Transcription factor for regulating and controlling drug resistance of plant pathogenic fungi and application of transcription factor
By regulating the transcription factor PoATFS1 of rice blast fungus and affecting its mtDNA copy number, the problem of rice blast fungus's resistance to mitochondrial respiration inhibitors was solved, and the sensitivity to drugs was improved and the synergistic effect of environmentally friendly fungicides was enhanced.
Patent Information
- Application Number
- CN202511183321.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-22
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-08-22
AI Technical Summary
Rice blast fungus has developed resistance to mitochondrial respiratory inhibitors, resulting in a decrease in the effectiveness of pesticides. The use of existing chemical pesticides brings environmental hazards, and there is a lack of effective gene regulation strategies to improve pesticide sensitivity.
A transcription factor PoATFS1 that regulates the resistance of plant pathogenic fungi is provided. By affecting the mtDNA copy number of rice blast fungus, the sensitivity to respiratory inhibitors is enhanced. The transcription factor encoding gene is used to construct recombinant vectors, microorganisms, plant cell lines and other biological materials to regulate mitochondrial dysfunction.
It significantly increased the sensitivity of rice blast fungus to mitochondrial respiratory inhibitors, reduced drug resistance, enhanced the activity of existing fungicides, provided target proteins for resistance management, and offered a new strategy for drug sensitivity and homeostasis regulation.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biology, and more specifically relates to a transcription factor for regulating the sensitivity of plant pathogenic fungi to mitochondrial respiratory inhibitors and mitochondrial homeostasis and an application thereof. Background Art
[0002] Rice blast is caused by Pyricularia oryzae ( Pyricularia oryzae ) is the world's most serious rice disease that has the most serious impact on rice production safety due to infection. Chemical agents are the main measures to prevent and control this disease, among which respiratory inhibitors are an important type of fungicide. At present, mitochondrial respiratory inhibitors that can be used for the prevention and control of rice blast fungi mainly include SDHI agents such as flupyraclostrobin that act on complex II, SDHI agents such as myclobutanil that act on complex III, and the uncoupling inhibitor fluazinam. However, inhibitors targeting mitochondrial complex I are particularly scarce, with only flupyraclostrobin. In recent years, Shenyang Sinochem Pesticide Chemical Research and Development Co., Ltd. has developed a new pyrimidine fungicide SYP-34773. The team's preliminary research has shown that it acts on mitochondrial complex I and has excellent prevention effects on rice blast and other diseases.
[0003] However, repeated application of chemical pesticides can easily lead to resistance in the rice blast fungus, resulting in reduced efficacy and significant economic losses. This, in turn, can lead to excessive pesticide use and environmental and ecological damage. Since the 1990s, resistant strains of the fungus have been discovered in major rice-growing areas in my country, necessitating urgent attention. Therefore, clarifying the mechanism of resistance to mitochondrial respiratory inhibitors and developing effective gene regulation strategies could provide important insights for improving pesticide sensitivity and managing resistance. Summary of the Invention
[0004] Therefore, the purpose of the present invention is to provide a transcription factor that regulates drug resistance in plant pathogenic fungi, as well as its encoding gene and application. This transcription factor is a bZIP transcription factor that mediates changes in the sensitivity of rice blast fungi to mitochondrial respiratory inhibitors and is highly expressed when mitochondria are dysfunctional, enhancing the replication of mtDNA in mitochondria. It can affect the copy number of mtDNA in rice blast fungi and lead to changes in the sensitivity of rice blast fungi to respiratory inhibitors. The present invention provides a target protein for the development of synergists for managing resistance to respiratory inhibitors and enhancing the activity of existing fungicides, representing a new resistance management strategy.
[0005] The above technical objectives of the present invention are achieved through the following technical solutions: a transcription factor that affects the copy number of mtDNA of rice blast fungus and causes the sensitivity of rice blast fungus to respiratory inhibitors to change, the transcription factor is PoATFS1 Transcription factor.
[0006] The transcription factor is a protein as shown in SEQ ID No. 2; The coding gene of the transcription factor is a DNA molecule as shown in SEQ ID NO.1 in the sequence table.
[0007] The present invention also provides a biological material containing the nucleic acid molecule encoding the gene, which is any one of the following C1) to C8): C1) an expression cassette containing the encoding gene; C2) a recombinant vector containing the encoding gene, or a recombinant vector containing the expression cassette described in C1); C3) a recombinant microorganism containing the encoding gene, or a recombinant microorganism containing the expression cassette described in C1), or a recombinant microorganism containing the recombinant vector described in C2); C4) a transgenic plant cell line containing the encoding gene, or a transgenic plant cell line containing the expression cassette described in C1); C5) transgenic plant tissue containing the encoding gene, or transgenic plant tissue containing the expression cassette described in C2); C6) a transgenic plant organ containing the encoding gene, or a transgenic plant organ containing the expression cassette described in C2); C7) a nucleic acid molecule that inhibits the expression of the encoding gene; C8) An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing the nucleic acid molecule described in C7).
[0008] The use of the transcription factor or its encoding gene or the above-mentioned biological material in regulating (increasing or reducing) the drug resistance of plant pathogenic fungi also falls within the protection scope of the present invention.
[0009] The use of the transcription factor or its encoding gene or the above-mentioned biological material in regulating (increasing or decreasing) the mitochondrial homeostasis of plant pathogenic fungi also falls within the scope of protection of the present invention.
[0010] Wherein, the plant pathogen is rice blast fungus ( Pyricularia oryzae The transcription factor or its encoding gene can affect the copy number of the rice blast fungus's mtDNA and lead to changes in the fungus's sensitivity to respiratory inhibitors. The drug resistance is resistance to mitochondrial respiratory chain inhibitors; the mitochondrial respiratory chain inhibitor is selected from one or any combination of two or more of SYP-34773, fluopyram, flupyrad, azoxystrobin, and fluazinam.
[0011] In summary, the present invention has the following beneficial effects: In the present invention, the transcription factor can affect the copy number of the rice blast fungus's mtDNA, leading to changes in the fungus's sensitivity to respiratory inhibitors. Knocking out a single target gene in the pathogen only slightly reduces the pathogen's resistance to certain fungicides, while targeting a key transcription factor can affect mitochondrial homeostasis, thereby reducing the pathogen's resistance to the agent. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 bZIP transcription factor ATFS1 Homology analysis.
[0013] Figure 2 bZIP transcription factor ATFS1 Expression analysis; the different treatments were the wild-type parent strain S118 of rice blast fungus without drug treatment, the parent strain S118 treated with SYP-34773 (SYP-S118); the SYP-34773-resistant strains R118-4-1, R118-10-1, and R118-4-3-3 of rice blast fungus without drug treatment, and the SYP-34773-resistant strains R118-4-1 (SYP-R118-4-1), R118-10-1 (SYP-R118-10-1), and R118-4-3-3 (SYP-R118-4-3-3).
[0014] Figure 3 yes PoATFS1 PCR verification gel image of overexpression vector.
[0015] Figure 4 yes PoATFS1 Gene knockout strategy diagram; using the principle of homologous recombination, HPT is used to replace the target gene to be knocked out.
[0016] Figure 5 Yes PoATFS1 PCR verification gel image of the upstream fragment pKOV21-up and downstream fragment pKOV21-down in the knockout vector.
[0017] Figure 6 yes PoATFS1 PCR verification gel images of knockout transformants △PoATFS1-12, △PoATFS1-16, △PoATFS1-19 and △PoATFS1-26.
[0018] Figure 7 yes PoATFS1Western blotting validation gel images of overexpressing transformants PoATFS1-22, PoATFS1-17, PoATFS1-18, PoATFS1-76, PoATFS1-37, PoATFS1-65, and PoATFS1-79. DETAILED DESCRIPTION
[0019] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The materials and reagents used in the following examples, unless otherwise specified, can all be obtained from commercial sources.
[0020] Rice blast fungus P131, published in Shi W, Yang J, Chen D, et al. 2022. The rice blastfungus SR protein 1 regulates alternative splicing with unique mechanisms. PLOS Pathogens 18(12): e1011036, is a standard strain donated by Professor Peng Youliang's laboratory at China Agricultural University and is deposited in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University. It is available to the public from China Agricultural University.
[0021] Magnaporthe grisea S118, published in Zhang C, Meng D, Wang W, et al. 2020. Overexpression of three P450 genes is responsible for resistance to novel pyrimidine amines in Magnaporthe oryzae . Pest Management Science 76(12):4268-4277, deposited in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University. The strains were collected and isolated from the field by the laboratory and are available to the public from China Agricultural University.
[0022] The blast-resistant strains R118-4-1, R118-4-3, and R118-10-1 were domesticated from the wild-type sensitive strain S118 via SYP-34773, and the low-level resistant strains R118-4 and R118-10 were obtained (published in Zhang C, Meng D, WangW, et al. 2020. Overexpression of three P450 genes is responsible for resistance to novel pyrimidine amines in Magnaporthe oryzae Pest Management Science 76(12):4268-4277), medium- and high-level resistant strains were obtained by further domestication of SYP-34773 and are stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. The public can obtain them from China Agricultural University.
[0023] The pGTN vector was published in Shi W, Yang J, Chen D, et al. 2022. The rice blastfungus SR protein 1 regulates alternative splicing with unique mechanisms. PLOS Pathogens 18(12): e1011036. The overexpression and subcellular localization vectors were donated by Professor Peng Youliang's research group at the College of Plant Protection, China Agricultural University. They are stored in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University and are available to the public from China Agricultural University.
[0024] The pKOV21 vector was published in Shi W, Yang J, Chen D, et al. 2022. The rice blastfungus SR protein 1 regulates alternative splicing with unique mechanisms. PLOS Pathogens 18(12): e1011036. It was donated by Professor Peng Youliang's research group at the College of Plant Protection, China Agricultural University and is deposited in the Seed Pathology and Fungicide Pharmacology Laboratory, College of Plant Protection, China Agricultural University. It is available to the public from China Agricultural University.
[0025] SYP-34773 published in Zhang C, Meng D, Wang W, et al. 2020. Overexpression of three P450 genes is responsible for resistance to novel pyrimidine aminesin Magnaporthe oryzae . Pest Management Science 76(12):4268-4277, from Shenyang Sinochem Pesticide Chemical Research and Development Co., Ltd., with an active ingredient content of 96.8%, and the chemical structure is shown in Formula I.
[0026]
[0027] Azoxystrobin, from Syngenta China Co., Ltd., has an active ingredient content of 98%.
[0028] Flupyraclostrobin, from BASF (China) Co., Ltd., has an active ingredient content of 98%.
[0029] Fluoxatomid comes from Shenyang Sinochem Pesticide Chemical Research Co., Ltd. and has an active ingredient content of 90%.
[0030] Fluazinam, from Shandong Zhongnong United Biotechnology Co., Ltd., has an active ingredient content of 95.8%.
[0031] Example 1: Acquisition of resistant strains The sensitive strain S118, isolated from the field in the laboratory, was used as the parent. It was inoculated on PDA medium and cultured at 25°C for 7 days. The strains were then screened on plates containing 10 μg / mL and 50 μg / mL SYP-34773, respectively. After 7 days, the plates were observed and colonies obtained from the plates were transferred to untreated PDA plates for propagation to determine the drug sensitivity of the suspected mutants and stored. Low-level resistant mutants R118-4 and R118-10 were obtained, with resistance multiples of 15.00 and 7.00, respectively (Table 1). The low-resistant strains were further inoculated twice on PDA medium containing 100 μg / mL SYP-34773 for acclimatization. The strains were then transferred to untreated PDA plates for propagation to determine the drug sensitivity of the suspected mutants and stored. The moderately and highly resistant strains R118-4-1, R118-4-3-3, and R118-10-1 used in this study were obtained through acclimation, with resistance multiples ranging from 26.17 to 68.75 (Table 1). The sensitivity of the resistant strains to the mitochondrial respiratory inhibitor fluopyram was tested using PDA medium containing fluopyram at concentrations of 0, 2.5, 10, 20, 50, and 100. The resistance multiples of the moderately and highly resistant strains R118-4-1, R118-4-3-3, and R118-10-1 to fluopyram ranged from 21.58 to 33.81 (Table 2).
[0032] Table 1. Sensitivity of S118 strains to SYP-34773
[0033]
[0034] Example 2: Transcriptomics data analysis revealed transcription factors PoATFS1 By analyzing transcriptome data, we found that bZIP transcription factor genes MGG-02865 The expression of the parental strain S118 was significantly upregulated after drug treatment, and the expression of the mutant R118-10-1 was further upregulated after drug treatment. According to the previous literature report that the bZIP transcription factor ATFS1 domain is associated with the increase of mtDNA content, among the proteins containing similar domains in rice blast fungus, MGG-02865 has the highest homology with ATFS1 at 21.72%. Further phylogenetic analysis of related bZIP transcription factors in mammals, plants, and fungi showed that MGG-02865 in rice blast fungus is still more closely related to ATFS1 in Caenorhabditis elegans, and MGG-02865 was named PoATFS1 For subsequent research ( Figure 1 ).
[0035] Example 3:PoATFS1 Differential gene expression analysis The qPCR method was used to analyze the above transcription factors PoATFS1 The expression differences were determined.
[0036] The transcription factor PoATFS1 The qPCR primer pairs are: PoATFS1 Forward primer: 5′-AACTACCAGGCTGATACCAA-3′ (SEQ ID No. 3); PoATFS1 Reverse primer: 5′-ATGTCCATCATAACTTCCCCA-3′ (SEQ ID No. 4).
[0037] like Figure 2 As shown, transcription factors [[ID= After drug addition, the expression levels of antibody mutants R118-10-1, R118-4-1, and R118-4-3-3 were increased by 2.0 to 115.4 times compared with the parent strain S118; in the absence of drug addition, the expression levels of R118-4-1 and R118-4-3-3 antibody mutants were increased by 2.1 to 12.9 times compared with the parent strain S118.
[0038] Example 4: Transcription Factors of the Present Invention Functions and applications 1. Build Overexpression and knockout vectors (1) Construction Overexpression vector: The wild-type parent strain S118 and the standard strain P131 of rice blast fungus were used as templates. Forward primer and The reverse primer is a primer that amplifies Fragments, found the two The sequence is completely consistent with the sequence 1 in the sequence table, encoding the amino acid sequence of sequence 2 in the sequence table; at the same time, the overexpression vector pGTN is digested with Bam I enzyme, and the The fragment was connected with the pGTN vector fragment by homologous recombination, transformed into Escherichia coli, screened for positive clones on ampicillin-resistant plates and verified by PCR. As can be seen from the figure, the recombinant plasmid was amplified with the universal primers on the vector, and a band of similar size to the target gene was obtained, indicating that the constructed overexpression vector has successfully Gene integration.
[0039] The transcription factor The primer pairs for overexpression vector amplification are: Forward primer: 5'-GCACCAAACCGCCAAAGGATCCATGGAGTCAAACAGC-3' (SEQ ID No. 5) Reverse primer: 5'-CTGCAGGAATTCGATCACTCGACCAGGCGCAGC-3' (SEQ ID No. 6) The universal primer pairs on the pGTN vector are: pGTN forward primer: 5'- ACGAACCCTTCTCTTCCCTTTCTC -3' (SEQ ID No.7) pGTN reverse primer: 5'- A ATCTTATCGAGATCCTGAACACCAT-3' (SEQ ID No.8) (2) Construction Knockout vector: The wild-type parent strain S118 of rice blast fungus and the standard strain P131 of rice blast fungus were used as templates, respectively. As shown, specific primers were used to amplify approximately 1500 bp of The upstream and downstream fragments of the gene were found to have completely identical sequences, and the PCR products were recovered and purified. The downstream fragment was connected to the The pKOV21 vector was digested with enzyme III, and the ligation product was transformed into E. coli. Positive clones were screened on ampicillin-resistant plates. The upstream fragment was ligated to the vector using seamless cloning. The single enzyme digestion with I has been successfully connected to the downstream recombinant vector. PCR verification was performed and the obtained band size was consistent with the expected result, indicating that the Gene knockout vectors, such as shown.
[0040] The transcription factor The primer pairs for knockout vector amplification are: Upstream forward primer: 5'-ACCAAACCGCCAAAGGATCCATGGCAGACAAGACCGAGAGGC-3' (SEQ ID No.9) Upstream reverse primer: 5'-TAGAACTAGTGGATCCTTACATCTCCACAGCCCTGGC-3' (SEQ ID No. 10) Downstream forward primer: 5'-GGGAACCAGTTATCAAGCTTGTGCTTCCGTTTTCGCCACC-3' (SEQ ID No. 11) Downstream forward and reverse primers: 5'-CGACGGTATCGATAAGCTTCGTGCATGTACTTGGTAGGTTG-3' (SEQ ID No. 12) Colony PCR verification of the pKOV21 knockout vector downstream of the forward primer: 5'-GCACCAAACCGCCAAAGGATCCATGGAGTCAAACAGCAACCG-3' (SEQ ID No. 13) Downstream reverse primer for colony PCR verification of pKOV21 knockout vector: 5'-CTGCAGGAATTCGATCACTCGACCAGGCGCAGC-3' (SEQ ID No. 14) Colony PCR verification of the upstream pKOV21 knockout vector forward primer: 5'-GCAGGCAGAACGCGAAGCT-3' (SEQ ID No.15) Reverse primer for colony PCR verification of the upstream pKOV21 knockout vector: 5'-CGACGTAAACGGCCACAAGT-3' (SEQ ID No.16) 2. Obtaining knockout and overexpression transformant strains (1) Obtaining knockout transformants: The knockout vector was transformed into the rice blast fungus S118 strain by PEG-mediated protoplast transformation, and the transformants were selected for PCR verification. shown.
[0041] The transcription factor The verification primer pairs for the upstream and downstream homology arms of the knockout transformants are: Upstream forward primer: 5'-CTACACACTACACAGTACATGCG -3' (SEQ ID No. 17) Upstream reverse primer: 5'-GCAGGACATATCCACGCCCTCCTAC-3' (SEQ ID No. 18) Downstream forward primer: 5'-ATTTCGATGATGCAGCTTGGGCG-3' (SEQ ID No. 19) Downstream reverse primer: 5'-GTTGTCCGAAGTAGTATTTGTTATG-3' (SEQ ID No. 20) Knockout transformants Gene PCR verification forward primer: 5'-ACGAACCCTTCTCTTCCCTTTCTC-3' (SEQ ID No. 21) Knockout transformants Gene PCR verification reverse primer: 5'-ATCTTATCGAGATCCTGAACACCAT-3' (SEQ ID No. 22) (2) Obtaining overexpression transformants: To verify that in the wild-type parent strain S118 The results of the gene overexpression test were further analyzed by PEG-mediated protoplast transformation of rice blast fungus to transform the overexpression vector into the standard strain P131 of rice blast fungus for subsequent drug sensitivity test. The selected transformants were verified by Western blotting, and GFP-labeled positive overexpression transformants and GFP-labeled empty vector transformants were obtained. shown.
[0042] 3. Sensitivity of gene overexpression and knockout transformants to SYP-34773.
[0043] The in vitro mycelial growth rate method was used to determine the parent strain and the two strains Overexpression strains and 2 strains To test the sensitivity of the knockout strain to SYP-34773, 5 mm cakes were taken from the edge of the 7-day-old colony and inoculated onto PDA medium with different concentrations of the drug (0, 0.0001, 0.0025, 0.01, 0.1, 1, 5, 10, and 100 μg / mL). Each treatment was repeated three times. After culturing at 25°C in the dark for 7 days, the diameter was measured and the inhibition rate and EC were calculated. 50 (Drug concentration when the inhibition rate is 50%).
[0044] P131 parent obtained EC of gene overexpression transformants PoATFS1-22 and PoATFS1-37 compared with their parents 50 The values increased by 2.02 to 2.63 times, and EC 90 The values increased by 5.55 to 8.81 times, indicating that Gene overexpression resulted in decreased sensitivity of rice blast fungus P131 to SYP-34773.
[0045] S118 parent obtained EC of gene knockout transformants △PoATFS1-16 and △PoATFS1-26 compared with their parents 50 The values decreased significantly by 0.05 to 0.16 times, indicating that Gene knockout resulted in increased sensitivity of rice blast fungus S118 to SYP-34773 (Table 3).
[0046]
[0047] 4. Sensitivity of gene overexpression and knockout transformants to mitochondrial respiratory chain inhibitors Determination of mycelial growth rate using the mycelial growth rate method Sensitivity of gene-overexpressing transformants PoATFS1-22 and PoATFS1-37 to mitochondrial respiratory chain inhibitors (fluopyram, fluopyram, azoxystrobin, and fluazinam). EC of gene overexpression transformants PoATFS1-22 and PoATFS1-37 compared with their parents 50 The values increased by 1.41 to 35.04 times, indicating that Gene overexpression leads to decreased sensitivity of rice blast fungus P131 to mitochondrial respiratory chain inhibitors.
[0048] EC of gene knockout transformants △PoATFS1-16 and △PoATFS1-26 compared with their parents 50 The values decreased significantly by 0.005 to 0.64 times, indicating that Gene knockout resulted in increased sensitivity of rice blast fungus S118 to mitochondrial respiratory chain inhibitors. This is related to the sensitivity of rice blast fungus to mitochondrial respiratory chain inhibitors (Table 4).
[0049] Table 4 Sensitivity of gene transformants to mitochondrial respiratory chain inhibitors
[0050] 5. Relative content of mitochondrial DNA in gene transformants The expression levels of four mitochondrial genes encoding core subunits of mitochondrial complex I in the overexpression transformants, control strains and parental strains were detected by qPCR.
[0051] Inoculate the transformants and parent strain onto a PDA plate covered with cellophane. Once the mycelium has grown completely over the cellophane, scrape the mycelium into a 2 mL centrifuge tube and extract DNA using the CTAB method. Establish a melting curve using the DNA as a template, and quantify the DNA concentration of all samples to a uniform level. Select mitochondrial genes: 、 、 and , nuclear genes: , using DNA as a template to determine the CT values of the above five genes in transformants and parental strains, calculate the mitochondrial DNA (mtDNA) copy number using formulas 1 and 2, and determine the relative mtDNA content of transformants using formula 3. Repeat three times.
[0052]
[0053] The gene 、 、 、 and The primer pairs for expression detection are: Upstream primer: 5'-TCCGTAACCTTTAGGCGAGA-3' (SEQ ID No. 23) Downstream primer: 5'-AGCTCAAACTTTTCTAGGGTGAAA-3' (SEQ ID No. 24) Upstream primer: 5'-ATTTTCGAGTGTGGTTTCCA-3' (SEQ ID No. 25) Downstream primer: 5'-AAGAGCGCTTTTACCTAATTCAA-3' (SEQ ID No. 26) Upstream primer: 5'- GTTCTGTATCACACGCTGCTG -3' (SEQ ID No. 27) Downstream primer: 5'-AGGTGCACCACAATTCCCTA-3' (SEQ ID No. 28) Upstream primer: 5'-AAAGCAACTAGAATACCCAAACC-3' (SEQ ID No. 29) Downstream primer: 5'-GGAGTCTTAGGATTTGTGTTAAATAGA-3' (SEQ ID No. 30) Upstream primer: 5'-CTTAAAACCAGCCTCAACCAA-3' (SEQ ID No. 31) Downstream primer: 5'-TTTGACCAGAAAAAGCATGTAT-3' (SEQ ID No. 32) Determined The mtDNA copy numbers in the gene transformants, control strains, and parental strains are shown in Tables 5 and 6. The mtDNA copy number of the gene overexpression transformants was higher than that of the parent strain P131 and the empty vector transformant P131 / pGTN. The relative mtDNA content of gene overexpression transformants was 1.41-3.05 times higher than that of the parent strain P131. The mtDNA copy number of knockout transformants was lower than that of the parent strain S118, and the relative mtDNA content was 0.40-0.83 times lower than that of the parent strain P131.
[0054] Table 5. mtDNA copy number in gene overexpression transformants
[0055] Table 6. Relative content of mtDNA in gene transformants
[0056] The specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the embodiments as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by patent law.
Claims
1. A transcription factor; characterized in that The transcription factor is a protein as shown in SEQ ID No.
2.
2. The gene encoding the transcription factor according to claim 1.
3. The coding gene according to claim 2, characterized in that The coding gene is a DNA molecule shown in SEQ ID NO.1 in the sequence table.
4. The biological material containing the nucleic acid molecule encoding the gene according to claim 3, which is any one of the following C1) to C8): C1) an expression cassette containing the encoding gene according to claim 3; C2) a recombinant vector containing the coding gene according to claim 3, or a recombinant vector containing the expression cassette according to C1); C3) a recombinant vector containing the encoding gene of claim 3, or a recombinant microorganism containing the expression cassette of C1), or a recombinant microorganism containing the recombinant vector of C2); C4) a transgenic plant cell line containing the encoding gene of claim 3, or a transgenic plant cell line containing the expression cassette of C1); C5) a transgenic plant tissue containing the encoding gene of claim 3, or a transgenic plant tissue containing the expression cassette of C2); C6) A transgenic plant organ containing the encoding gene of claim 3, or a transgenic plant organ containing the expression cassette of C2); C7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 3; C8) An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing the nucleic acid molecule described in C7).
5. Use of the transcription factor according to claim 1 or 2 or the encoding gene according to claim 3 as any one of the following 1) and 2): 1) Application in regulating the resistance of plant pathogenic fungi; 2) Application in regulating mitochondrial homeostasis of plant pathogenic fungi.
6. The use according to claim 5, wherein the plant pathogenic fungus is rice blast fungus ( Pyricularia oryzae ); the drug resistance is resistance to mitochondrial respiratory chain inhibitors; the mitochondrial respiratory chain inhibitors are selected from one or any combination of two or more of SYP-34773, fluopyram, flupyrad, azoxystrobin and fluazinam.
7. The use according to claim 5, wherein the use in regulating mitochondrial homeostasis of plant pathogenic fungi is the use of the transcription factor in regulating the sensitivity of rice blast fungus to respiratory inhibitors and affecting the mtDNA content.
8. The application of the biomaterial according to claim 4 to plant pathogenic fungi is any one of the following 1) and 2): 1) Application in regulating the resistance of plant pathogenic fungi; 2) Application in regulating mitochondrial homeostasis of plant pathogenic fungi.
9. The use according to claim 8, wherein the plant pathogenic fungus is rice blast fungus ( Pyricularia oryzae ); the application in regulating mitochondrial homeostasis of plant pathogenic fungi is the application of the transcription factor in regulating its sensitivity to respiratory inhibitors in rice blast fungus and affecting the mtDNA content; the drug resistance is resistance to mitochondrial respiratory chain inhibitors; the mitochondrial respiratory chain inhibitor is selected from one or any combination of two or more of SYP-34773, fluopyram, flupyrad, azoxystrobin and fluazinam.
10. A method for regulating drug resistance of plant pathogenic fungi, comprising the following steps: 1) Transforming the gene encoding the transcription factor according to claim 3 into a plant pathogen for expression, thereby reducing the sensitivity of the plant pathogen to pesticides; or, 2) inactivating the gene encoding the transcription factor according to claim 3 in plant pathogens, thereby increasing the sensitivity of the plant pathogens to pesticides; The plant pathogen is rice blast fungus ( Pyricularia oryzae ).
Citation Information
Patent Citations
Application of pathogenic factor of magnaporthe oryzae or gene for coding pathogenic factor
CN113698461A
Transcription factor for regulating and controlling drug resistance of plant pathogenic fungi and application of transcription factor
CN119161432A