Glucose dehydrogenase mutant, recombinant engineering bacterium and preparation method thereof
By molecular modification of GDH from Mucor circinelloides and recombinant expression in Rhodococcus, the problems of GDH thermal stability and glycosylation heterogeneity were solved, and a GDH mutant S398M with improved thermal stability and substrate specificity was obtained, which is suitable for the preparation of in vitro diagnostic products.
Patent Information
- Application Number
- CN202510904233.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2025-09-19
AI Technical Summary
Glucose dehydrogenase (GDH) from Mucor has low thermal stability, low expression level, and excessive glycosylation in Pichia pastoris, which limits its application in in vitro diagnostics.
Through artificial intelligence-assisted design, the serine 398th position of GDH of Mucor circinelloides was mutated to methionine, and the recombinant engineered bacteria were constructed for expression in Rhodococcus rhodochrous bacteria. The signal peptide of Bacillus licheniformis was used to achieve efficient secretory expression, and the GDH mutant S398M with improved thermal stability and substrate specificity was obtained by nickel column affinity chromatography purification.
The thermal stability of GDH was improved, and the residual enzyme activity of the mutant S398M was 82% after incubation at 55°C for 30 minutes, which solved the problem of low thermal stability. Efficient secretory expression of GDH was achieved in recombinant Rhodococcus, avoiding excessive glycosylation, and is suitable for the preparation of in vitro diagnostic products.
Smart Images

Figure CN120665831A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a glucose dehydrogenase mutant, a recombinant engineering bacterium and a preparation method thereof. Background Art
[0002] Glucose dehydrogenase (GDH) is an oxidoreductase that catalyzes the conversion of glucose to gluconolactone. Common sources include microorganisms such as Aspergillus, Pseudomonas, and Bacillus. GDH can be divided into three categories based on the type of electron acceptor: (1) GDH with nicotinamide adenine dinucleotide as a cofactor (NAD(P)-GDH); (2) GDH with pyrroloquinoline quinone as a cofactor (PQQ-GDH); and (3) GDH with flavin adenine dinucleotide as a cofactor (FAD-GDH). Compared with the glucose oxidase (GOD) method, the GDH method does not use oxygen molecules as an electron acceptor, thus avoiding the interference of blood oxygen partial pressure and can be used to detect blood samples with different oxygen contents. Therefore, GDH is widely used in the preparation of glucose determination kits and glucose biosensors.
[0003] The above three GDHs can all be used for blood glucose testing, but the NAD-GDH coenzyme factor is not tightly bound to the enzyme, and the coenzyme needs to be continuously added during the reaction. PQQ-GDH has poor thermal stability and substrate specificity. The FAD-GDH coenzyme factor is tightly bound to the enzyme, with high catalytic efficiency and high substrate specificity.
[0004] FAD-GDH is widely used for blood glucose testing. Its main sources are Aspergillus, Penicillium, Mucor, Pseudomonas, and other genera. However, GDH derived from Mucor has better stability, stronger substrate specificity, and higher catalytic efficiency, thus showing potential for application in the field of blood glucose testing. However, GDH derived from Mucor generally suffers from poor thermal stability and low expression levels in wild strains, which seriously limits its industrial application. The GDH currently used in my country mainly relies on imported products, and the product quality is not very ideal and is expensive.
[0005] Currently, the preparation of GDH is mainly carried out by recombinant expression in Escherichia coli and Pichia pastoris. When expressed in Escherichia coli, inclusion bodies are often formed and co-expression with a molecular chaperone is required to obtain soluble protein. The expression level is low, and subsequent separation and purification are more difficult. Moreover, the recombinant GDH expressed in E. coli cannot be glycosylated and has lower thermal stability than the natural GDH expressed by Mucor. Pichia pastoris can efficiently secrete and express exogenous proteins, but the expressed exogenous proteins have the problem of excessive glycosylation. At the same time, due to differences in the degree of glycosylation, the molecular weight of the expressed GDH is uneven. The different degrees of GDH glycosylation will lead to differences in the catalytic properties of the enzyme molecule, which seriously limits the application of GDH in the field of in vitro diagnosis. Therefore, the development of new GDH exogenous protein expression systems is of great significance. Summary of the Invention
[0006] The present invention aims to provide a glucose dehydrogenase mutant, a recombinant engineered bacterium and a preparation method thereof, which solve the problem of low thermal stability of GDH derived from Mucor; the obtained glucose dehydrogenase mutant S398M has significantly improved specificity in catalyzing glucose.
[0007] The present invention adopts the following technical solution: a glucose dehydrogenase mutant, with an amino acid sequence such as SEQ ID NO.1 as a parent, and the 398th serine of the parent is mutated to methionine.
[0008] Furthermore, its amino acid sequence is shown in SEQ ID NO.2.
[0009] Furthermore, the nucleotide sequence of its parent is shown in SEQ ID NO.3.
[0010] The present invention also discloses a gene encoding the above-mentioned glucose dehydrogenase mutant, and the nucleic acid sequence thereof is shown in SEQ ID NO:4.
[0011] The invention also discloses a recombinant engineering bacterium containing the above gene.
[0012] The present invention also discloses a method for preparing the above-mentioned recombinant engineered bacteria, which comprises cloning the above-mentioned gene into the expression vector pDD103, transforming competent cells of Rhodococcus rhodochrous to obtain the recombinant engineered bacteria.
[0013] The present invention also discloses the use of the above-mentioned glucose dehydrogenase mutant or gene for preparing in vitro diagnostic products.
[0014] The beneficial effects of the present invention are as follows: 1. Through artificial intelligence-assisted rational design and molecular modification of glucose dehydrogenase (GDH) from Mucor circinelloides, a GDH mutant S398M with improved thermal stability and substrate specificity was screened and obtained. The residual enzyme activity of mutant S398M was 82% after incubation at 55°C for 30 minutes, resolving the problem of low thermal stability of Mucor-derived GDH; the recombinant GDH mutant S398M significantly improved its specificity for glucose catalysis. 2. A recombinant engineered bacterium, R. rhodochrous-pDD103-GDH, was constructed, achieving efficient secretory expression of GDH in recombinant Rhodococcus sp.; this solved the problems of excessive glycosylation and heterogeneous glycosylation modification in recombinant Pichia pastoris expression of glucose dehydrogenase. The GDH expressed in recombinant Rhodococcus sp. had a low degree of glycosylation modification, and the molecular weight of the glycosylated protein was uniform, laying the foundation for the use of glucose dehydrogenase in the preparation of in vitro diagnostic products. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The recombinant expression vector pDD103-GDH for glucose dehydrogenase (GDH) was constructed;
[0016] Among them: Signal peptide represents the protein secretion signal peptide, which is derived from the signal peptide of Bacillus licheniformis α-amylase; GDH represents the glucose dehydrogenase gene sequence; Kanamycin represents the kanamycin resistance gene; pAL5000 represents the Rhodococcus replicon; pMB1 represents the Escherichia coli replicon; Promoter represents the constitutive promoter in the pDD103 plasmid.
[0017] Figure 2 This is the nucleic acid electrophoresis diagram of the glucose dehydrogenase (GDH) recombinant expression vector pDD103-GDH;
[0018] Wherein: M: Marker; 1: GDH gene; 2: pDD103-GDH linearized plasmid.
[0019] Figure 3 The minimum free energy heat map of the flexible region of GDH protein predicted by FoldX and the virtual saturation mutation of amino acid residues;
[0020] Among them: A is the flexible region of GDH protein predicted by FoldX; B is the minimum free energy heat map after virtual saturation mutation of amino acid residues predicted by FoldX.
[0021] Figure 4 The activity of wild-type (WT) glucose dehydrogenase and mutant enzyme fermentation supernatant.
[0022] Figure 5is the residual activity of wild-type (WT) glucose dehydrogenase and mutant enzyme fermentation broth incubated at 55°C for 30 min.
[0023] Figure 6 This is the SDS-PAGE electrophoresis of the recombinantly expressed glucose dehydrogenase (GDH) mutant S398M and the purified wild-type (WT) GDH protein in Rhodococcus.
[0024] Figure 7 A graph comparing the thermal stability of the recombinant GDH mutant S398M and the wild-type enzyme.
[0025] Figure 8 This is the SDS-PAGE electrophoresis of the GDH mutant S398M expressed in recombinant Pichia pastoris. DETAILED DESCRIPTION
[0026] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0027] Rhodococcus is a Gram-positive actinomycete with multiple catabolic activities and strong adaptability, strong environmental tolerance and protein secretion expression ability, certain glycosylation modification ability for proteins, and stronger ability to utilize carbon sources. It has potential application value in pollutant degradation and environmental remediation, and efficient secretion and expression of heterologous proteins. The present invention uses artificial intelligence-assisted rational design to molecularly modify the glucose dehydrogenase GDH from Mucor circinelloides, screens and obtains GDH mutants with improved thermal stability and substrate specificity, and recombinantly expresses them in Rhodococcus rhodochrous, and purifies and obtains recombinant GDH.
[0028] The present invention discloses a glucose dehydrogenase mutant with improved thermal stability and substrate specificity, wherein the amino acid sequence of the parent is shown in SEQ ID NO. 1, and the serine at position 398 of the parent is mutated to methionine. The nucleotide sequence of the parent is shown in SEQ ID NO. 3.
[0029] The amino acid sequence of the glucose dehydrogenase mutant is shown in SEQ ID NO. 2. The nucleic acid sequence thereof is shown in SEQ ID NO. 4.
[0030] SEQ ID NO.1 is as follows:
[0031] QQDTNSSSVDTYDYVIVGGGVAGLALASRISENKDVTVAVLESGPNANDRFVVYAPGMYGQAVGTDLCPLIPTTPQENMGNRSLTIATGRLLGGGSAINGLVWTRGGLRDYDAWEELGNPGWNGANLFKYFKKVENFTPPTPAQIEYGATYQKSAHGKKGPIDVSFTNYEFSQSASWNASLETLDFTALPDILNGTLAGYSTTPNILDPETVQRVDSYAGYIAPYTNRNNLNVLANHTVSRIQFAPKNGSEPLKATGVEWYPTGNKDQKQTIKARYEVIISSGAIGSPKLLEISGIGNKDIVSAAGVESLIDLPGVGSNMQDHVHAITVSATNITGYTTNSVFVNETLAQEQREEYEANKTGIWATTPNNLGYPTPEQLFNGTEFVSGKEFADKIRNSTDEWANYYASTNASNVELLKKQYAIVASRYEENYLSPIEINFTPGYEGSANLDLQNNKYQTVNHVLIAPLSRGYTHINSSDVEDHSVINPQYYSHPMDIDVHIASTKLAREIITASPGLGDINSGEIEPGMNITSEDDLRSWLSNNVRSDWHPVGTCAMLPKELGGVVSPALMVYGTSNLRVVDASIMPLEVSSHLMQPTYGIAEKAADIIKNFYKTQYKNQN。
[0032] SEQ ID NO.2 is as follows:
[0033] QQDTNSSSVDTYDYVIVGGGVAGLALASRISENKDVTVAVLESGPNANDRFVVYAPGMYGQAVGTDLCPLIPTTPQENMGNRSLTIATGRLLGGGSAINGLVWTRGGLRDYDAWEELGNPGWNGANLFKYFKKVENFTPPTPAQIEYGATYQKSAHGKKGPIDVSFTNYEFSQSASWNASLETLDFTALPDILNGTLAGYSTTPNILDPETVQRVDSYAGYIAPYTNRNNLNVLANHTVSRIQFAPKNGSEPLKATGVEWYPTGNKDQKQTIKARYEVIISSGAIGSPKLLEISGIGNKDIVSAAGVESLIDLPGVGSNMQDHVHAITVSATNITGYTTNSVFVNETLAQEQREEYEANKTGIWATTPNNLGYPTPEQLFNGTEFVSGKEFADKIRNMTDEWANYYASTNASNVELLKKQYAIVASRYEENYLSPIEINFTPGYEGSANLDLQNNKYQTVNHVLIAPLSRGYTHINSSDVEDHSVINPQYYSHPMDIDVHIASTKLAREIITASPGLGDINSGEIEPGMNITSEDDLRSWLSNNVRSDWHPVGTCAMLPKELGGVVSPALMVYGTSNLRVVDASIMPLEVSSHLMQPTYGIAEKAADIIKNFYKTQYKNQN。
[0034] SEQ ID NO.3 is as follows:
[0035]
[0036] SEQ ID NO. 4 is as follows:
[0037]
[0038] The invention also discloses a recombinant plasmid and a recombinant engineering bacterium containing the above coding gene.
[0039] The above-mentioned recombinant engineered bacteria were constructed by the following method:
[0040] The gene shown in SEQ ID NO.4 was cloned into the pDD103 expression vector to obtain the recombinant plasmid pDD103-GDH, and the obtained recombinant plasmid was transformed into Rhodococcus rhodochrous competent cells to obtain recombinant R. rhodochrous-pDD103-GDH, that is, the recombinant engineered bacteria.
[0041] The method for preparing the above-mentioned glucose dehydrogenase mutant comprises the following steps:
[0042] Step 1: Inoculate the above-mentioned recombinant engineered bacteria R. rhodochrous-pDD103-GDH cell monoclone into liquid LB medium and culture it at 30°C overnight for 12-16 hours to obtain seed liquid; inoculate the overnight cultured seed liquid into liquid TB medium at a 1% inoculum size and culture it at 30°C for 36-48 hours to obtain culture liquid.
[0043] Step 2: Centrifuge the culture solution in step 1 to remove the bacteria to obtain crude glucose dehydrogenase enzyme solution, and perform nickel column affinity chromatography and molecular sieve filtration desalination on the crude enzyme solution collected by centrifugation to obtain pure recombinant glucose dehydrogenase enzyme.
[0044] The present invention also provides a use of a glucose dehydrogenase mutant or the above gene in the preparation of in vitro diagnostic products.
[0045] Example 1 Expression and activity determination of glucose dehydrogenase:
[0046] Rhodococcus rhodochrous was purchased from the China General Microorganism Culture Collection (CGMCC 4.1147). The Rhodococcus expression plasmid pDD103 was purchased from Addgene (Plasmid No. 119887). The vector DNA sequence can be downloaded from the Addgene website (https: / / www.addgene.org / ). Escherichia coli Top10, Pichia pastoris X33, and the Pichia pastoris expression vector pGAPZaA were all homemade.
[0047] The culture medium formula used in the present invention is as follows: LB culture medium formula: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L.
[0048] TB medium formula: peptone 12 g / L, yeast powder 24 g / L, KH2PO4 17 mM, K2HPO4 72 mM, glycerol 4 ml / L.
[0049] MB medium formula for the preparation of competent cells of Rhodococcus: 5 g / L yeast extract, 15 g / L tryptone, 5 g / L soy peptone, 5 g / L NaCl, 2.0% glycine and 1.8% sucrose, pH 7.2.
[0050] YPD medium formula for Pichia pastoris culture: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L.
[0051] The steps for expressing glucose dehydrogenase GDH are as follows:
[0052] 1. The amino acid sequence of glucose dehydrogenase (GDH) from Mucor circinelloides was obtained from the UniProt protein database (https: / / www.uniprot.org / ) (UniProt: S2J876). This protein consists of 641 amino acid residues, including a 20-amino acid signal peptide at the amino terminus and a mature peptide of 621 amino acid residues. The mature peptide amino acid sequence is annotated as SEQ ID NO. 1. Based on the codon usage bias of Bacillus subtilis, the GDH encoding gene was artificially synthesized to obtain the optimized nucleotide sequence shown in SEQ ID NO. 3.
[0053] In order to achieve secretory expression of glucose dehydrogenase in Rhodococcus, the present invention uses a natural signal peptide derived from the Gram-positive bacterium Bacillus licheniformis a-amylase. The signal peptide amino acid sequence is: MLGGLALTAALLTLLPALIPLLPHSAAGA, and the DNA sequence based on the codon preference of Bacillus subtilis is: ATGTTGGGAGGGCTCGCACTGACCGCTGCGCTGCTCACTCT GCTTCCGGCGCTGATCCCGCTGCTTCCGCACTCTGCAGCAGGGGCT. When synthesizing the glucose dehydrogenase gene, the above signal peptide gene is synthesized at the 5' end of the glucose dehydrogenase gene DNA. The synthesized glucose dehydrogenase GDH gene with a signal peptide is inserted into the expression vector pDD103 using seamless cloning technology to construct the Rhodococcus expression vector pDD103-GDH. The expression vector and the included DNA elements are as follows: Figure 1 Agarose gel electrophoresis of the synthesized glucose dehydrogenase gene and the recombinant expression plasmid pDD103-GDH is shown in FIG. Figure 2As shown, the synthesized glucose dehydrogenase gene is about 1900 bp, the constructed glucose dehydrogenase Rhodococcus expression plasmid pDD103-GDH is about 6000 bp, and the electrophoresis results of the glucose dehydrogenase gene and the linearized recombinant plasmid pDD103-GDH are consistent with the theoretical molecular weight.
[0054] The pDD103-GDH plasmid, verified to be correct by sequencing, was transformed into Escherichia coli Top10 competent cells using the heat shock method. The cells were plated onto LB solid medium supplemented with 50 μg / mL kanamycin and cultured at 37°C for 12-16 hours to screen for positive clones. A single colony was selected and inoculated into LB liquid medium supplemented with 50 μg / mL kanamycin. After shaking and incubation at 37°C for 12-16 hours, the recombinant plasmid pDD103-GDH was obtained using a plasmid extraction kit, and its concentration was determined by UV spectrophotometry. The recombinant plasmid pDD103-GDH was then used to transform Rhodococcus competent cells.
[0055] 2. The recombinant plasmid pDD103-GDH was electroporated into Rhodococcus competent cells to construct a recombinant Rhodococcus rhodochrous bacterium that can secrete and express GDH.
[0056] The recombinant plasmid pDD103-GDH was introduced into Rhodococcus rhodochrous competent cells by electroporation. The transformed cells were then evenly plated onto LB solid medium plates containing kanamycin (final concentration 34 μg / mL) and cultured in a 30°C incubator for 48 to 72 hours.
[0057] The process for preparing competent cells of Rhodococcus rhodochrous is as follows:
[0058] Activate the strain: Pick a single Rhodococcus rhodochrous colony from an LB solid medium plate and inoculate it into 20 mL of LB liquid medium. Incubate the culture at 30°C and 200 rpm for 36 hours to obtain the culture solution.
[0059] Expansion culture and induction: Take 3-4 mL of the above culture medium and centrifuge at 4000 rpm for 3 minutes to collect the cells. Wash the cells once with 1.0 mL of sterile water and centrifuge under the same conditions as above, then resuspend the cells in 1.0 mL of sterile water. Inoculate the entire suspension into 100 mL of MB medium. Shake and culture at 30°C and 200 rpm until the OD value of the culture medium reaches 0. 600 The value reaches the range of 0.8-1.0.
[0060] Bacteria collection: Transfer the culture medium to a sterilized 50 mL centrifuge tube, centrifuge at 4000 rpm for 5 minutes, discard the supernatant, and collect the bacteria.
[0061] Wash the cells: Add 15 mL of pre-cooled sterile distilled water to the pellet and gently resuspend. Centrifuge at 4000 rpm for 5 minutes and discard the supernatant.
[0062] Glycerol wash: Add 15 mL of pre-cooled 5% (v / v) sterile glycerol solution and gently resuspend and wash. Centrifuge at 4000 rpm for 5 minutes and discard the supernatant. Add 10 mL of pre-cooled 10% (v / v) sterile glycerol solution and gently resuspend and wash. Centrifuge at 4000 rpm for 5 minutes and discard the supernatant. Gently resuspend and wash with 10 mL of pre-cooled 10% sterile glycerol solution again and centrifuge at 4000 rpm for 5 minutes and discard the supernatant to obtain the cells.
[0063] Aliquot and Freeze: Finally, gently resuspend the bacterial pellet in 5 mL of pre-chilled 10% (v / v) sterile glycerol solution. Aliquot 100 μL of this Rhodococcus rhodochrous competent cell suspension into pre-chilled sterile microcentrifuge tubes. Immediately store the aliquots in a -80°C freezer until ready for use.
[0064] Steps for electroporation of Rhodococcus rhodochrous competent cells:
[0065] Mix the plasmid and competent cells: Take 100 μL of prepared Rhodococcus rhodochrous competent cells and add 1 μL (approximately 100 ng) of the plasmid DNA to be transformed. Mix gently and incubate on ice for 30 minutes to obtain the cell-plasmid mixture.
[0066] Electroporation: Transfer the entire cell-plasmid mixture from the ice-incubation to a pre-chilled 0.2 cm electroporation cuvette. Immediately perform electroporation using the following parameters: voltage 2.5 kV, pulse duration 5.0 ms.
[0067] Recovery culture: Immediately after electroporation, add 1 mL of LB medium to the cuvette and mix gently by pipetting. Transfer the mixture to a sterile centrifuge tube and incubate at 30°C with shaking for 2 hours to promote cell recovery and plasmid expression.
[0068] Transformant screening: After recovery, pipette 100 μL of the transformant solution and spread it evenly onto a LB plate containing 34 μg / mL kanamycin. Place the LB plate in a 30°C incubator and invert for 2-3 days until single colonies are clearly visible.
[0069] 3. Rhodococcus expresses recombinant glucose dehydrogenase GDH:
[0070] Primary seed culture: Pick a single colony from the LB solid plate and inoculate it into 20 mL of LB liquid medium. Incubate at 30°C, 200 rpm, and shake for 36 hours to obtain the primary seed solution.
[0071] To expand the fermentation: Transfer the primary seed solution to a 2% (v / v) inoculum into a shake flask containing 200 mL of TB medium. Continue shaking the culture at 30°C and 200 rpm for 24-36 hours. The recombinantly expressed GDH protein is secreted into the extracellular medium by means of the native signal peptide of the Bacillus licheniformis α-amylase carried by the recombinant plasmid. After fermentation, centrifuge the culture at 10,000 rpm for 10 minutes, carefully collect the supernatant, and dilute the supernatant to the desired concentration before measuring GDH activity.
[0072] 4. Glucose dehydrogenase activity determination method:
[0073] The principle for measuring glucose dehydrogenase (GDH) activity is based on an enzymatic reaction coupled with electron transfer and colorimetric detection. In the presence of glucose, GDH catalyzes the oxidation of β-D-glucose to glucono-δ-lactone, while simultaneously reducing the prosthetic group FAD to FADH2. The reduced FADH2 then transfers electrons to the artificial electron acceptor phenazine methylsulfate (PMS), causing its reduction. The reduced PMS further reduces 2,6-dichloroindophenol (DCIP), causing DCIP to transform from a blue oxidized state (maximum absorption peak at 600 nm) to a colorless reduced state. The GDH enzyme activity can be quantitatively calculated by monitoring the rate of decrease in absorbance at 600 nm in the reaction system in real time.
[0074] The reaction system consisted of 200 μl of a 90 mM phosphate buffer (pH 7.0), 200 mM glucose, 0.1 mM 2,6-dichloroindophenol (DCIP), and 1 mM phenazine methosulfate (PMS). The reaction was incubated in an ELISA plate at 37°C for 5 min. Then, 10 μl of a diluted GDH-containing fermentation broth supernatant was added to each well of the plate. The reaction was incubated in a microplate reader at 37°C for 10 min. The enzyme activity was calculated by monitoring the decrease in DCIP absorbance at 600 nm. One unit of enzyme activity (U) was defined as the amount of enzyme required to reduce DCIP by 1 μmol per minute at 37°C and pH 7.0.
[0075] The calculation formula of glucose dehydrogenase activity is as follows:
[0076]
[0077] in:
[0078] ΔA600 is the absorbance change of the reaction solution;
[0079] ΔA600 blank is the absorbance change value of the blank control sample without adding enzyme solution;
[0080] 0.2 is the total volume of the reaction solution, in mL; df is the dilution factor;
[0081] 16.3 is the molar extinction coefficient of DCIP, in mM-1·cm -1 ;
[0082] 0.625 is the optical path length of 200 μl reaction solution in a 96-well plate, in cm;
[0083] 0.01 is the volume of enzyme solution added to the reaction solution, in mL.
[0084] The supernatant of the recombinant GDH secreted and expressed by the recombinant Rhodococcus was diluted 50 times, and then 10 μl was added to the reaction solution to determine the enzyme activity. The results showed that the activity of the wild glucose dehydrogenase expressed in the fermentation supernatant of the recombinant Rhodococcus was 11.6 U / ml.
[0085] Example 2 Construction of Glucose Dehydrogenase Mutant Library:
[0086] First, the monomer_ptm model of AlphaFold2 was used to predict the three-dimensional structure of the mature peptide sequence (621 amino acid residues) of glucose dehydrogenase from Mucor circinelloides (UniProt: S2J876). According to the predicted Local Distance Difference Test (pLDDT) confidence score analysis, the overall confidence of the predicted structure exceeded 90 points, indicating that the predicted structure has high reliability. Therefore, subsequent analyses were carried out based on this predicted structure.
[0087] Molecular dynamics (MD) simulations were performed using Gromacs 2019.6, under constant temperature, constant pressure, and periodic boundary conditions. The Amber99SB protein force field and the TIP3P water model were used, and the LINCS algorithm constrained all bonds with an integration step of 2 fs. Electrostatic interactions were calculated using the PME (Particle-mesh Ewald) method, and the cutoff for non-bonded interactions was updated every 10 steps. Temperature control was performed using the Berendsen coupling method (controlled to 300 K, respectively), and pressure control was performed using the Parrinello-Rahman method (1 bar). The simulation process included: (1) steepest descent energy minimization to eliminate close contacts between atoms; (2) heating the system to the target temperature within 100 ps; and (3) performing a 100 ns MD simulation (saving conformations every 20 ps). Visualization analysis was performed using the Gromacs embedded program and PyMOL.
[0088] The results showed that the RMSF analysis showed that the flexible regions and sites of the protein mainly included 78, 80, 81, 142, 143, 146-148, 153, 246-252, 264, 267, 300, 301, 304, 306, 335, 344, 346, 347, 381-486, 398, 446-454, and 529-532. Figure 3 As shown in A. Then, the protein engineering computational tool FoldX was used to perform virtual saturation mutations on the flexible sites, calculate the change in unfolding free energy (ΔΔG) after mutation, and generate a minimum free energy heat map, as shown in Figure 3 As shown in Figure B, the overall structural stability of a protein (ΔG) can be assessed by free energy, with lower values indicating greater thermal stability. The predicted mutation sites are as follows: N78W, G80N, K153P, N265R, V386T, S398L, S398M, S447Y, and M529P, a total of nine sites.
[0089] To construct nine glucose dehydrogenase mutants, specific primers were designed (sequences shown in Table 1) and site-directed PCR amplification was performed using the wild-type recombinant plasmid pDD103-GDH as a template. The amplification program was set as follows:
[0090] Pre-denaturation: 98°C × 2 min;
[0091] Cycling parameters (30 cycles): denaturation: 98°C × 15s; annealing: 55°C × 30s; extension: 72°C × 2min; final extension: 72°C × 5min;
[0092] The PCR product was digested with Dpn I (37°C for 4 hours) to remove the template plasmid. The digested product was then transformed into competent E. coli Top10 cells. The transformed bacterial solution was spread onto LB solid medium and incubated at 37°C for 12-16 hours to obtain single colonies. Single colonies were randomly selected for sequencing to verify the mutation site. After confirming the successful construction of nine mutant plasmids, high-purity recombinant plasmids were extracted for future use.
[0093] Table 1 Primers used for site-directed mutagenesis
[0094]
[0095]
[0096] Example 3 Expression and Screening of Glucose Dehydrogenase Mutants in Rhodococcus
[0097] Electroporation and expression of mutant plasmids: The nine constructed glucose dehydrogenase mutant plasmids were introduced into Rhodococcus competent cells by electroporation. Transformed cells were plated on LB plates containing 34 μg / mL kanamycin and incubated at 30°C for 48-72 hours to obtain single colonies.
[0098] Recombinant enzyme expression: A single colony was inoculated into 20 mL of LB medium and cultured with shaking at 30°C and 200 rpm for 36 hours to prepare a primary seed solution. This seed solution was then transferred to 200 mL of TB medium at a 2% (v / v) inoculum and cultured under the same conditions for 24-36 hours. The fermentation broth was centrifuged at 10,000 rpm for 10 minutes, and the supernatant was collected as the crude enzyme solution.
[0099] Activity assay: Figure 4 As shown, all nine mutants achieved secretory expression, among which the expression activities of the N265R and S398L mutants in Rhodococcus were 17.2 U / ml and 15.4 U / ml, respectively, which were significantly higher than the expression level of the wild-type enzyme (WT) (11.6 U / ml). The expression activities of the remaining mutant enzymes had no significant difference from those of the wild-type enzyme.
[0100] Thermal stability evaluation: The crude enzyme solutions of wild-type and mutant enzymes were heat-treated at 55°C for 30 min, and the residual enzyme activity was calculated with the enzyme activity before heat treatment as 100%. Figure 5 The results showed that mutants S398L, S398M, and M529P showed significantly improved stability, with residual enzyme activity of 49%, 82%, and 43% after heat treatment, respectively. This was a significant improvement over the 21% residual enzyme activity of the wild-type enzyme after heat treatment. The remaining six mutants showed no significant difference in thermal stability or slightly decreased thermal stability compared to the wild-type enzyme.
[0101] Assessment of Mutant Enzyme Substrate Specificity: When glucose dehydrogenase is used for blood glucose testing, it may react with other sugars in the blood, potentially leading to inaccurate measurements. Common interfering substances include maltose, xylose, galactose, and mannose. The activities of wild-type GDH and the different mutants were measured using 50 mM glucose as a substrate. The enzyme activity at 50 mM glucose was set as 100%. The activities of wild-type GDH and the different mutants were then measured using 50 mM maltose, xylose, galactose, and mannose as substrates, respectively, to calculate their specificity for the glucose substrate. The results are shown in Table 2. Wild-type GDH and the mutants all showed weak activity on maltose and xylose substrates. The catalytic activity of the three mutant enzymes on maltose was not significantly different from that of wild-type GDH. However, the catalytic activity of mutant S398M on xylose was significantly lower than that of wild-type GDH. Therefore, mutant S398M was selected for further study.
[0102] Table 2 Substrate specificity of recombinant glucose dehydrogenase
[0103]
[0104] Example 4 Purification and Enzymatic Property Analysis of Glucose Dehydrogenase:
[0105] The fermentation broth of Rhodococcus expressing wild-type GDH and the S398M mutant was centrifuged to collect the supernatant, which was then filtered through a 0.22 μm filter membrane. The filtered supernatant was applied to a nickel ion affinity chromatography column, and impurities were eluted using an equilibration buffer (PBS) containing 30 mM imidazole. Finally, the recombinant GDH was eluted using an elution buffer containing 300 mM imidazole. The eluted protein solution was then desalted by gel filtration chromatography, and the purified recombinant enzyme was collected. SDS-PAGE analysis showed that the purity of the purified recombinant glucose dehydrogenase exceeded 95%, as shown in the attached figure. Figure 6 As shown. Electrophoresis results showed that the molecular weight of the recombinant S398M mutant (lane 1) and wild-type GDH (lane 2) was 75 kDa. The theoretical molecular weight of recombinant GDH calculated based on the amino acid sequence is 68 kDa, so the GDH expressed by recombinant Rhodococcus has a certain degree of glycosylation modification. However, it is significantly lower than the glycosylation modification reported for GDH expressed recombinantly using Pichia pastoris. The specific activity of the purified wild-type GDH was determined to be 837 U / mg, and the specific activity of the S398M mutant was 856 U / mg.
[0106] The purified wild-type GDH and S398M mutant were then incubated at different temperatures for 30 min, and the enzyme activity was measured. The residual enzyme activity after treatment at different temperatures was calculated. The activity of the untreated wild-type GDH and S398M mutant was set as 100%, and the residual enzyme activity after treatment at different temperatures was calculated. Figure 7 Compared with wild-type GDH, the S398M mutant showed significantly improved thermal stability. After incubation at 55°C and 60°C for 30 minutes, the residual enzyme activity of the mutant enzyme was 82% and 51%, respectively. In contrast, the wild-type enzyme had only 21% residual activity after treatment at 55°C for 30 minutes and was almost completely inactivated after treatment at 60°C for 30 minutes.
[0107] Example 5 Recombinant expression of glucose dehydrogenase S398M mutant in Pichia pastoris:
[0108] Construction of a Pichia pastoris expression vector: The amino acid sequence of glucose dehydrogenase (GDH) from Mucor circinelloides (UniProt: S2J876) was obtained. This protein consists of 641 amino acid residues, including a 20-amino acid signal peptide at the amino terminus and a mature peptide of 621 amino acid residues. The mature peptide amino acid sequence is annotated as SEQ ID NO. 1. Based on the codon usage bias of Pichia pastoris, the GDH encoding gene was synthesized to obtain the DNA sequence of the glucose dehydrogenase S398M mutant.
[0109] The gene for the glucose dehydrogenase S398M mutant was ligated into the Pichia pastoris constitutive secretory expression vector pGAPZaA using seamless cloning between the EcoRI and NotI restriction enzyme sites. A carboxy-terminal His tag was retained for protein purification. The resulting secretory expression vector, named pGAPZaA-GDH(S398M), was then transformed into competent Escherichia coli Top10 cells using the heat shock method. The cells were plated onto solid LB medium supplemented with 50 μg / mL zeocin and cultured at 37°C for 12-16 hours to select positive colonies. A single colony was inoculated into liquid LB medium supplemented with 50 μg / mL zeocin and cultured with shaking at 37°C for 12-16 hours. The plasmid was then extracted using a plasmid extraction kit, and its concentration was determined by UV spectrophotometry.
[0110] The plasmid pGAPZaA-GDH(S398M) was electroporated into competent Pichia pastoris cells to construct recombinant Pichia pastoris expressing secreted GDH. The plasmid pGAPZaA-GDH(S398M) extracted from Escherichia coli was linearized using the Avr II restriction endonuclease. The enzyme digestion reaction system is shown in Table 3. After mixing thoroughly, the reaction was incubated at 37°C for 3–5 hours. The linearized plasmid was then purified according to the Pichia pastoris protocol. The purified linearized plasmid was then transformed into competent Pichia pastoris X33 cells. The transformed cells were then evenly plated onto YPD plates containing 100 μg / mL zeocin and incubated at 30°C for 2–3 days.
[0111] Table 3 Plasmid linearization reaction system
[0112]
[0113] The preparation process of Pichia pastoris X33 competent cells is as follows:
[0114] A single colony of Pichia pastoris was picked from the plate, inoculated into YPD medium, and cultured overnight at 30°C and 200 rpm;
[0115] Take the above cultured bacteria liquid and inoculate it into 50 mL YPD medium at a 1% inoculum volume. Continue to culture overnight at 30°C and 200 rpm until the OD600 value of the culture liquid reaches 1.3-1.5. Then collect the cultured bacteria liquid and place it in an ice bath for 30 minutes.
[0116] Centrifuge at 4000 rpm for 5 min at 4°C, discard the supernatant, and then wash the cells three times with pre-cooled sterile water;
[0117] The cells were then washed three times with pre-cooled sorbitol aqueous solution. After each wash, the cells were centrifuged at 4000 rpm for 5 min at 4°C and the supernatant was discarded.
[0118] Finally, resuspend the cells in 1 mL of 1 mol / L pre-cooled sorbitol solution to obtain competent cells.
[0119] Pichia pastoris competent cell electroporation steps:
[0120] Take 80 μL of freshly prepared Pichia pastoris X33 competent cells, place on ice, add 10 μg of linearized plasmid, mix gently with a pipette, and place on ice for 10 minutes;
[0121] The above mixture was transferred to a 2 cm electroporation cuvette, which was pre-placed in an ice bath;
[0122] Set the electroporator parameters to 2500V and 5ms. Immediately after electroporation, add 900μL of 1mol / L pre-cooled sorbitol solution to resuspend the cells.
[0123] The resuspended bacterial solution was incubated at 30°C and 200 rpm for 1 to 2 hours;
[0124] Take 50 μL of the incubated bacterial solution, spread it on a YPD plate medium containing 100 μg / mL bleomycin, and culture it at 30°C for 2-3 days until a single colony appears.
[0125] Pichia pastoris recombinantly expressed glucose dehydrogenase mutant S398M. Use a sterilized pipette tip to pick up a single clone and inoculate it into 20mL YPD medium, and culture it at 30°C and 200rpm for 48h to prepare a primary seed liquid. The primary seed liquid was inoculated into a shake flask containing 300mL YPD medium at a 2% inoculation rate, and cultured at 30°C and 200rpm for 48-72h. After the fermentation is completed, the culture solution is centrifuged at 10,000rpm for 10 minutes, the supernatant is collected, and then filtered using a 0.22um filter membrane. The filtered supernatant is applied to a nickel ion affinity chromatography column, and the impurities are eluted using an equilibrium buffer (PBS) containing 30mM imidazole. Finally, the recombinant GDH is eluted using an elution buffer containing 300mM imidazole. The eluted protein is then desalted by molecular sieves to collect the purified recombinant enzyme. The purified glucose dehydrogenase mutant S398M is detected by SDS-PAGE. Figure 8 shown.
[0126] The electrophoresis results show that the molecular weight of recombinant GDH expressed by Pichia pastoris ranges from 80 to 135 KDa, indicating that the recombinant GDH expressed by Pichia pastoris is over-glycosylated and the glycosylation is heterogeneous, resulting in heterogeneity in the molecular weight of the recombinant protein. However, the glycosylation degree of recombinant GDH expressed by Rhodococcus is very low, with a molecular weight of 75 KDa. The molecular weight of the recombinant enzyme is uniform. Figure 6 As shown. Furthermore, the specific activity of recombinant GDH expressed in Pichia pastoris was 842 U / mg, showing no significant difference from the specific activity of recombinant GDH expressed in Rhodococcus sp., indicating that glycosylation modification does not affect the catalytic activity of the enzyme. The results of thermal stability assays of recombinant GDH expressed in Pichia pastoris showed that after incubation at 55°C for 30 minutes, the recombinant mutant S398M had a residual enzyme activity of 78%, showing no significant difference in thermal stability from recombinant GDH expressed in Rhodococcus sp. The recombinant GDH expressed in Rhodococcus sp. had a uniform molecular weight and excellent thermal stability and substrate specificity.
Claims
1. A glucose dehydrogenase mutant, characterized in that The amino acid sequence such as SEQ ID NO.1 is used as a parent, and the serine at position 398 of the parent is mutated to methionine.
2. A glucose dehydrogenase mutant according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO.
2.
3. A glucose dehydrogenase mutant according to claim 2, characterized in that: The nucleotide sequence of its parent is shown in SEQ ID NO.
3.
4. A gene encoding a glucose dehydrogenase mutant according to any one of claims 1 to 3, characterized in that: Its nucleic acid sequence is shown in SEQ ID NO.
4. A recombinant engineered bacterium comprising the gene according to claim 4 .
6. The method for preparing a recombinant engineered bacterium according to claim 5, wherein: The gene in claim 4 is cloned into the expression vector pDD103, and transformed into Rhodococcus rhodochrous competent cells to obtain recombinant engineered bacteria.
7. Use of a glucose dehydrogenase mutant according to any one of claims 1 to 3 or the gene according to claim 4, characterized in that: Used for the preparation of in vitro diagnostic products.