyJ, https: / / www.jax.org / strain / 002014) were a gift from Professor Sun Bing. All experimental animals were 6 to 8 weeks old and of the same age and origin. All experimental procedures strictly adhered to institutional animal ethics standards and were approved by the Animal Experimentation Ethics Committee of Southern Medical University.

[0039] Raji cell lines, HEK293T cell lines, and B16 melanoma cell lines were purchased from Wuhan Pronocell Co., Ltd., along with their derivative, B16-OVA (developed by laboratory members; see 2 for details). All were cultured in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco) and 100 U / mL penicillin-streptomycin. Raji cell lines were cultured in RPMI-1640 medium (Gibco), also supplemented with 10% FBS and antibiotics.

[0040] 2. Construction of B16-OVA cell line

[0041] Virus packaging (using Lipofectamine TM 3000 system): 1) Cell preparation: 293T cells were pre-seeded in a 6-well plate, with 8×10 5cells to ensure uniform cell density. The cells were cultured overnight in 2.5 ml of DMEM complete medium at 37°C and 5% CO2. Plated in the afternoon of the same day and transfected the next afternoon. 2) Transfection operation (Day 0): Discard the culture medium, leaving only about 1 mL per well to maintain the cell state. The transfection mixture was then prepared as follows: Solution A: Prepared according to the ratio of OVA overexpression plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd.): packaging plasmid = 1:1, add a total of 3 μg of plasmid to each well (i.e. 1.5 μg each), then add 6 μL of P3000 transfection enhancer, and use 125 μL of OPTI-MEM serum-free medium to mix thoroughly. Solution B: Take 125 μL of OPTI-MEM per well and add 6 μL of Lipofectamine 3000 transfection reagent. Finally, mix solutions A and B and let them stand at room temperature for 15 minutes to form a transfection complex. The mixture was then slowly added dropwise to the corresponding wells to avoid disturbing the cell monolayer. After gently shaking the culture plate horizontally, place it in a 37°C incubator and incubate for approximately 20 hours. 3) Collection and processing of OVA overexpression virus solution:

[0042] Day 1 (20 h after transfection): Remove the supernatant and add 2 mL of fresh DMEM complete medium to each well.

[0043] Day 2 (48 h after transfection): Collect the supernatant of the OVA overexpression virus solution and add 2 mL of complete culture medium to continue the culture.

[0044] Day 3 (60 h after transfection): The supernatant of the OVA-overexpressing virus solution was collected again, and the supernatants of 48 h and 60 h were mixed and filtered through a 0.22 μm filter membrane to remove cell debris. The obtained OVA-overexpressing virus solution can be used for subsequent infection experiments.

[0045] Construction of B16-OVA cell line: 1) Cell plating: B16 cells were counted and seeded into 48-well plates, with 3×10 cells per well. 510 cells (if a higher infection number is required, use a 24-well plate and increase the number of cells seeded accordingly) and culture in complete DMEM medium. 2) Viral infection: 12 hours after plating, discard the medium and add 500 μL of OVA-overexpressing virus solution filtered through a 0.22 μm filter to each well. Polybrene is added to a final concentration of 10 μg / mL to enhance viral infection efficiency. Seal the plate with parafilm and centrifuge at 2000 rpm for 2 hours to facilitate viral entry. 3) Subsequent culture and screening: After centrifugation, incubate the cells in a 37°C incubator overnight. The next day (after 12 hours), discard the virus solution and replace with fresh complete medium. Continue culturing for an additional 24–48 hours. Fluorescent protein expression can then be assessed by flow cytometry, and the cells can be transferred to T25 culture flasks for expansion. If desired, flow cytometry can be performed to identify B16 cell lines stably expressing OVA (i.e., B16-OVA).

[0046] 3. Induction and polarization of Th9 cells in vitro

[0047] Single cell suspensions were prepared from spleens and peripheral lymph nodes of 6–8 week old C57BL / 6 mice. Commercially available from BioLegend or STEMCELL Technologies. CD4 + T cell isolation kit separates and purifies naive CD4 T cells by negative selection + T cells. CD4 + T cells were inoculated into a culture system containing anti-CD3 / CD28 stimulation and induced to differentiate into Th9 cells under polarizing conditions with the addition of TGF-β (1 ng / mL) and IL-4 (10 ng / mL). A control group (adding an equal volume of DMSO) and an experimental group (adding 1 μM, 10 μM, or 20 μM EpA as needed) were also set up. Both groups of cells were polarized in vitro for 4 days under standard culture conditions (37°C, 5% CO2). After polarization, Th9 cells from the DMSO and EpA-treated groups were collected for subsequent flow cytometry analysis and adoptive transfer therapy.

[0048] 4. Flow cytometry

[0049] T cells were collected by centrifugation, washed with FACS buffer, and Fc receptors were blocked for 10 minutes using human TruStain FcX (BioLegend, 422301) or mouse TruStain FcX (BioLegend, 101319). They were then incubated with fluorescently labeled antibodies on ice in the dark in a 96-well V-bottom plate. After staining, the cells were washed twice and surface stained as described above. Cells were then fixed and permeabilized using the BD Cytofix / Cytoperm kit (Cat. No. 554714, BD Biosciences) according to the manufacturer's instructions, and intracellular staining was performed. Staining was performed using the following designated antibodies: anti-mouse IL-9, PE (RM9A4), Biolegend, 514104, anti-mouse CD4, APC / Cy7 (E-AB-F1353UJ), Elabscience, AF18028.

[0050] 5. Virus Production and Transduction

[0051] To construct human CAR-T cells, we cloned a chimeric antigen receptor (CAR) containing a CD19 single-chain antibody (scFv) containing the intracellular domains of 4-1BB and CD3ζ (reference doi: 10.1172 / jci.insight.121322 ) into the lentiviral vector pUltra to obtain lentiviral plasmid. Lentivirus particles were generated by HEK293T cells in 6-well plates by X-tremeGENE TM HP DNA transfection reagent (Roche) was used to co-transfect the plasmids and the viral supernatant was collected 48 h after transfection and stored at −80°C until use.

[0052] Before viral infection, human peripheral blood T cells were activated for 40 hours and collected and suspended in viral supernatant containing IL-2 (100 U / mL), polyisoprene (10 μg / mL), and anti-CD28 antibody (2 μg / mL). After centrifugation at 2000 rpm for 2 hours, the cells were cultured at 37°C for 24 hours. CAR-T cells were harvested on day 5 or 7 after stimulation for subsequent functional analysis.

[0053] 6. Isolation and Culture of Human T Cells

[0054] Isolation of human naive CD4 T cells from peripheral blood mononuclear cells (PBMC) of healthy donors + T cells, using EasySep TM Human naive CD4 +Cell purification was completed using the T Cell Isolation Kit II (#17555; STEMCELL Technologies). The cells were cultured in OptiVitro T Cell Specific Medium SF (TE000-N022; ExCell Bio) and supplemented with IL-2 (100 U / mL). T cells were activated using plate-coated anti-CD3 antibodies (OKT3, 5 μg / mL, BioLegend) and soluble anti-CD28 antibodies (CD28.2, 2 μg / mL). When inducing Th9 differentiation, IL-4 (10 ng / mL, Proteintech, AF-200-04), TGF-β (1 ng / mL, EPOTO Biotech) and anti-IFN-γ antibodies (10 μg / mL, BioXcell, BE0055-XMG1.2) were added to the culture system. Cells were collected after 3 days of culture and continued to be cultured for 1 day under the same factor conditions. Cells were collected on days 4, 5, and 6 for functional testing. In the adoptive transfer experiments, Th9 cells obtained on day 4 of culture were used and washed with PBS before injection into the tail vein.

[0055] 7. Tumor vaccination and treatment

[0056] In the C57BL / 6 mouse model, 5×10 5 B16-OVA melanoma cells (step 2) were used to establish a solid tumor model. On the 4th day after tumor inoculation, cyclophosphamide (CTX, 200 mg / kg, Sigma) was injected intraperitoneally for pretreatment. On the 5th day, 2×10 6 Th9 cells differentiated in vitro for 4 days were injected simultaneously with 4×10 5 At the designated time points, the cells were euthanized and spleen, tumor-draining lymph nodes (TDLN), and tumor tissues were collected for analysis.

[0057] In NSG mice, 1 × 10 6 Raji-CD19 tumor cells were used to establish a xenograft model. On day 5, 2×10 6 Human CD19-CAR Th9 cells (Th9 cells from step 6) were used to evaluate their in vivo anti-tumor activity.

[0058] 8. Statistical analysis

[0059] All statistical analyses were performed using GraphPad Prism 9 software. Data are presented as mean ± standard error of the mean (SEM). Unless otherwise stated, comparisons between two groups were performed using a two-sided unpaired Student's t-test or Mann-Whitney U test. For comparisons of three or more groups, one-way analysis of variance (ANOVA) combined with Tukey's test for multiple comparisons was used. Survival data were analyzed using the log-rank test, unless otherwise stated. A p-value of less than 0.05 was considered statistically significant.

[0060] 3. Research Results

[0061] 1. If Figure 1 As shown, flow cytometry was used to detect the expression level of IL-9, showing the effect of different concentrations of EpA on the polarization of Th9 cells. All data are expressed as mean ± standard error (SEM) and statistically analyzed by one-way analysis of variance (ANOVA) combined with Tukey's test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 1 It can be seen that EpA promotes Th9 cell differentiation in a concentration-dependent manner.

[0062] 2. Experimental flow chart: C57BL / 6 mice were subcutaneously inoculated with 5×10 5 B16-OVA tumor cells were injected with CTX (200 mg / kg) on ​​day 4, and OT-II Th9 cells (2×10 6 Figures were generated using BioRender. All data are presented as mean ± standard error (SEM) and analyzed using one-way ANOVA with Tukey's test. *p < 0.05. Figure 2 The diagrams in this paper were created using BioRender. Figure 2 It can be seen that EpA enhances the anti-tumor response of Th9 cells.

[0063] 3. Figure 3Figure 2. A. Schematic diagram of the Raji-ffLuc xenograft model, showing the experimental protocol for injection of control or EpA-treated Th9-CAR-T cells into the tail vein of NSG mice (n = 5 / group). This figure was created by BioRender. D. Tumor burden was assessed by in vivo bioluminescence imaging on day 2 (D shows an example image, and B shows quantitative analysis). C. Kaplan-Meier survival curves comparing survival times among treatment groups. All data are presented as mean ± standard error of variance (SEM) and statistically analyzed using one-way analysis of variance (ANOVA), Tukey's test (B), and log-rank test (C). *p < 0.05, ***p < 0.001, ****p < 0.0001. Figure 3 The schematic diagram in A was created using BioRender. Figure 3 It can be seen that EpA promotes human Th9 differentiation and enhances the anti-tumor activity of Th9 CAR-T cells.

[0064] IV. Conclusion

[0065] During the screening of candidate compounds, we found a class of cyclic lipopeptides, EpA, which has been reported but its immune function is not yet clear. In the in vitro differentiation experiment, EpA can significantly induce CD4 + T cells secrete IL-9 and show excellent Th9 differentiation enhancement activity, so they were selected as the core object for subsequent mechanism research. The optimal concentration of EpA was determined by dose gradient experiments. + T cells were treated with different concentrations of EpA under standard Th9 polarization conditions to detect IL-9 expression levels. The results showed that the Th9 polarization effect was strongest at 10 μM. Figure 1 ), so this concentration was used in all subsequent experiments. For in vivo functional validation, we used the B16-OVA melanoma mouse model. Tumor-bearing mice were intravenously injected with OT-II Th9 cells that had been treated with EpA. The results showed that compared with the control Th9 treatment group, the tumor burden of mice in the EpA-Th9 group was significantly reduced, suggesting that EpA-polarized Th9 cells have stronger anti-tumor ability ( Figure 2). To further verify the role of EpA-Th9 in the context of human cells, we established a Raji xenograft model in NSG mice and infused control Th9 CAR-T or EpA-Th9 CAR-T cells. The results showed that the EpA-treated group significantly reduced tumor burden and significantly prolonged mouse survival. These results indicate that EpA not only enhances the anti-tumor activity of Th9 cells in the mouse model, but also significantly enhances the efficacy of human Th9CAR-T cells. These results indicate that EpA not only promotes the differentiation and metabolic activation of human Th9 cells, but also significantly enhances the anti-tumor efficacy of Th9 CAR-T cells in vitro and in vivo.

[0066] In summary, we identify EpA as a highly valuable cyclic peptide that addresses key limitations of traditional Th9-based adoptive cell therapy (ACT). More broadly, our study reveals how pharmacological integration of immune signaling and metabolism can unlock the potential within Th9 cells, providing a powerful strategy for enhancing the efficacy of cellular immunotherapy.

Claims

1. Use of Indometine or its pharmaceutically acceptable salts, solvates, or derivatives in the preparation of cellular immune modulators; The structural formula of the Indometine is as follows:

2. The use according to claim 1, characterized in that The cellular immunomodulator is an enhancer of the anti-tumor activity of Th9 cells.

3. The use according to claim 2, characterized in that The cellular immunomodulator is a therapeutic enhancer of human Th9 CAR-T cells.

4. The use according to claim 2, characterized in that The anti-tumor agent is anti-melanoma.

5. The use according to claim 1, characterized in that The cellular immune regulator also contains a pharmaceutically acceptable carrier.

6. The use according to claim 1, characterized in that The cellular immune regulator can be in any pharmaceutically acceptable dosage form.

7. The use according to claim 6, characterized in that The cellular immune modulator is in the form of an injection, oral administration, inhalation, transdermal administration, topical cream or gel or powder, or rectal administration.

8. A cellular immune regulator, characterized in that Containing indometine or its pharmaceutically acceptable salt, solvate, or derivative as an active ingredient; The structural formula of the Indometine is as follows:

9. A method for preparing the indometine according to claim 1, characterized in that: It is isolated from the fermentation culture of the endophytic fungus Endomelanconiopsis sp.GLQ07 GDMCC NO:66086.

10. The method according to claim 9, characterized in that The specific steps are: First, the seed liquid of the strain Endomelanconiopsis sp.GLQ07 was inoculated into rice culture medium for cultivation. After cultivation, the bacteria were broken and soaked in methanol overnight. The supernatant was taken out, and the extract was concentrated under reduced pressure to remove methanol. The aqueous phase was extracted with ethyl acetate, and the extract was concentrated under reduced pressure to obtain an ethyl acetate extract. It was then separated by a normal phase silica gel column and eluted according to an isocratic solvent (dichloromethane:methanol = 95:5 v / v). According to the TLC thin layer plate display results, a TLC thin layer plate was obtained, and the developing solvent was dichloromethane:methanol = 90:10 v / v, R f =0.8 Fr.B, the Fr.B component is purified by high performance liquid chromatography to obtain indometal cyclic peptide. Preferably, the high performance liquid chromatography has the following chromatographic conditions: an eluent volume fraction of 91% methanol-water solvent, containing 0.1% formic acid, a flow rate of 2.5 mL / min, and a retention time of 30.0 min.

Images