Transcription factor for regulating drug resistance of plant pathogenic fungi and application thereof

By regulating the mtDNA copy number of rice blast fungus and using the bZIP transcription factor PoATFS1 to regulate the sensitivity of rice blast fungus to respiratory inhibitors, the problem of rice blast fungus resistance was solved, and the synergistic effect of fungicides was achieved.

CN120665164BActive Publication Date: 2026-02-10CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511183321.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2026-02-10
Estimated Expiration
2045-08-22

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a bZIP transcription factor mediating sensitivity change of Magnaporthe oryzae to mitochondrial respiratory inhibitors and high expression in mitochondrial dysfunction, and enhancing mtDNA replication in mitochondria PoATFS1 . PoATFS1 The overexpression transformant is sensitive to various respiratory inhibitors, and the knockout transformant is sensitive to various respiratory inhibitors. Meanwhile, PoATFS1 The mtDNA content in the overexpression transformant increases, and the mtDNA content in the knockout transformant decreases, which indicates that PoATFS1 The gene is involved in regulating mitochondrial homeostasis. The application provides a synergistic agent screening candidate target for restoring the sensitivity of resistant plant pathogens to respiratory inhibitors, and is favorable for the management of drug resistance of plant pathogens and the improvement of the activity of the existing respiratory inhibitors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, and more specifically, it relates to a transcription factor that regulates the sensitivity of plant pathogenic fungi to mitochondrial respiration inhibitors and mitochondrial homeostasis and its application. Background Technology

[0002] Rice blast is caused by prickly porphyria (Synthia spp.) Pyricularia oryzae Rice blast is the most serious global rice disease affecting safe rice production. Chemical agents are the main measure for its control, among which respiratory inhibitors are important fungicides. Currently, mitochondrial respiratory inhibitors that can be used to control rice blast fungus mainly include SDHI agents that act on complex II, such as fluopyram; SDHI agents that act on complex III, such as azoxystrobin; and uncoupling inhibitors such as fluazinam. However, inhibitors targeting mitochondrial complex I are particularly scarce, with only fluazinam available. In recent years, Shenyang Zhonghua Pesticide & Chemical R&D Co., Ltd. has developed a novel pyrimidine amine fungicide, SYP-34773. Previous studies by the research group have shown that it acts on mitochondrial complex I and has excellent control efficacy against rice blast and other diseases.

[0003] However, repeated application of chemical pesticides can easily lead to resistance in rice blast fungus, resulting in decreased pesticide efficacy, significant economic losses, and further environmental damage due to excessive pesticide use. Since the 1990s, resistant strains of rice blast fungus have been discovered in major rice-growing areas of my country, necessitating urgent attention. Therefore, clarifying the resistance mechanism of rice blast fungus to mitochondrial respiratory inhibitors and providing effective gene regulation strategies can offer important references for improving pesticide sensitivity and implementing resistance management. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a transcription factor that regulates drug resistance in plant pathogenic fungi, its encoding gene, and its application. This transcription factor is a bZIP transcription factor that mediates changes in the sensitivity of *Blastoma oryzae* to mitochondrial respiratory inhibitors and is highly expressed in cases of mitochondrial dysfunction, enhancing the replication of mtDNA in mitochondria. It can affect the copy number of *Blastoma oryzae* mtDNA and lead to changes in the fungicide's sensitivity to respiratory inhibitors. This invention provides a target protein for the development of synergists for the management of respiratory inhibitor resistance and the enhancement of the activity of existing fungicides, representing a novel resistance management strategy.

[0005] The above-mentioned technical objective of this invention is achieved through the following technical solution: a transcription factor that affects the copy number of mtDNA of rice blast fungus and causes changes in the sensitivity of rice blast fungus to respiratory inhibitors, wherein the transcription factor is... PoATFS1 Transcription factors.

[0006] The transcription factor is a protein as shown in SEQ ID No. 2;

[0007] The gene encoding the transcription factor is a DNA molecule as shown in SEQ ID NO.1 in the sequence listing.

[0008] This invention also provides biological materials containing nucleic acid molecules encoding the shown gene, which are any one of C1) to C8) below:

[0009] C1) An expression cassette containing the encoded gene;

[0010] C2) A recombinant vector containing the coding gene, or a recombinant vector containing the expression cassette described in C1);

[0011] C3) A recombinant microorganism containing the coding gene, or a recombinant microorganism containing the expression cassette of C1), or a recombinant microorganism containing the recombinant vector of C2);

[0012] C4) A transgenic plant cell line containing the coding gene, or a transgenic plant cell line containing the expression cassette described in C1);

[0013] C5) Transgenic plant tissue containing the coding gene, or transgenic plant tissue containing the expression cassette described in C2);

[0014] C6) A transgenic plant organ containing the coding gene, or a transgenic plant organ containing the expression cassette described in C2);

[0015] C7) Nucleic acid molecules that inhibit the expression of the encoded gene;

[0016] C8) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in C7).

[0017] The application of the aforementioned transcription factors or their encoding genes, or the aforementioned biological materials, in regulating (enhancing or reducing) the drug resistance of plant pathogenic fungi also falls within the scope of protection of this invention.

[0018] The application of the transcription factors or their encoding genes or the aforementioned biological materials in regulating (enhancing or reducing) mitochondrial homeostasis in plant pathogenic fungi is also within the scope of protection of this invention.

[0019] The plant pathogen mentioned is rice blast fungus ( ). Pyricularia oryzae The transcription factor or its encoding gene can affect the copy number of mtDNA of *Blastoma oryzae* and lead to changes in the susceptibility of *Blastoma oryzae* to respiratory inhibitors. The resistance is resistance to mitochondrial respiratory chain inhibitors; these inhibitors are selected from one or more combinations of SYP-34773, fluopyram, fluopyram, azoxystrobin, and fluazinam.

[0020] In summary, the present invention has the following beneficial effects: In this invention, the transcription factor can affect the copy number of mtDNA of rice blast fungus and cause changes in the fungus's sensitivity to respiratory inhibitors. Knocking out a single target gene in the pathogen can only weakly reduce the pathogen's resistance to a certain fungicide, while targeting a key transcription factor can affect mitochondrial homeostasis, thereby reducing the pathogen's resistance to the fungicide. Attached Figure Description

[0021] Figure 1 It is a bZIP transcription factor ATFS1 Homology analysis.

[0022] Figure 2 It is a bZIP transcription factor ATFS1 Expression level analysis: The different treatments were the untreated wild-type parental strain S118 of rice blast fungus, the parental strain S118 treated with SYP-34773 (SYP-S118), the untreated rice blast fungus resistant to SYP-34773 strains R118-4-1, R118-10-1, and R118-4-3-3, and the SYP-34773 resistant strains R118-4-1 (SYP-R118-4-1), R118-10-1 (SYP-R118-10-1), and R118-4-3-3 (SYP-R118-4-3-3).

[0023] Figure 3 yes PoATFS1 PCR validation gel image of the overexpression vector.

[0024] Figure 4 yes PoATFS1 Gene knockout strategy diagram; using the principle of homologous recombination, HPT is used to replace the target gene to be knocked out.

[0025] Figure 5 Yes PoATFS1 PCR validation gel image of the upstream fragment pKOV21-up and the downstream fragment pKOV21-down in the knockout vector.

[0026] Figure 6 yes PoATFS1 PCR validation gel images of knockout transformants △PoATFS1-12, △PoATFS1-16, △PoATFS1-19 and △PoATFS1-26.

[0027] Figure 7 yes PoATFS1Western blotting validation gel images of overexpression transformants PoATFS1-22, PoATFS1-17, PoATFS1-18, PoATFS1-76, PoATFS1-37, PoATFS1-65 and PoATFS1-79. Detailed Implementation

[0028] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] The rice blast fungus P131, published in Shi W, Yang J, Chen D, et al. 2022. The rice blastfungus SR protein 1 regulates alternative splicing with unique mechanisms. PLOS Pathogens 18(12): e1011036, is a standard strain donated by Professor Peng Youliang's laboratory at China Agricultural University. It is stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection at China Agricultural University and is available to the public from China Agricultural University.

[0030] Rice blast fungus S118, published in Zhang C, Meng D, Wang W, et al. 2020. Overexpression of three P450 genes is responsible for resistance to novelpyrimidine amines in Magnaporthe oryzae Pest Manag Science 76(12):4268-4277, stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University, is a strain collected and isolated from the field by the laboratory and is available to the public from China Agricultural University.

[0031] Rice blast fungus resistant strains R118-4-1, R118-4-3, and R118-10-1 were found to be low-level resistant strains R118-4 and R118-10, obtained by domestication of the wild-type susceptible strain S118 using SYP-34773 (published in Zhang C, Meng D, Wang W, et al. 2020). Overexpression of three P450 genes is responsible for resistance to novel pyrimidine amines in Magnaporthe oryzae Based on the study published in Pest ManagScience 76(12):4268-4277), a medium-to-high level resistant strain was obtained through domestication with SYP-34773. This strain is stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University, and is available to the public from China Agricultural University.

[0032] The pGTN vector was published in Shi W, Yang J, Chen D, et al. 2022. The rice blastfungus SR protein 1 regulates alternative splicing with unique mechanisms. PLOS Pathogens 18(12): e1011036. The overexpression and subcellular localization vector was donated by Professor Peng Youliang's research group at the College of Plant Protection, China Agricultural University, and is stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. It is available to the public from China Agricultural University.

[0033] The pKOV21 vector was published in Shi W, Yang J, Chen D, et al. 2022. The rice blastfungus SR protein 1 regulates alternative splicing with unique mechanisms. PLOS Pathogens 18(12): e1011036. It was donated by Professor Peng Youliang's research group of the College of Plant Protection, China Agricultural University, and is stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. It is available to the public from China Agricultural University.

[0034] SYP-34773 published in Zhang C, Meng D, Wang W, et al. 2020. Overexpression of three P450 genes is responsible for resistance to novel pyrimidine aminesin Magnaporthe oryzae Pest Manag Science 76(12):4268-4277, from Shenyang Zhonghua Pesticide Chemical R&D Co., Ltd., with an effective ingredient content of 96.8%, and the chemical structure is shown in Formula I.

[0035]

[0036] Azoxystrobin, sourced from Syngenta China Ltd., has an active ingredient content of 98%.

[0037] Fluopyram, sourced from BASF (China) Co., Ltd., has an active ingredient content of 98%.

[0038] Flupyrimethanil, sourced from Shenyang Zhonghua Pesticide & Chemical Research Co., Ltd., has an active ingredient content of 90%.

[0039] Fluazinam, sourced from Shandong Zhongnong United Biotechnology Co., Ltd., has an active ingredient content of 95.8%.

[0040] Example 1: Obtaining resistant strains

[0041] Using the susceptible strain S118, isolated from the field in the laboratory, as the parent, it was inoculated into PDA medium and cultured at 25 ℃ for 7 days. Subsequently, it was screened by inoculating onto plates containing 10 μg / mL and 50 μg / mL SYP-34773, respectively. After 7 days, the plates were observed. Colonies obtained from the plates were transferred to untreated PDA plates for propagation to determine the drug sensitivity of suspected mutants and were then preserved. Low-level resistant mutants R118-4 and R118-10 were obtained, with resistance folds of 15.00 and 7.00, respectively (Table 1). Using the above low-resistance strains as materials, they were further inoculated twice into PDA medium containing 100 μg / mL SYP-34773 for acclimatization, and then transferred to untreated PDA plates for propagation to determine the drug sensitivity of suspected mutants and were then preserved. The medium-to-high level resistant strains R118-4-1, R118-4-3-3, and R118-10-1 used in this study were obtained through drug acclimation, with resistance multiples ranging from 26.17 to 68.75 (Table 1). Simultaneously, the susceptibility of the resistant strains to the mitochondrial respiration inhibitor fluopyram was assessed using PDA medium containing fluopyram at concentrations of 0, 2.5, 10, 20, 50, and 100. The resistance multiples of the medium-to-high level resistant strains R118-4-1, R118-4-3-3, and R118-10-1 to fluopyram ranged from 21.58 to 33.81 (Table 2).

[0042] Table 1. Sensitivity of S118 series strains to SYP-34773

[0043]

[0044]

[0045] Example 2: Transcriptomics data analysis reveals transcription factors PoATFS1

[0046] By analyzing transcriptome data, the bZIP transcription factor gene was discovered. MGG-02865 The expression of MGG-02865 was significantly upregulated after treatment with the parental strain S118, and further upregulated after treatment with the mutant R118-10-1. Based on previous literature reports of the bZIP transcription factor ATFS1 being associated with increased mtDNA levels, analysis of its domain revealed that among proteins containing similar domains in *Bacillus oryzae*, MGG-02865 showed the highest homology with ATFS1 (21.72%). Further phylogenetic analysis of related bZIP transcription factors in mammals, plants, and fungi showed that MGG-02865 in *Bacillus oryzae* was more closely related to ATFS1 in *Nematodea elegans*. Therefore, MGG-02865 was named... PoATFS1 For subsequent research ( Figure 1 ).

[0047] Example 3: PoATFS1 Differential expression analysis of genes

[0048] The above transcription factors were analyzed using qPCR. PoATFS1 The results of the expression differences were measured.

[0049] The transcription factor PoATFS1 The qPCR primer pair is:

[0050] PoATFS1 Forward primer: 5'-AACTACCAGGCTGATACCAA-3' (SEQ ID No. 3);

[0051] PoATFS1 Reverse primer: 5'-ATGTCCATCATAACTTCCCCA-3' (SEQ ID No. 4).

[0052] like Figure 2 As shown, transcription factors PoATFS1 After drug administration, the expression level of S118 in antibody mutants R118-10-1, R118-4-1, and R118-4-3-3 was upregulated by 2.0 to 115.4 times compared to the parental strain S118; in the absence of drug administration, the expression level of S118 in antibody mutants R118-4-1 and R118-4-3-3 was upregulated by 2.1 to 12.9 times compared to the parental strain S118.

[0053] Example 4: Transcription factors of the present invention PoATFS1 Functions and applications

[0054] 1. Construction PoATFS1 Overexpression vectors and knockout vectors

[0055] (1) Construction PoATFS1 Overexpression vectors:

[0056] Using cDNA from the wild-type parent strain S118 and the standard strain P131 of *Oryza blast fungus* as templates, respectively, PoATFS1 Forward primer and PoATFS1 Reverse primers are used for amplification. PoATFS1 The fragment reveals the two PoATFS1 The sequences are completely identical, as shown in Sequence 1 of the sequence listing, encoding the amino acid sequence of Sequence 2 in the sequence listing; simultaneously, the overexpression vector pGTN is digested with Bam I enzyme, and... PoATFS1 The fragment and the pGTN vector fragment were ligated using homologous recombination, transformed into *E. coli*, and positive clones were screened on ampicillin-resistant plates and verified by PCR. Figure 3As can be seen, amplification of the recombinant plasmid using universal primers on the vector yielded a band of similar size to the target gene, indicating that the constructed overexpression vector has successfully expressed the target gene. Genes are integrated into it.

[0057] The transcription factor PoATFS1 The primer pair for overexpression vector amplification is:

[0058] PoATFS1 Forward primer:

[0059] 5'-GCACCAAACCGCCAAAGGATCCATGGAGTCAAACAGC-3' (SEQ ID No. 5)

[0060] PoATFS1 Reverse primer:

[0061] 5'-CTGCAGGAATTCGATCACTCGACCAGGCGCAGC-3' (SEQ ID No. 6)

[0062] The universal primer pair on the pGTN vector is:

[0063] pGTN forward primer:

[0064] 5'- ACGAACCCTTCTCTTCCCTTTCTC -3' (SEQ ID No.7)

[0065] pGTN reverse primer:

[0066] 5'-A ATCTTATCGAGATCCTGAACACCAT-3' (SEQ ID No.8)

[0067] (2) Construction PoATFS1 Knockout vector:

[0068] Using the DNA of the wild-type parent strain S118 of *Oryza sativa* and the standard strain P131 of *Oryza sativa* as templates, respectively, as follows: PoATFS1 As shown, approximately 1500 bp was amplified using specific primers. Figure 4 The upstream and downstream fragments of the gene were found to be completely identical in sequence, allowing for the recovery and purification of the PCR product. The downstream fragment was then ligated using a seamless cloning method. PoATFS1 The pKOV21 vector was digested with enzyme III, the ligation product was transformed into E. coli, and positive clones were screened on ampicillin-resistant plates. The upstream fragment was then ligated using a seamless cloning method. HindEnzyme I digestion was successfully performed and ligated into the downstream recombinant vector. PCR verification showed that the band size was consistent with the expected result, indicating successful ligation. Ecor Gene knockout vectors, such as PoATFS1 As shown.

[0069] The transcription factor Figure 5 The primer pair for knockout vector amplification is:

[0070] PoATFS1 Upstream forward primer:

[0071] 5'-ACCAAACCGCCAAAGGATCCATGGCAGACAAGACCGAGAGGC-3' (SEQ ID No.9)

[0072] PoATFS1 Upstream reverse primer:

[0073] 5'-TAGAACTAGTGGATCCTTACATCTCCACAGCCCTGGC-3' (SEQ ID No. 10)

[0074] PoATFS1 Downstream forward primer:

[0075] 5'-GGGAACCAGTTATCAAGCTTGTGCTTCCGTTTTCGCCACC-3' (SEQ ID No. 11)

[0076] PoATFS1 Downstream forward and reverse primers:

[0077] 5'-CGACGGTATCGATAAGCTTCGTGCATGTACTTGGTAGGTTG-3' (SEQ ID No. 12)

[0078] PoATFS1 Forward primers for downstream pKOV21 knockout vector colony PCR verification:

[0079] 5'-GCACCAAACCGCCAAAGGATCCATGGAGTCAAACAGCAACCG-3' (SEQ ID No. 13)

[0080] PoATFS1 Reverse primers for downstream pKOV21 knockout vector colony PCR verification:

[0081] 5'-CTGCAGGAATTCGATCACTCGACCAGGCGCAGC-3' (SEQ ID No. 14)

[0082] PoATFS1 Forward primers for upstream pKOV21 knockout vector colony PCR verification:

[0083] 5'-GCAGGCAGAACGCGAAGCT-3' (SEQ ID No.15)

[0084] PoATFS1 Reverse primers for upstream pKOV21 knockout vector colony PCR verification:

[0085] 5'-CGACGTAAACGGCCACAAGT-3' (SEQ ID No.16)

[0086] 2. PoATFS1 Obtaining knockout and overexpression transformant strains

[0087] (1) Obtaining knockout transformants:

[0088] The knockout vector was transformed into *Bacillus oryzae* strain S118 using PEG-mediated protoplast transformation. Transformants were then selected for PCR verification. PoATFS1 As shown.

[0089] The transcription factor Figure 6 The validation primer pair for knocking out the upstream and downstream homologous arms of the transformant is:

[0090] PoATFS1 Forward primer: 5'-CTACACACTACACAGTACATGCG-3' (SEQ ID No. 17)

[0091] PoATFS1 Upstream reverse primer: 5'-GCAGGACATATCCACGCCCTCCTAC-3' (SEQ ID No. 18)

[0092] PoATFS1 Downstream forward primer: 5'-ATTTCGATGATGCAGCTTGGGCG-3' (SEQ ID No. 19)

[0093] PoATFS1 Downstream reverse primer: 5'-GTTGTCCGAAGTAGTATTTGTTATG-3' (SEQ ID No. 20)

[0094] PoATFS1 Knockout transformant PoATFS1 Forward primers for gene PCR verification:

[0095] 5'-ACGAACCCTTCTCTTCCCTTTCTC-3' (SEQ ID No. 21)

[0096] PoATFS1 Knockout transformant PoATFS1 Reverse primers for gene PCR verification:

[0097] 5'-ATCTTATCGAGATCCTGAACACCAT-3' (SEQ ID No. 22)

[0098] (2) Obtaining overexpression transformants:

[0099] To verify the presence of wild-type parental strain S118 PoATFS1 Based on the gene overexpression results, the overexpression vector was further transformed into the standard strain P131 of *Blastoma oryzae* using PEG-mediated protoplast transformation for subsequent pesticide susceptibility assays. The selected transformants were verified by Western blotting, yielding GFP-labeled positive overexpression transformants and GFP-labeled empty vector transformants, as shown below. PoATFS1 As shown.

[0100] 3. Figure 7 Sensitivity of gene overexpression and knockout transformants to SYP-34773.

[0101] The parental strain and two strains were determined using the in vitro mycelial growth rate method. PoATFS1 Overexpression strains and 2 strains PoATFS1 To assess the sensitivity of the knockout strain to SYP-34773, 5 mm mycelial discs were collected from the edge of 7-day-old colonies and inoculated onto PDA medium containing different concentrations of the drug (0, 0.0001, 0.0025, 0.01, 0.1, 1, 5, 10, 100 μg / mL). Each treatment was repeated three times. After culturing at 25°C in the dark for 7 days, the diameter was measured, and the inhibition rate and EC were calculated. 50 (Drug concentration at an inhibition rate of 50%).

[0102] P131 parental genes obtained PoATFS1 Gene overexpression transformants PoATFS1-22 and PoATFS1-37 compared to parental EC 50 The value increased by 2.02 to 2.63 times, EC 90 The value increased by 5.55 to 8.81 times, indicating PoATFS1 Gene overexpression leads to a decrease in the sensitivity of rice blast fungus P131 to SYP-34773.

[0103] S118 parent stock obtained PoATFS1Gene knockout transformants △PoATFS1-16 and △PoATFS1-26 compared to parental EC 50 The value decreased significantly by 0.05 to 0.16 times, indicating that... PoATFS1 Gene knockout led to increased susceptibility of rice blast fungus S118 to SYP-34773 (Table 3).

[0104]

[0105] 4. PoATFS1 Sensitivity of gene overexpression and knockout transformants to mitochondrial respiratory chain inhibitors

[0106] The mycelial growth rate method was used to determine PoATFS1 The sensitivity of gene overexpression transformants PoATFS1-22 and PoATFS1-37 to mitochondrial respiratory chain inhibitors (fluopyram, fluopyram, azoxystrobin and fluazinam). PoATFS1 Gene overexpression transformants PoATFS1-22 and PoATFS1-37 compared to parental EC 50 The value increased by 1.41 to 35.04 times, indicating PoATFS1 Gene overexpression leads to decreased sensitivity of rice blast fungus P131 to mitochondrial respiratory chain inhibitors.

[0107] PoATFS1 Gene knockout transformants △PoATFS1-16 and △PoATFS1-26 compared to parental EC 50 The value decreased significantly by 0.005 to 0.64 times, indicating that... PoATFS1 Gene knockout led to increased sensitivity of rice blast fungus S118 to mitochondrial respiratory chain inhibitors. This result indicates that transcription factors... PoATFS1 It is related to the susceptibility of rice blast fungus to mitochondrial respiratory chain inhibitors (Table 4).

[0108] Table 4 PoATFS1 Sensitivity of gene transformants to mitochondrial respiratory chain inhibitors

[0109]

[0110] 5. PoATFS1 Relative content of mitochondrial DNA in gene transformants

[0111] The expression levels of four mitochondrial genes encoding the core subunit of mitochondrial complex I were detected by qPCR in overexpression transformants, control strains, and parental strains.

[0112] Transformants and parental strains were inoculated onto PDA plates lined with cellophane. After the hyphae had fully colonized the cellophane, they were scraped into 2 mL centrifuge tubes, and DNA was extracted using the CTAB method. Melting curves were constructed using the DNA as a template, and the DNA from all samples was quantified to a uniform concentration. Mitochondrial genes were selected. PoATFS1 , Nad2 , Nad3 and Nad4 Nuclear genes: Nad4L Using DNA as a template, the CT values ​​of the above 5 genes in the transformant and parent strain were determined. The copy number of mitochondrial DNA (mtDNA) was calculated using formulas 1 and 2. The relative content of mtDNA in the transformant was determined using formula 3. The experiment was repeated 3 times.

[0113]

[0114] The gene MGG-12387 , Nad2 , Nad3 , Nad4 and Nad4L The primer pair for expression level detection is:

[0115] MGG-12387 Upstream primer: 5'-TCCGTAACCTTTAGGCGAGA-3' (SEQ ID No. 23)

[0116] Nad2 Downstream primer: 5'-AGCTAAACTTTTCTAGGGTGAAA-3' (SEQ ID No. 24)

[0117] Nad2 Upstream primer: 5'-ATTTTCGAGTGTGGTTTCCA-3' (SEQ ID No. 25)

[0118] Nad3 Downstream primer: 5'-AAGAGCGCTTTTACCTAATTCAA-3' (SEQ ID No. 26)

[0119] Nad3 Upstream primer: 5'- GTTCTGTATCACACGCTGCTG-3' (SEQ ID No. 27)

[0120] Nad4 Downstream primer: 5'-AGGTGCACCACAATTCCCTA-3' (SEQ ID No. 28)

[0121] Nad4Upstream primer: 5'-AAAGCAACTAGAATACCCAAACC-3' (SEQ ID No. 29)

[0122] Nad4L Downstream primer: 5'-GGAGTCTTAGGATTTGTGTTAAATAGA-3' (SEQ ID No. 30)

[0123] Nad4L Upstream primer: 5'- CTTAAACCAGCCTCAACCAA-3' (SEQ ID No. 31)

[0124] MGG-12387 Downstream primer: 5'-TTTGACCAGAAAAAGCATGTAT-3' (SEQ ID No. 32)

[0125] Measurement MGG-12387 The mtDNA copy numbers in the gene transformants, control strains, and parental strains are shown in Tables 5 and 6. PoATFS1 The mtDNA copy number of the gene-overexpressing transformants was higher than that of the parental strain P131 and the empty vector transformant P131 / pGTN. PoATFS1 The relative mtDNA content of gene overexpression transformants was 1.41-3.05 times higher than that of the parental strain P131. The mtDNA copy number of knockout transformants was lower than that of the parental strain S118, and the relative mtDNA content was 0.40-0.83 times lower than that of the parental strain P131.

[0126] Table 5. PoATFS1 mtDNA copy number in gene overexpression transformants

[0127]

[0128] Table 6. PoATFS1 PoATFS1 Relative content of mtDNA in gene transformants

[0129]

[0130] The specific embodiments are merely illustrative of the present invention and are not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of the present invention.

Claims

1. A transcription factor; characterized in that, The transcription factor is a protein as shown in SEQ ID No.

2.

2. The gene encoding the transcription factor of claim 1.

3. The encoding gene according to claim 2, characterized in that, The encoding gene is the DNA molecule shown in SEQ ID NO.1 of the sequence listing.

4. Biological material containing the nucleic acid molecule encoding the gene as described in claim 3, wherein the following is C1) or C2): C1) An expression cassette containing the gene encoding as described in claim 3; C2) A recombinant vector containing the encoding gene of claim 3, or a recombinant vector containing the expression cassette of C1).

5. The application of knocking out the gene encoding the pathogenic fungus described in claim 3, wherein the application is any one of 1) and 2) below: 1) Application in reducing the resistance of rice blast fungus to pesticides; the resistance refers to resistance to mitochondrial respiratory chain inhibitors; 2) Application in regulating mitochondrial homeostasis of rice blast fungus; The application of the transcription factor in regulating mitochondrial homeostasis in plant pathogenic fungi is to enhance the sensitivity of the transcription factor to mitochondrial respiratory chain inhibitors in rice blast fungus and affect the mtDNA content; the mitochondrial respiratory chain inhibitor is selected from one or more of SYP-34773, fluopyram, fluopyram, azoxystrobin and fluazinam.

6. A method for reducing the resistance of plant pathogenic fungi, comprising the following steps: This method inactivates the encoding gene of the transcription factor described in claim 3 in plant pathogens, thereby increasing the sensitivity of the plant pathogens to mitochondrial respiratory chain inhibitors; the mitochondrial respiratory chain inhibitor is selected from one or more combinations of SYP-34773, fluopyram, fluopyram, azoxystrobin, and fluazinam; the plant pathogen is *Pseudomonas oryzae* (the causal agent of rice blast). Pyricularia oryzae ).

Citation Information

Patent Citations

  • Application of pathogenic factor of magnaporthe oryzae or gene for coding pathogenic factor

    CN113698461A

  • Transcription factor for regulating and controlling drug resistance of plant pathogenic fungi and application of transcription factor

    CN119161432A