C-Met / PD-L1-cb-Ap, PROTAC and preparation and application thereof

Abstract

The invention belongs to the field of biological medicines, and particularly relates to c-Met / PD-L1-cb-Ap, PROTAC and preparation and application of the c-Met / PD-L1-cb-Ap and PROTAC, and the c-Met / PD-L1-cb-Ap is an annular bivalent aptamer formed by connecting a c-Met aptamer and a PD-L1 aptamer through complementary sequences. The receptor provides an annular bivalent aptamer composed of a c-Met aptamer and a PD-L1 aptamer, the nuclease resistance and in-vivo stability of the aptamer are remarkably improved, and compared with an antibody, the molecular weight is smaller, higher tissue penetrability is achieved, and the receptor is suitable for tumor targeted therapy. In addition, the synthesis efficiency is high.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, in particular to the field of circular bivalent aptamer technology. Background Art

[0002] Lung cancer is the second most common and most deadly malignancy worldwide, with non-small cell lung cancer (NSCLC) accounting for approximately 80% of lung cancer cases. In NSCLC patients, the epidermal growth factor receptor (EGFR) harbors the L858R point mutation, which is a small in-frame deletion of exon 21 within exon 19. These mutations lead to aberrant EGFR activation, which is closely associated with the development and progression of NSCLC. Furthermore, these mutations create a higher-affinity binding pocket within EGFR, enhancing its binding to first-generation tyrosine kinase inhibitors (such as gefitinib and erlotinib) and second-generation tyrosine kinase inhibitors (such as afatinib and dacomitinib). Consequently, patients carrying these mutations exhibit increased sensitivity to EGFR tyrosine kinase inhibitor therapy, with response rates as high as 70% and median survival extended to 24-27 months. Therefore, EGFR-TKIs have become the standard treatment for NSCLC patients harboring these mutations. However, despite significant initial treatment responses, approximately 50% of patients develop acquired resistance to EGFR-TKIs after a median of approximately 12 months. The emergence of the T790M mutation is one of the most common mechanisms of EGFR-TKI resistance. This mutation significantly enhances the binding of ATP to EGFR, thereby resisting the inhibitory effects of first- and second-generation TKIs. Furthermore, activation of alternative signaling pathways is also a key cause of EGFR-TKI resistance. For example, overexpression of c-Met in cells can continuously activate the ERK and AKT signaling pathways, which share downstream effects with EGFR and promote tumor cell survival and proliferation.

[0003] Currently, a large number of efforts have been devoted to addressing the problem of EGFR-TKI resistance in NSCLC. For example, osimertinib and QLH11811 have been developed and used in clinical practice. In addition, various drug combination strategies have been developed, such as EGFR-TKIs combined with chemotherapy. However, the former inevitably leads to acquired resistance, while the latter, although it may prevent or at least delay the emergence of resistance, has not shown a survival advantage. Summary of the Invention

[0004] In response to the problems existing in the prior art, the first purpose of the present invention is to provide a c-Met / PD-L1-cb-Ap, aiming to provide a new aptamer that can target and recognize multiple receptor tyrosine kinases.

[0005] The second purpose of the present invention is to provide the preparation and application of the c-Met / PD-L1-cb-Ap.

[0006] The third object of the present invention is to provide a PROTAC comprising the c-Met / PD-L1-cb-Ap.

[0007] The fourth object of the present invention is to provide the preparation of the PROTAC and its use in the preparation of anticancer drugs.

[0008] The fifth object of the present invention is to provide an anticancer active ingredient.

[0009] c-Met / PD-L1-cb-Ap is a circular bivalent aptamer formed by connecting the c-Met aptamer and the PD-L1 aptamer through complementary sequences.

[0010] The receptor of the present invention provides a circular bivalent aptamer composed of a c-Met aptamer and a PD-L1 aptamer. This not only significantly improves the aptamer's resistance to nucleases and in vivo stability, but also has a smaller molecular weight and stronger tissue penetration than antibodies, making it suitable for tumor targeted therapy. In addition, its synthesis efficiency is high.

[0011] In the present invention, the c-Met aptamer is aptamer SL1, and its sequence may be known in the industry.

[0012] Preferably, the PD-L1 aptamer is Mj5c, and its sequence may be well known in the industry.

[0013] In this aspect, the complementary sequence is a DNA sequence.

[0014] More preferably, the complementary sequence has 10 to 15 bases.

[0015] In the present invention, the complementary sequences may be sequences known in the industry that can complement each other.

[0016] The present invention also provides a method for preparing the c-Met / PD-L1-cb-Ap, wherein the c-Met aptamer and the PD-L1 aptamer complementary sequences are connected to prepare the c-Met / PD-L1-cb-Ap.

[0017] In the present invention, the c-Met aptamer and the PD-L1 aptamer can be linked to each other based on conventional linking means to form the circular bivalent aptamer.

[0018] For example, in the present invention, as an optional solution, sequence A with a phosphate group terminal can be added to the 5' end of the c-Met aptamer to obtain c-Met aptamer-sequence A; sequence B with a phosphate group terminal can be added to the 5' end of the PD-L1 aptamer to obtain PD-L1 aptamer-sequence B; wherein sequence A and sequence B are complementary, and then the c-Met aptamer-sequence A and the PD-L1 aptamer-sequence B are treated with DNA ligase to complementary ligate sequence A and sequence B to obtain the c-Met / PD-L1-cb-Ap. Of sequence A and sequence B, one sequence is GGAGGGAAAAGTC and the other is GACTTTTCCCTCC.

[0019] The present invention also provides an application of the c-Met / PD-L1-cb-Ap for preparing drugs for targeted cancer treatment.

[0020] For example, the cyclic bivalent nucleic acid aptamer described in the present invention can be used as a targeted drug delivery vehicle or as a therapeutic molecule itself. It can not only block c-Met-mediated tumor growth signals, but also intervene in PD-L1-mediated immune escape. It has the potential to synergistically enhance anti-tumor effects. In the future, it is expected to be used in multi-target precision treatment and immunotherapy, expanding the application boundaries of nucleic acid drugs in the field of tumor treatment.

[0021] The present invention also provides a c-Met / PD-L1-cb-Ap-PROTAC (also referred to as PROTAC), comprising c-Met / PD-L1-cb-Ap modified with an E3 ubiquitin ligase ligand; wherein the c-Met / PD-L1-cb-Ap is the c-Met / PD-L1-cb-Ap described in the present invention.

[0022] The present invention provides c-Met / PD-L1-cb-Ap for the first time and innovatively modifies an E3 ubiquitin ligase ligand thereon to construct a PROTAC. The PROTAC of the present invention has the targeting and degradation activity of multiple tyrosine kinases, and can be used to construct drugs based on excellent activity. For example, the PROTAC of the present invention can efficiently and simultaneously degrade c-Met and other receptor tyrosine kinases, thereby inhibiting the phosphorylation of downstream effector proteins. Based on this mechanism, PROTAC can simultaneously overcome lung cancer resistance caused by EGFR mutations and signal crosstalk. In vivo data show that the combination of PROTAC and first-generation EGFR kinase inhibitors can significantly inhibit the growth of lung cancer tumors, and its effect is comparable to that of the third-generation EGFR kinase inhibitor osimertinib.

[0023] The c-Met / PD-L1-cb-Ap-PROTAC of the present invention, the E3 ubiquitin ligase ligand includes AHPC.

[0024] In the present invention, the E3 ubiquitin ligase ligand can be produced using known methods and processes. For example, as an alternative, the AHPC is linked to the T base of c-Met / PD-L1-cb-Ap via the following formula 1:

[0025]

[0026] Formula 1.

[0027] The present invention also provides a method for preparing the c-Met / PD-L1-cb-Ap-PROTAC, which directly modifies the E3 ubiquitin ligase ligand on c-Met / PD-L1-cb-Ap;

[0028] Alternatively, an E3 ubiquitin ligase ligand is pre-modified on at least one of the c-Met aptamer and the PD-L1 aptamer, and then ligated using complementary sequences to produce the c-Met / PD-L1-cb-Ap-PROTAC.

[0029] In the present invention, the modified E3 ubiquitin ligase ligand can be conventional. For example, DBCO can be modified on the sequence of c-Met aptamer, PD-L1 aptamer, or the c-Met / PD-L1-cb-Ap, such as the T base, and then cross-linked with an E3 ubiquitin ligase ligand with N3- to prepare the PROTAC.

[0030] The present invention also provides a use of the c-Met / PD-L1-cb-Ap-PROTAC in the preparation of a drug for degrading tyrosine kinase;

[0031] Preferably, it is used to prepare a drug for degrading EGFR and c-Met;

[0032] Preferably, it is used to prepare a drug for treating cancer;

[0033] Preferably, it is used to prepare a drug for treating lung cancer;

[0034] Preferably, the compound is used for preparing a drug for treating EGFR inhibitor-resistant lung cancer.

[0035] The present invention also provides an anticancer active ingredient comprising a pharmaceutically effective amount of the c-Met / PD-L1-cb-Ap-PROTAC;

[0036] Preferably, it further comprises an EGFR inhibitor;

[0037] Preferably, the anticancer active ingredient is an active ingredient against lung cancer;

[0038] Preferably, the anti-cancer active ingredient is an active ingredient for lung cancer resistant to EGFR inhibitors.

[0039] Beneficial effects

[0040] The present invention provides a c-Met / PD-L1-cb-Ap and a PROTAC constructed based on the c-Met / PD-L1-cb-Ap, which has good cancer recognition activity and multiple receptor tyrosine kinase degradation activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the preparation based on cyclized bivalent aptamers;

[0042] Figure 2 Preparation of cb-Ap and analysis of its binding capacity;

[0043] Figure 3 The levels of c-Met and PD-L1 in different tumor cells;

[0044] Figure 4 1.3 The stability analysis results of gel electrophoresis;

[0045] Figure 5 Fluorescence confocal laser microscopy (CLSM) images of 200 nM FAM-labeled SL1, Mj5c, and cb-Ap binding to NCI-H1975 cells, scale bar = 30 μm;

[0046] Figure 6 1.4 Flow cytometry test to verify the target binding ability;

[0047] Figure 7 This is a graph of the 1.6 in vivo half-life experiment;

[0048] Figure 8 Figure 1.7 shows in vivo tumor imaging analysis. (A) In vivo fluorescence monitoring at different time points after injection of Cy5-labeled aptamers into NCI-H1975 tumor-bearing mice. (B) Fluorescence distribution assessment of major organs and tumors after euthanasia of tumor-bearing mice.

[0049] Figure 9 Immunoblotting test of AHPC-cb-Ap-induced c-Met protein degradation Figure: (A) NCI-H1975 cells (B) A549 cells;

[0050] Figure 10 Figure 2.2: Western blot test. (A) Western blot experiment to investigate the levels of p-EGFR and p-AKT under different treatments. (B) Quantification of protein levels in (A) and differential analysis.

[0051] Figure 11 Immunofluorescence detection of c-Met (green) and PD-L1 (red) expression levels in NCI-H1975 cells after incubation with 500 nM SSL1, AHPC-SL1, AHPC-Mj5c, and AHPC-cb-Ap for 72 hours;

[0052] Figure 12 This is a diagram showing the effect of AHPC-cb-Ap on the movement of NCI-H1975 cells in 2.4 scratch experiment;

[0053] Figure 13 Figure 2 shows the cytotoxicity test of NCI-H1975 cells pre-incubated with 500 nM AHPC-cb-Ap. (A) 24 hours, (B) 48 hours, and (C) 72 hours later, the cells were incubated with different concentrations of Erlotinib for 72 hours. (D) IC50 statistical graph under different treatments.

[0054] Figure 14 This is a graph showing apoptosis analysis of NCI-H1975 cells pretreated with 500 nM AHPC-cb-Ap combined with Erlotinib;

[0055] Figure 15 Fluorescence staining analysis of the live and dead cells of NCI-H1975 cells after pretreatment with 500 nM AHPC-cb-Ap and combined with Erlotinib (Calcein-AM marks live cells, green; PI marks dead cells, red; scale bar = 50 μm);

[0056] Figure 16 This figure shows the investigation of AHPC-cb-Ap overcoming the resistance of NCI-H1975 tumor-bearing mice to the first-generation EGFR kinase inhibitor Erlotinib;

[0057] Figure 17 To compare the therapeutic effects of combination therapy with first-, second-, and third-generation EGFR kinase inhibitors;

[0058] Figure 18 Figure 2.7: Western blot analysis of tumor tissues. (A) Changes in tumor volume. (B) Changes in mouse weight. (C) Tumor images of NCI-H1975 tumor-bearing mice after treatment. (D) Western blot analysis of EGFR and c-Met levels in tumors of NCI-H1975 tumor-bearing mice after treatment.

[0059] Figure 19 2.8 Immunofluorescence analysis of c-Met protein in tumors treated with different methods, as well as HE and TUNEL staining analysis;

[0060] Figure 202.9 Pathological analysis of tumors and major organs after treatment;

[0061] Figure 21 Immunohistochemical analysis of p-EGFR, p-AKT, and Ki67 as well as HE and TUNEL staining analysis in the tumor after different treatments;

[0062] Figure 22 Pathological analysis of tumors and major organs after treatment. DETAILED DESCRIPTION

[0063] Exemplary embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0064] 1. Reagents

[0065] Table 1 DNA sequences

[0066]

[0067]

[0068] Table 2

[0069]

[0070] Table 3 Antibodies

[0071]

[0072] Table 4 Cell lines

[0073]

[0074] 2. Preparation of the second part of materials:

[0075] Synthesis circuit diagram Figures 1 and 2 .

[0076] Example 1 Construction of c-Met / PD-L1-cb-Ap (also referred to as cb-Ap in the present invention)

[0077] To construct the circular bivalent aptamer cb-Ap, 13-base complementary sequences were first introduced into the 5' termini of aptamers SL1 and Mj5c, respectively. Phosphorylation modifications were then added to both ends to yield aptamer derivatives with ligation activity (denoted as 13nt-SL1 and 13nt-Mj5c, respectively; see Table 1 for details). Subsequently, equimolar amounts of the two aptamer monomers were dissolved in 1× T4 DNA ligase buffer (New England Biolabs), heated at 95°C for 5 minutes for full denaturation, and then quickly cooled in an ice bath at 4°C to promote efficient hybridization of the complementary regions. Following hybridization, 400 U of T4 DNA ligase was added at 4°C for a 12-hour ligation reaction to covalently block the hybridization sites, ultimately constructing the stable circular bivalent nucleic acid aptamer cb-Ap.

[0078] Example 2 Construction of c-Met / PD-L1-cb-Ap-PROTAC (also referred to as AHPC-cb-Ap in the present invention)

[0079] The preparation method of c-Met / PD-L1-cb-Ap-PROTAC of the present invention directly modifies the E3 ubiquitin ligase ligand on c-Met / PD-L1-cb-Ap;

[0080] Alternatively, an E3 ubiquitin ligase ligand is pre-modified on at least one of the c-Met aptamer and the PD-L1 aptamer, and then ligated using complementary sequences to produce the c-Met / PD-L1-cb-Ap-PROTAC.

[0081] In the present invention, the modified E3 ubiquitin ligase ligand can be conventional. For example, DBCO can be modified on the sequence of c-Met aptamer, PD-L1 aptamer, or the c-Met / PD-L1-cb-Ap, such as the T base, and then cross-linked with an E3 ubiquitin ligase ligand with N3- to prepare the PROTAC.

[0082] For example, DBCO can be first modified on SL1 to obtain DBCO-SL1, whose sequence is GT(DBCO)CAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCT(DBCO)GAC, and DBCO is modified at two T bases in the sequence. The structure of the modified site is, for example:

[0083]

[0084] DBCO-SL1 modified fragment (also labeled as dT-DBCO).

[0085] DBCO-SL1 and N3-AHPC were then cross-linked, and AHPC was modified on SL1 to prepare SL1-AHPC.

[0086] (N3-AHPC)

[0087] Alternatively, DBCO can be pre-modified on the T base of Mj5c using the above method to obtain DBCO-Mj5c, which is then combined with N3-AHPC to obtain Mj5c-AHPC.

[0088] In the present invention, the complementary sequence can be a sequence with any number of bases and capable of complementation, and can be linked and modified on the aptamer based on conventional means. As optional complementary sequences, one sequence is GGAGGGAAAAGTC and the other sequence is GACTTTTCCCTCC.

[0089] The preparation is specifically as follows:

[0090] First, the DBCO (strained alkyne)-modified aptamer derivative DBCO-13nt-SL1 was mixed with the azide-carrying (S,R,S)-AHPC-PEG4-N3 at a molar ratio of 1:1.2 in 1× PBS buffer and incubated at 37°C in the dark for 12 hours. Efficient coupling was achieved using a copper-free strain-facilitated azide-alkyne click reaction (SPAAC). Following the reaction, the product was purified by three rounds of centrifugation using a 3 kDa molecular weight cutoff ultrafiltration tube (Millipore, UFC900396), each at 14,000 rpm for 15 minutes to remove unreacted small molecules. Subsequently, the resulting AHPC-13nt-SL1 and 13nt-Mj5c were mixed in equal moles and annealed and ligated in T4 DNA ligase buffer according to the cb-Ap construction protocol, resulting in the construction of the circular bivalent aptamer AHPC-cb-Ap with protein degradation function.

[0091] In addition, AHPC-SL1 and AHPC-Mj5c were constructed by the same click reaction of DBCO-SL1 or DBCO-Mj5c with (S,R,S)-AHPC-PEG4-N3, respectively, and purified by the same ultrafiltration method.

[0092] 3. Testing and Analysis:

[0093] Part I: cb-Ap association test and data analysis

[0094] 1.1 Immunoblotting

[0095] Specific steps for immunoblotting experiments:

[0096] (1) Protein extraction and concentration determination: After removing the culture medium with a pipette, wash the twelve-well plate three times with pre-cooled DPBS. Add 80 μL of RIPA lysis buffer containing protease inhibitors to each well, and then shake vigorously on ice for 20 minutes to fully lyse the cells. Subsequently, use a pre-cooled pipette tip to scrape the lysed cells, transfer the lysate to a pre-cooled 1.5 mL centrifuge tube, and centrifuge at 15,000 rpm for 15 minutes at 4°C. Finally, aspirate 50 μL of the supernatant into another pre-cooled centrifuge tube and store at -80°C. Use a UV spectrophotometer to determine the protein concentration, and take the average value after repeating three times.

[0097] (2) Sample preparation: Based on the quantitative results, take a sample volume containing 240 μg of protein, add ultrapure water to 16 μL, and then add 4 μL of protein loading buffer containing bromophenol blue (final volume 20 μL). After centrifugation, place the protein sample in a PCR instrument and heat at 100°C for 5-10 minutes. Finally, remove the sample and prepare for loading.

[0098] (3) SDS-PAGE (Sodium dodecyl sulfate-polyacrylamide gel electrophoresis): After removing the comb, add the sample and protein marker to the SDS-PAGE gel. Then adjust the voltage to 65V and run for 30 minutes. Then adjust the voltage to 130V and continue the experiment.

[0099] (4) Transfer: With the blackboard facing down and the whiteboard facing up, stack the sponge sheet, filter paper, PVDF membrane, gel, filter paper, and sponge sheet in sequence to complete the transfer clamp assembly. Use a roller to remove bubbles between each layer to ensure the quality of the transfer. Then adjust the electrophoresis instrument to the current mode, specifically set the voltage to 300mA, and the run time to 90 minutes. After the transfer is completed, gently remove the PVDF membrane and stain it with Ponceau red. Finally, trim the membrane according to the protein marker to prepare for the blocking step.

[0100] (5) Blocking: Incubate the trimmed strips with the pre-prepared blocking solution at room temperature for 1 hour to eliminate nonspecific binding of the antibody.

[0101] (6) Antibody incubation: Incubate the protein bands with the primary antibody at 4°C for more than 12 hours. Then, recover the primary antibody and wash the bands with 1×TBST buffer three times for 10 minutes each. Subsequently, incubate the protein bands with the secondary antibody at room temperature for 1 hour. Wash the bands again with 1×TBST buffer three times for 10 minutes each and prepare for luminescence.

[0102] (7) Luminescent imaging: After gently absorbing the residual liquid on the surface of the protein band with filter paper, mix the luminescent liquid A and B in a 1:1 volume ratio and then cover the surface of the protein band with them. Use a gel imaging instrument to image.

[0103] To evaluate the expression levels of c-Met and PD-L1 proteins in different cell lines, different tumor cells were cultured at 2×10 5 The cells were seeded into 12-well plates at a density of 10 cells / well. After the cells adhered to the wall, they were washed and lysed, and then subjected to immunoblotting analysis. Figure 3 .

[0104] 1.2 Polyacrylamide gel electrophoresis experiment

[0105] (1) 7.4 mL of ultrapure water, 6 mL of 30% acrylamide / methylenebisacrylamide (29:1), 1.5 mL of 10× TBE buffer (pH 8.3), 110 μL of 10% ammonium persulfate (APS), and 10 μL of TEMED were mixed in sequence, vortexed for 10 seconds to thoroughly mix, and quickly injected into a glass plate sandwich (10 cm × 8 cm × 1.5 mm), inserted with a 15-tooth comb, and allowed to stand at room temperature for 30 minutes until complete polymerization.

[0106] (2) Sample preparation: Prepare 10 μL of 2 μM DNA sample, then add 2 μL of loading buffer, centrifuge and mix, and then prepare for loading.

[0107] (3) Electrophoresis: Place the pre-prepared gel in a vertical electrophoresis tank and add 500 mL of electrophoresis solution. After ensuring that there is no leakage, add the nucleic acid sample and DNA marker in sequence. Then set the electrophoresis instrument to voltage mode and adjust the voltage to 120 V and run for 45 minutes.

[0108] (4) Gel imaging: Since the nucleic acid samples were not labeled with fluorescent dyes, the gel was gently removed after electrophoresis and incubated with 1:10000 diluted GelRed in the dark for 30 minutes. TM Gel imaging was performed using the XRS+ system.

[0109] 1.3 Stability analysis experiment

[0110] (1) Sample incubation: The number of samples to be prepared is determined based on the experimental design time point. The concentration of each sample is 2 μM, and the concentration of nuclease I is 0.25 U / μL. After the sample is prepared, place it in a 37°C oven. After a specific time point, remove the sample and place it in a PCR instrument at 95°C for 5 minutes to denature the nuclease I. The sample is then stored at -20°C for later use.

[0111] (2) Sample characterization: After the sample incubation is complete, 10 μL of DNA is removed and added to 2 μL of loading buffer, followed by electrophoresis. Finally, the results are imaged by gel.

[0112] The stability analysis results of gel electrophoresis are shown in Figure 4 .

[0113] The experimental results are as follows Figure 4 As shown, Mj5c showed significant degradation after just one hour of incubation, indicating its extremely poor stability under enzymatic conditions. In contrast, SL1 exhibited some resistance to enzymatic cleavage, retaining some intact bands after 24 hours. This may be related to the formation of G-quadruplexes or other stable secondary structures due to its G-rich sequence. Of particular note, cb-Ap maintained significant band intensity after 72 hours of incubation with exonucleases, demonstrating its exceptionally high integrity. This result suggests that the unique circular structure of cb-Ap offers a natural advantage in resisting exonuclease attack, significantly enhancing its stability in physiological environments. Furthermore, since the circular configuration lacks free 3' or 5' ends, its spatial configuration may hinder nuclease binding and cleavage, further enhancing its resistance to degradation.

[0114] 1.4 Fluorescence imaging experiment

[0115] Aptamer binding assay: To analyze the binding of aptamers to cells, 2.5×10 5 NCI-H1975 cells were seeded in a 15 mm diameter confocal culture dish. After cell attachment, they were incubated with 200 nM SSL1, Mj5c, and cb-Ap labeled with FAM for 1 hour at 4°C and then washed three times with Western blotting buffer. Finally, cell nuclei were stained with Hoechst 33342 (1:1000 dilution) for 15 minutes, and fluorescence images were acquired using an Olympus confocal microscope (FV1000, Japan).

[0116] Fluorescence confocal laser microscopy (CLSM) images of 200 nM FAM-labeled SL1, Mj5c, and cb-Ap binding to NCI-H1975 cells are shown in Figure 5 , scale bar = 30 μm.

[0117] Flow cytometry verification of target binding ability experiment Figure 6 .

[0118] Figure 6AB showed that compared with SL1 and Mj5c, cb-Ap exhibited stronger binding ability in the NCI-H1975 cell line, but was unable to recognize c-Met and PD-L1 in the double-negative cell line HEK293, which was consistent with the performance of monovalent nucleic acid aptamers. The above experiments confirmed that cb-Ap increased the binding ability of target cells but did not affect its specificity. At the same time, it can be clearly seen from the confocal experiment that on NCI-H1975, the co-expression of c-Met and PD-L1 on the cell surface increased the binding of cb-Ap on the cell, which significantly enhanced the fluorescence intensity on the cell membrane surface, which is consistent with the conclusion obtained by flow cytometry. Finally, the present invention also determined the apparent equilibrium dissociation constants (Kd) of cb-Ap on NCI-H1975 to be 28.2, 336.3 and 187nM, respectively, further confirming that cb-Ap has good binding ability ( Figure 6 C).

[0119] 1.5 Cell culture and passaging

[0120] The cell culture medium used is RPMI-1640 or DMEM containing 10% fetal bovine serum and 1% double antibody. The specific culture conditions are 37°C, 5% CO2 and 95% humidity. When the cell density is lower than 30%, it is only necessary to wash 2-3 times with DPBS buffer. When the cell density is greater than 70%, passaging is required. The specific operation is as follows: first wash the cells 2-3 times with DPBS buffer, then add 200μL of trypsin to the culture flask and place it in the cell culture incubator and wait 1-2 minutes. After the cells are digested, add complete culture medium to terminate the digestion process, and remove part of the culture medium to complete the passaging process.

[0121] 1.6 In vivo half-life study

[0122] The experiment used healthy BALB / c nude mice aged 4 to 6 weeks, and all operations were in compliance with the standards approved by the Experimental Animal Ethics Committee of Hunan University (Batch No.: SYXK2023-0010). 9 mice were randomly divided into three groups, three in each group, and 4nmol of SL1, Mj5c and cb-Ap labeled with Cy5 dye were injected into the tail vein of the mice. Subsequently, 10μL blood samples were collected from the tail of the mice at 10 minutes, 20 minutes, 30 minutes, 60 minutes, 120 minutes and 240 minutes after injection, and 90uLDPBS buffer was added for fluorescence spectral analysis. After 240 minutes, the mice were euthanized, and the major organs were collected and analyzed in vitro using a living imaging system.

[0123] In vivo half-life experiment Figure 7(A) 2μM SL1, Mj5c, and cb-Ap were incubated in 0.25U / μL exonuclease I for a specific time, and their integrity was analyzed using a 12% native polyacrylamide gel. (B) Pharmacokinetics of Cy5-labeled SL1, Mj5c, and cb-Ap were evaluated in mice after tail vein administration. (C) In vitro imaging analysis of fluorescence signals in major organs of mice.

[0124] Figure 7 As shown in Figure A, Mj5c showed significant degradation after just one hour of incubation, indicating its extremely poor stability under enzymatic conditions. In contrast, SL1 exhibited some resistance to enzymatic cleavage, retaining some intact bands after 24 hours. This may be due to the formation of G-quadruplexes or other stable secondary structures due to its G-rich sequence. Of particular note, cb-Ap maintained significant band intensity after 72 hours of incubation with exonucleases, demonstrating its exceptionally high integrity. This result suggests that the unique circular structure of cb-Ap offers a natural advantage in resisting exonuclease attack, significantly enhancing its stability in physiological environments. Furthermore, since the circular structure lacks free 3' or 5' ends, its spatial configuration may hinder nuclease binding and cleavage, further enhancing its resistance to degradation.

[0125] To further evaluate the in vivo stability of nucleic acid aptamers, the present invention selected Cy5 fluorescently labeled SL1, Mj5c, and cb-Ap and administered them to mice via tail vein injection. Subsequently, tail vein blood samples were collected from mice at predetermined time points, and the Cy5 fluorescent signal intensity in the blood was measured to indirectly estimate the residual amount of each aptamer in the blood, thereby obtaining its circulation half-life. The results are shown in Figure 2. Figure 7 As shown in Figure B, the circulation half-life of cb-Ap in the blood is about 56.01 minutes, which is significantly better than SL1 (22.51 minutes) and Mj5c (15.02 minutes), and is extended by about 2.49 times and 3.73 times, respectively. This significant extension of half-life may be due to the unique structural characteristics of cb-Ap. On the one hand, the ring conformation makes cb-Ap lack exposed 3' and 5' ends, thereby avoiding the recognition and degradation of nuclease exonucleases; on the other hand, its larger molecular weight and conformational stability may also reduce its filtration efficiency in the glomeruli and slow its clearance from the blood. After completing the hemodynamic analysis, the present invention euthanized the mice and collected major organs (including heart, liver, spleen, lungs, kidneys, etc.) for in vitro fluorescence imaging analysis to evaluate the distribution characteristics of different aptamers in vivo. As Figure 7As shown in Figure C, cb-Ap exhibits significant fluorescence signal enrichment in both the liver and kidneys, while the signal in other organs is relatively weak. This enrichment may be closely related to its prolonged blood circulation time—the longer the circulation time, the more likely the aptamer is to passively accumulate in metabolic organs such as the liver and kidneys. Furthermore, the ring structure is more stable in the body and less prone to rapid metabolism, which may also promote its accumulation in hepatocytes and the renal tubular system.

[0126] 1.7 In vivo tumor imaging analysis

[0127] Take 1×10 7 After washing three times with DPBS, NCI-H1975 cells were subcutaneously injected into the back of the right hind limb of 4- to 6-week-old BALB / c nude mice to establish a tumor-bearing mouse model. 3 (The volume calculation formula is 0.5×length×width 2 ), 4 nmol of Cy5-labeled cb-Ap, SL1, or Mj5c were injected via the tail vein. Subsequently, mice were imaged in real time using the IVISLumina II in vivo imaging system (Caliper Life Sciences, USA). Ten hours later, mice were euthanized, and major organs were harvested for ex vivo imaging analysis using an in vivo imaging system.

[0128] In vivo tumor imaging analysis Figure 8 , including: (A) In vivo fluorescence monitoring at different time points after injection of Cy5-labeled aptamers into NCI-H1975 tumor-bearing mice; (B) Fluorescence distribution evaluation of major organs and tumors after euthanasia of tumor-bearing mice

[0129] like Figure 8 As shown in A, cb-Ap quickly showed obvious fluorescent signals at the tumor site 2 hours after injection, indicating that it can quickly and efficiently locate to the target tissue. Over time, the fluorescence intensity of cb-Ap in the tumor area continued to increase, and reached a peak 10 hours after injection, showing good in vivo retention ability. In contrast, the fluorescence signals of SL1 and Mj5c were significantly weaker in the tumor area and decayed rapidly over time, suggesting that their in vivo stability and targeting capabilities were inferior to cb-Ap. It is worth noting that cb-Ap did not show obvious nonspecific enrichment during the entire monitoring period, indicating that it has high selectivity and targeting in vivo. This advantage may be attributed to the spatial conformational stability and resistance to enzymatic degradation brought about by its ring structure. In order to further verify its tissue distribution and tumor enrichment specificity, after the in vivo imaging was completed, the present invention euthanized the mice, and took their tumor tissues and major organs (heart, liver, spleen, lungs, and kidneys) for tissue fluorescence imaging analysis. As Figure 8As shown in Figure B, cb-Ap exhibited the strongest fluorescence signal in tumor tissue, significantly higher than that of the SL1 and Mj5c groups, further demonstrating its enhanced tumor accumulation in vivo. Furthermore, cb-Ap exhibited relatively low fluorescence distribution in organs such as the liver and kidneys, indicating that its clearance pathway is primarily through hepatic and renal metabolism, but with minimal nonspecific accumulation, facilitating subsequent drug aptamerization and therapeutic delivery applications. In contrast, SL1 and Mj5c not only exhibited poor tumor accumulation but also exhibited high background signals in tissues such as the liver and spleen, suggesting their instability and susceptibility to nonspecific clearance.

[0130] Part II: RPOTAC-related tests and data

[0131] 2.1 Cell culture and passaging

[0132] See Section 1.5 of Part 1 for details.

[0133] 2.2 Immunoblotting

[0134] Please refer to Section 1.1 of Part 1 for details.

[0135] To investigate the protein degradation ability of proteins, adherent NCI-H1975 cells were incubated with different groups of DNA for 72 h, and the cells were lysed for immunoblot analysis.

[0136] Western blot test of AHPC-cb-Ap induced c-Met protein degradation Figure 9 : (A) NCI-H1975 cells (B) A549 cells.

[0137] The results showed that in the SL1-treated group, the c-Met level in A549 cells decreased significantly, while no significant changes were observed in NCI-H1975 cells ( Figure 9). Specifically, after 72 hours of treatment with 800nM SL1, the expression level of c-Met in A549 cells decreased by approximately 75%, but had no significant effect on NCI-H1975 cells. This may be related to SL1-mediated c-Met phosphorylation dependent on the Y1003 site, and the Y1003 site may be missing in the juxtamembrane region of c-Met in NCI-H1975 cells. Furthermore, after the E3 ligase ligand small molecule AHPC was cross-linked with the SL1 aptamer through click chemistry to form an AHPC-SL1 chimera, it was observed that this chimera could effectively degrade c-Met in both A549 and NCI-H1975 cells. In NCI-H1975 cells, after AHPC-SL1 was internalized into the cells, it was able to efficiently recruit the E3 ligase VHL and activate the ubiquitin-proteasome pathway, thereby achieving c-Met degradation, and this process was independent of phosphorylation at the Y1003 site. In A549 cells, aptamer SL1-mediated phosphorylation of the Y1003 site and AHPC ligand-mediated E3 ligase recruitment jointly promoted c-Met degradation. Consequently, AHPC-SL1 exhibited significantly improved degradation efficiency in A549 cells compared to single-chain SL1. Finally, AHPC-cb-Ap was constructed by linking AHPC-SL1 to the PD-L1-targeting aptamer Mj5c using the T4 enzyme-linked assay. Compared to SL1 and AHPC-SL1, the chimeric AHPC-cb-Ap exhibited the strongest protein degradation activity after 72 hours of treatment. For example, treatment with 200 nM of AHPC-cb-Ap reduced c-Met levels by 68% and 56% in NCI-H1975 and A549 cells, respectively. In contrast, SL1 and AHPC-SL1 showed little to no degradation at 200 nM. This significant difference is mainly attributed to the advantages of circular aptamers in targeting and binding ability.

[0138] To verify the effects of the combined treatment on the EGFR signaling pathway, adherent NCI-H1975 cells were incubated with erlotinib, AHPC-cb-Ap, or erlotinib plus AHPC-cb-Ap for 24 hours. Following incubation, the cells were washed three times with ice-cold DPBS and lysed. Western blot analysis was then performed to measure the expression of p-EGFR and p-AKT, key signaling proteins in the EGFR signaling pathway.

[0139] Western blot test Figure 10 (A) Western blot analysis of the p-EGFR and p-AKT levels under different treatments. (B) Quantification of protein levels in (A) and differential analysis.

[0140] like Figure 10To evaluate the effect of the combined use of AHPC-cb-Ap and erlotinib on the levels of p-EGFR and p-AKT, key molecules in the EGFR signaling pathway, the present invention compared the effects of erlotinib with those of AHPC-cb-Ap alone. Because the NCI-H1975 cell line is resistant to erlotinib, erlotinib alone only slightly reduced p-EGFR and p-AKT levels compared to the DPBS control, indicating that the anti-tumor effect of erlotinib is significantly limited in this cell line.

[0141] However, when AHPC-cb-Ap is used alone, it can effectively reduce the phosphorylation levels of p-EGFR and p-AKT by degrading c-Met and related receptor tyrosine kinase (RTK) proteins, reducing them by 30.5% and 23%, respectively. This shows that AHPC-cb-Ap not only has good protein degradation ability, but also can indirectly regulate the activity of downstream key signaling molecules and inhibit the continuous proliferation signals of cancer cells. More importantly, when AHPC-cb-Ap is used in combination with Erlotinib, the expression levels of p-EGFR and p-AKT are significantly reduced.

[0142] The results showed that AHPC-cb-Ap significantly enhanced the inhibitory effect of erlotinib through its protein degradation function, overcame the drug resistance of erlotinib to NCI-H1975 cells, and effectively sensitized the cell line.

[0143] 2.3 Immunofluorescence experiments

[0144] Immunofluorescence experiment: To detect the expression of cell membrane surface proteins, 1×10 5 NCI-H1975 cells were seeded in 15 mm diameter confocal microplate dishes. After cell attachment, they were incubated with 500 nM AHPC-cb-Ap, AHPC-SL1, AHPC-Mj5c, SL1, and Mj5c for 72 hours. The old medium was then removed, and the cells were thoroughly washed three times with pre-chilled DPBS before being fixed with 4% paraformaldehyde for 15 minutes at room temperature. Subsequently, the cells were blocked with 5% BSA solution for 1 hour at room temperature. The fixed cells were incubated with either c-Met or PD-L1 antibodies (1:1000 dilution) overnight at 4°C. The following day, they were incubated with AlexaFluor 488-conjugated anti-rabbit or AlexaFluor 647-conjugated anti-mouse secondary antibodies (1:1000 dilution) for 1 hour at room temperature. Afterwards, the cell nuclei were stained with Hoechst 33342 (1:1000 dilution) for 15 min, and fluorescent images were acquired using an Olympus confocal microscope (FV1000, Japan).

[0145] Immunofluorescence detection of c-Met (green) and PD-L1 (red) expression levels in NCI-H1975 cells after incubation with 500 nM SSL1, AHPC-SL1, AHPC-Mj5c, and AHPC-cb-Ap for 72 hours. Figure 11 .

[0146] Figure 11 The results showed that AHPC-cb-Ap still exhibited the best protein degradation effect, which is consistent with the results of the immunoblotting experiment. At the same time, by incubating with PD-L1 antibody and using AlexaFluor488 fluorescently labeled secondary antibody, changes in PD-L1 protein on the cell membrane were observed, and its expression trend was consistent with that of c-Met protein.

[0147] 2.4 Cell scratch assay

[0148] NCI-H1975 cells were seeded in 96-well plates (10,000 cells per well). After cell attachment, the medium was switched to serum-free medium and incubated for another 24 hours. A scratch wound was then performed using a scratch wound instrument. The cells were then treated with 100 ng / mL HGF, 500 nM AHPC-cb-Ap, 500 nM AHPC-cb-Ctrl, 100 ng / mL HGF + 500 nM AHPC-cb-Ap, and 100 ng / mL HGF + 500 nM AHPC-cb-Ctrl. Data were recorded at different time points (12 and 24 hours) using a Cytation5 (Biotek) microplate reader.

[0149] The scratch test investigated the effect of AHPC-cb-Ap on the movement of NCI-H1975 cells. Figure 12 .

[0150] from Figure 12 These data indicate that AHPC-cb-Ap can not only effectively degrade c-Met protein, but also inhibit cell motility and migration.

[0151] 2.5 Cytotoxicity assay

[0152] CCK8 experimental steps:

[0153] (1) Cell treatment: After removing the culture medium from each well, add 90 μL of culture medium and 10 μL of CCK8 mixed solution to each well.

[0154] (2) Incubation: Incubate the cells at 37°C, 5% CO2 for approximately 30 minutes.

[0155] (3) Absorbance Detection: The absorbance was recorded at 450 nm using a BioTek Synergy Neo2 Multi-Mode Mixed-Mode Plate Reader (BioTek). A mixed solution of 90 μL fresh culture medium and 10 μL CCK8 was used as a blank control well to calculate the background value.

[0156] (4) Data Calculation: Subtract the average absorbance of the background wells from the average absorbance of the experimental and control groups. Calculate cell viability using the formula (At / A0) × 100%, where At is the average absorbance of the experimental group and A0 is the average absorbance of the control group.

[0157] (5) Data processing: The data were expressed as the average percentage of cell viability and were fitted with nonlinear regression using GraphPad Prism 8 software.

[0158] To investigate the effect of AHPC-cb-Ap on the viability of NCI-H1975 cells, adherent cells were incubated with different concentrations of AHPC-cb-Ap for different times (24 h, 48 h, and 72 h), and then the cell viability was detected by CCK8 reagent.

[0159] To investigate whether AHPC-cb-Ap could sensitize NCI-H1975 cells and overcome their resistance to erlotinib, NCI-H1975 cells were first incubated with AHPC-cb-Ap for different periods of time (24, 48, and 72 hours). Subsequently, the old culture medium was removed, and different concentrations of erlotinib were added, followed by an additional incubation for 72 hours. Finally, cell viability was assessed using CCK8 assay.

[0160] To verify that the combination therapy's efficacy is comparable to that of the second- and third-generation EGFR kinase inhibitors afatinib and osimertinib, adherent NCI-H1975 cells were preincubated with AHPC-cb-Ap for 24 hours. The culture medium was removed, and erlotinib was added for a further 72 hours. For the afatinib and osimertinib groups, adherent NCI-H1975 cells were incubated directly for 96 hours. Finally, cell viability in each group was assessed using CCK8 assay.

[0161] Cytotoxicity test of 500nM AHPC-cb-Ap pre-incubated with NCI-H1975 cells is shown in the figure. Figure 13 , among which, cytotoxicity analysis after incubation with different concentrations of Erlotinib for 72 hours after (A) 24 hours (B) 48 hours and (C) 72 hours (D) IC50 statistical graph under different treatments.

[0162] In brief, NCI-H1975 cells were pre-incubated with 500nM AHPC-cb-Ap for 24 hours, 48 ​​hours, or 72 hours, and then treated with fresh medium or fresh medium containing Erlotinib for 72 hours. As expected, since NCI-H1975 cells are insensitive to Erlotinib, their IC50 value after 72 hours of Erlotinib treatment is approximately 26.70μM. When the incubation time is extended to 144 hours, the IC50 of Erlotinib for NCI-H1975 cells only decreases slightly to about 9.84μM. However, after being pre-incubated with AHPC-cb-Ap for 24 hours and then incubated with Erlotinib for 72 hours, the IC50 dropped significantly to about 11.01μM ( Figure 13 When the AHPC-cb-Ap pre-incubation time was extended to 48 hours or 72 hours, and then treated with Erlotinib for 72 hours, the IC50 was further reduced to approximately 2.63 μM ( Figure 13 B) and 0.24 μM ( Figure 13 C).

[0163] AHPC-cb-Ap can effectively reverse the resistance of NCI-H1975 cells to erlotinib, and the effect is clearly time-dependent. The longer the preincubation time, the more significant the synergistic sensitization effect. This finding provides strong experimental evidence for combined targeted therapy strategies.

[0164] 2.6 Cell apoptosis assay

[0165] NCI-H1975 cells were cultured at 1×10 5 Cells were seeded at a density of 100 μg / well in a 12-well plate and cultured for 24 hours and then divided into the following groups: 200 nM AHPC-cb-Ap (two groups), 200 nM AHPC-cb-Ctrl (two groups), and 10 μM Erlotinib group. After 24 hours of incubation, the culture medium was removed from one group of cells in the AHPC-cb-Ap and AHPC-cb-Ctrl treatment groups and 10 μM Erlotinib was added. The cells were incubated for 72 hours, and the remaining groups were not given additional treatment. Subsequently, the cells in each group were collected and washed twice with PBS. The following procedures were performed according to the instructions: After resuspending the cells in 100 μL binding buffer, 5 μL Annexin V / AlexaFluor 647 was added and incubated at room temperature in the dark for 15 minutes. Then 10 μL PI and 400 μL PBS were added and immediately analyzed by flow cytometry.

[0166] Apoptosis analysis of NCI-H1975 cells after 500nM AHPC-cb-Ap pretreatment combined with Erlotinib is shown in the figure Figure 14 .

[0167] like Figure 14 Flow cytometry analysis of cell apoptosis showed that the AHPC-cb-Ap and AHPC-cb-Ctrl groups alone had no significant effect on apoptosis in NCI-H1975 cells, while erlotinb had a modest, but not significant, effect in promoting apoptosis. This may be due to NCI-H1975 resistance to erlotinib. Surprisingly, the combined treatment of the present invention had a significant effect on cells, causing significant apoptosis (38.7%) and cell death (22.7%). Therefore, the apoptosis experiment further demonstrated that AHPC-cb-Ap can effectively overcome the resistance of NCI-H1975 cells to erlotinib.

[0168] 2.7 Cell death and live staining experiment

[0169] NCI-H1975 cells were cultured at 1×10 5 Cells were seeded at a density of 100 cells / well in 12-well plates and cultured for 24 hours before being divided into the following treatment groups: 200nM AHPC-cb-Ap (two groups), 200nM AHPC-cb-Ctrl (two groups), and 10μM Erlotinib group. After 24 hours of incubation, the medium was removed from one group of cells in the AHPC-cb-Ap and AHPC-cb-Ctrl treatment groups, and 10μM Erlotinib was added and incubated for a further 72 hours. The remaining groups did not receive additional treatment. Subsequently, cells from each group were collected and washed twice with PBS. According to the instructions of the cell death and viability staining kit, calcein and PI were added to the cell suspension at a dilution ratio of 1:1000. After incubation at room temperature in the dark for 30 minutes, imaging analysis was performed using a Zeiss confocal laser scanning microscope.

[0170] Fluorescence staining analysis of NCI-H1975 cells after pretreatment with 500nM AHPC-cb-Ap and combined with Erlotinib is shown in Figure 15 , (Calcein-AM labels live cells, green; PI labels dead cells, red; scale bar = 50 μm)

[0171] NCI-H1975 cells treated with AHPC-cb-Ap and AHPC-cb-Ctrl alone still showed good activity, indicating that the aptamer itself had almost no obvious toxicity to the cells. NCI-H1975 cells treated with Erlotinib alone showed only a small amount of cell death, and almost no red fluorescence was observed in the field of view, suggesting that its inhibitory effect on this cell line was limited. However, after being pre-treated with AHPC-cb-Ap and then co-incubated with Erlotinib, the red fluorescence signal of NCI-H1975 cells was significantly enhanced, indicating that a large number of cells died ( Figure 15 ).

[0172] 2.8 In vivo therapeutic experiments

[0173] To verify the potential of AHPC-cb-Ap in overcoming erlotinib resistance in NCI-H1975 tumor-bearing mice, the present invention designed a "sensitization followed by treatment" experimental strategy. The specific steps are as follows: First, an NCI-H1975 tumor-bearing mouse model was established. 4- to 6-week-old BALB / c nude mice (Hunan Slake Laboratory Animal Co., Ltd.) were subcutaneously injected with 1×10 7 NCI-H1975 cells were suspended in 100 μL of DPBS. After 14 days of growth, the average volume of the tumor reached approximately 70 mm 3 , then the mice were randomly divided into six groups and started treatment. Among them, the DPBS group, Erlotinib group, AHPC-cb-Ap group and AHPC-cb-Ctrl group were injected with 200μL DPBS, Erlotinib (10mg / kg), AHPC-cb-Ap (20nmol) or AHPC-cb-Ctrl (20nmol) through the tail vein, respectively, once every two days, for a total of seven times. The combined treatment group (AHPC-cb-Ap+Erlotinib and AHPC-cb-Ctrl+Erlotinib group) first injected mice with AHPC-cb-Ap (20nmol) or AHPC-cb-Ctrl (20nmol) three times, and then injected Erlotinib (10mg / kg) four times through the tail vein every two days, for a total of seven treatments. The mice were observed for 5 days after the end of treatment. During the entire treatment period, the body weight and tumor volume of the mice were recorded every two days, and the volume was calculated according to the formula (volume=width 2 Length (cm) was calculated using a 3.5-mm (1 / 2) scale, and data were collected using an electronic balance and vernier calipers. After treatment, mice were sacrificed by cervical dislocation. The mice were dissected, and major organs and tumors were collected. Organs were fixed with paraformaldehyde for subsequent biochemical analysis.

[0174] To verify whether the combination therapy has comparable efficacy to second- and third-generation EGFR kinase inhibitors in vivo, this study designed a comparative experiment with the second-generation inhibitor Afatinib and the third-generation inhibitor Osimertinib. The specific steps are as follows: First, the NCI-H1975 tumor-bearing mouse model was established according to the aforementioned method. After the tumor volume stabilized to approximately 70 mm, 3 After that, the mice were randomly divided into four groups and started treatment. The combination treatment group still adopted the strategy of "sensitization first and then treatment"; while for the Erlotinib group, Afatinib group and Osimertinib group, the drug was injected through the tail vein, and the drug dose was 10 mg / kg, once every two days, for a total of seven times. After the end of treatment, the mice were observed for 5 days. During the entire treatment period, the weight and tumor volume of the mice were recorded every two days. The volume was calculated according to the formula (volume = width 2 The lateral length (cm) was calculated using a microscope (× length / 2), and data were collected using an electronic balance and vernier caliper. After treatment, mice were sacrificed by cervical dislocation. The mice were dissected, and major organs (including heart, liver, spleen, lungs, and kidneys) and tumors were collected. Organs were fixed with paraformaldehyde for subsequent biochemical analysis.

[0175] AHPC-cb-Ap overcomes the resistance of NCI-H1975 tumor-bearing mice to the first-generation EGFR kinase inhibitor Erlotinib (see Figure) Figure 16 ;

[0176] Comparison of the therapeutic effects of combination therapy with first-, second-, and third-generation EGFR kinase inhibitors is shown in Figure 17 .

[0177] 2.9 Tumor tissue immunoblotting

[0178] To investigate the expression of c-Met and EGFR proteins in tumor tissue, 20 mg of tumor tissue was washed three times with pre-chilled DPBS. The tissue was then mechanically homogenized in 300 μL of RIPA lysis buffer containing 1% protease inhibitors until completely dissolved. After incubation on ice for 30 minutes, the cells were centrifuged at 12,000 rpm for 15 minutes at 4°C, and the supernatant was collected for Western blot analysis.

[0179] Tumor tissue immunoblotting experiment Figure 18 (A) Changes in tumor volume (B) Changes in mouse weight (C) Tumor images of NCI-H1975 tumor-bearing mice after treatment (D) Western blot analysis of EGFR and c-Met content in tumors of NCI-H1975 tumor-bearing mice after treatment

[0180] 2.10 Immunofluorescence assay of tumor sections

[0181] Paraffin tissue sections were prepared by Changsha Aifang Biotechnology Co., Ltd. The specific steps were as follows: fresh tissue was fixed with 4% paraformaldehyde at room temperature for 24 hours, followed by dehydration with a gradient of ethanol: 75% ethanol (4 hours), 85% ethanol (2 hours), 90% ethanol (2 hours), 95% ethanol (1 hour), and absolute ethanol (2 × 30 minutes). Tissues were then cleared with ethanol-benzene (1:1, 5 minutes) and xylene (2 × 10 minutes) and embedded in paraffin (embedding machine: Wuhan Junjie JB-P5). After the paraffin solidified, blocks were trimmed and 10-μm-thick sections were cut using a Leica RM2016 microtome. Sections were flattened in a 56°C water bath (Kehua KD-P spreader) and mounted. The sections were then baked at 60°C until dry and stored at room temperature.

[0182] To visualize the content of c-Met protein in tissue sections, the present invention performed an immunofluorescence assay on tumor tissue. The specific steps are as follows: sections were dehydrated sequentially with xylene (2 x 15 minutes), anhydrous ethanol (2 x 5 minutes), and graded ethanol (85%, 75%, and 50% for 5 minutes each). After rinsing with deionized water, sections were antigen-retrieved with boiling EDTA buffer (pH 8.0) for 10 minutes. After cooling, sections were blocked with 3% bovine serum albumin (BSA) for 30 minutes. Then, c-Met antibody (1:1000, overnight at 4°C), Cy5-labeled secondary antibody (1:300, 1 hour), and DAPI (protected from light, 10 minutes) were added sequentially. Between each staining step, sections were washed three times with DPBS (5 minutes each). After staining, sections were treated with an autofluorescence quencher (Beyotime P0126) for 5 minutes, rinsed three times with DPBS, and mounted.

[0183] The immunofluorescence analysis of c-Met protein in tumors treated with different methods and the HE and TUNEL staining analysis are shown in Figure 19 .

[0184] Finally, the sections were observed using a MoticBA410E fluorescence microscope and the data were analyzed using ImageProPlus software. Figure 19 As shown, the combined treatment group showed the most significant damage to tumor tissue structure and a significant increase in the number of apoptotic cells, significantly superior to the groups treated with either drug alone. This suggests a synergistic effect between AHPC-cb-Ap and erlotinib, and their combined use more effectively induces tumor cell death. Furthermore, to assess the biosafety of this treatment strategy, the present invention performed morphological analysis of major organs (including the heart, liver, kidneys, spleen, and lungs) of mice receiving the combined treatment using HE staining.

[0185] 2.11 Tissue section pathological analysis experiment

[0186] To further investigate the expression of p-EGFR, p-AKT, or Ki67 in tumor tissues after various treatments, immunohistochemical analysis was performed. The specific experimental steps were as follows: blocked tissue sections were incubated with primary antibodies against p-EGFR, p-AKT, or Ki67 overnight at 4°C, followed by incubation with an HRP-labeled secondary antibody (Beyotime, A0208) for 1 hour. Sections were developed with DAB and rinsed with tap water to terminate the reaction. Hematoxylin counterstaining (3 minutes), hydrochloric acid-ethanol differentiation (several seconds), and bluing was then performed, with tap water rinses between each step. Following staining, sections were dehydrated and transparentized using a gradient of ethanol (75% → 85% → anhydrous ethanol, 5 minutes each; followed by a secondary treatment with anhydrous ethanol), n-butanol (5 minutes), and xylene (5 minutes).

[0187] Finally, the slides were mounted with BioMount mounting medium, images were observed using a Nikon optical microscope (E100), and data were analyzed using CaseViewer 2.4 software. Positive criteria: DAB staining (yellow-brown) indicated target protein expression, and hematoxylin (blue) marked cell nuclei.

[0188] After rehydration, tissue sections were first stained with hematoxylin for 3 minutes. After rinsing with tap water, the sections were then differentiated and bluing treated sequentially, with tap water rinses between each step. Subsequently, sections were dehydrated with 85% and 95% ethanol for 5 minutes each, and finally counterstained with eosin for 5 minutes for H&E staining. Sections were dehydrated and transparentized with anhydrous ethanol (3 × 5 minutes) and xylene (2 × 5 minutes), then mounted with neutral gum and analyzed using a 3D HISTECHPannoramic MIDI digital slide scanning system for H&E staining.

[0189] TUNEL staining analysis of tissue sections: TUNEL analysis of tissue sections was performed using a TUNEL kit (ServicebioTechnologyCo., Ltd., Cat. No.: G1501). Briefly, the recovered tumor tissue sections were placed in a flat-bottomed container, and a mixed solution of TDT enzyme, FITC-labeled dUTP, and equilibration buffer prepared in a ratio of 1:5:50 was added and incubated at 37°C for 2 hours. To prevent sample evaporation, the sections were placed in a humid environment. After incubation, the sections were rinsed three times with DPBS, and then 10 μg / mL of DAPI solution was added and incubated in the dark at room temperature for 10 minutes. After staining, the sections were rinsed with DPBS and sealed with neutral gum. Analysis of tissue sections was performed using a digital slice scanning system (PannoramicMIDI, 3DHISTECHLtd., Hungary).

[0190] Pathological analysis of tumors and major organs after treatment is shown in Figure 20 .

[0191] Immunohistochemical analysis of p-EGFR, p-AKT, and Ki67 in tumors after different treatments, as well as HE and TUNEL staining analysis are shown in Figure 21 .

[0192] Pathological analysis of tumors and major organs after treatment is shown in Figure 22 .

[0193] like Figure 20 As shown, no significant toxicity, such as necrosis, hemorrhage, or inflammatory cell infiltration, was observed in any organ tissue structure, indicating that this combination therapy effectively inhibits tumors without producing visible systemic toxic side effects, demonstrating good safety and potential for clinical translation. This result provides a solid foundation for further research into its efficacy mechanism and the expansion of its indications.

[0194] Similarly, after the second group of animal experiments were completed, the present invention dissected the mice and collected major organs and tumor tissues to further evaluate the biochemical and pathological effects of the combined treatment. First, at the molecular level, the experimental results showed that compared with Erlotinib or Afatinib alone, the combined treatment with Osimertinib significantly inhibited the activity of p-AKT in tumor tissues and significantly reduced the expression level of the cell proliferation marker Ki67 ( Figure 21 This suggests that the combined therapy effectively blocks the EGFR / AKT signaling pathway, thereby inhibiting tumor cell proliferation. Furthermore, the significant decrease in p-AKT further supports the inhibitory effect of AHPC-cb-Ap on the RTK signaling axis, indicating that the combined therapy not only enhances the efficacy of erlotinib but also achieves similar effects as osimertinib at the molecular level.

[0195] In addition, HE and TUNEL staining confirmed that combined treatment can promote tumor cell apoptosis. HE staining results showed that compared with Erlotinib and Afatinib monotherapy, the necrotic area in the tumor tissue of the Osimertinib and combined treatment groups was significantly larger and the cells were disordered, indicating that the tumor cells were more severely damaged. TUNEL staining further confirmed that Osimertinib and combined treatment significantly increased the apoptosis level of tumor cells ( Figure 21 ), while the apoptosis level of the Erlotinib bare drug group was lower, which indicates that the pretreatment of AHPC-cb-Ap effectively enhanced the apoptosis-inducing ability of Erlotinib, making its anti-tumor effect close to that of Osimertinib.

[0196] At the same time, the present invention analyzed the main organs of mice, such as heart, liver, spleen, lung, and kidney, by HE staining to evaluate the systemic safety of the treatment. The results showed that the tissue structure of the main organs of mice in all treatment groups remained intact, and no obvious inflammatory reaction, cell necrosis or tissue damage was observed, indicating that the combined treatment did not cause significant systemic toxicity ( Figure 22 This further supports the fact that AHPC-cb-Ap enhances the anti-tumor activity of erlotinib without causing additional adverse reactions, demonstrating a favorable safety profile. Furthermore, this result is consistent with weight change trends and behavioral observations, which showed no significant abnormalities, further demonstrating the well-tolerated and feasible nature of this combination therapy.

[0197] In summary, the AHPC-cb-Ap described in the present invention has excellent protein degradation ability, and provides a new solution strategy for the key problem of lung cancer resistance to EGFR inhibitors. Studies have shown that AHPC-cb-Ap can effectively target and degrade c-Met and EGFR proteins in tumor cells, thereby blocking the phosphorylation activation of EGFR and its downstream effector proteins, and significantly weakening the proliferation and survival ability of tumor cells. It is worth noting that, unlike traditional small molecule inhibitors, AHPC-cb-Ap comprehensively overcomes the drug resistance caused by EGFR mutations (such as T790M / L858R) and activation of bypass signaling pathways through a protein degradation mechanism, providing an innovative approach for the precise treatment of drug-resistant lung cancer. In addition, in vivo experiments further verified the superior anti-tumor activity of AHPC-cb-Ap. Studies have found that AHPC-cb-Ap, in combination with the first-generation EGFR inhibitor Erlotinib, can significantly inhibit EGFR T790M / L858R mutant lung cancer cells (NCI-H1975), and its anti-tumor effect was comparable to that of the third-generation EGFR inhibitor Osimertinib. This discovery not only demonstrates the potential of AHPC-cb-Ap as a sensitizer in the treatment of lung cancer, but also provides an important experimental basis for the combined treatment strategy of EGFR inhibitors and protein degraders. More importantly, the mechanism of action of AHPC-cb-Ap has a wide range of applicability and is not limited to EGFR mutant lung cancer. Its efficient protein degradation ability and deep regulation of tumor signaling pathways may be extended to the treatment of other drug-resistant tumors. In the future, combined with the optimized design of different targeted degradation molecules,

[0198] With further pharmacokinetic and safety studies, AHPC-cb-Ap is expected to develop into a new generation of precision medicine for drug-resistant cancers and further promote the clinical application of aptamer-protein degraders. In summary, this study provides a new strategy for the treatment of drug-resistant lung cancer and lays an important foundation for the application of protein degradation technology in the anti-tumor field.

[0199] The above are only preferred specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with this technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solutions and inventive concepts of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. c-Met / PD-L1-cb-Ap, characterized in that It is a circular bivalent aptamer formed by connecting the c-Met aptamer and the PD-L1 aptamer through complementary sequences.

2. The c-Met / PD-L1-cb-Ap according to claim 1, wherein The c-Met aptamer is aptamer SL1; Preferably, the PD-L1 aptamer is Mj5c.

3. The c-Met / PD-L1-cb-Ap according to claim 1 or 2, wherein The complementary sequence is a DNA sequence; More preferably, the complementary sequence has 10 to 15 bases.

4. A method for preparing c-Met / PD-L1-cb-Ap according to any one of claims 1 to 3, characterized in that: Connecting the c-Met aptamer and the PD-L1 aptamer complementary sequence to prepare the c-Met / PD-L1-cb-Ap; Preferably, sequence A with a phosphate group terminal is added to the 5' end of the c-Met aptamer to obtain c-Met aptamer-sequence A; sequence B with a phosphate group terminal is added to the 5' end of the PD-L1 aptamer to obtain PD-L1 aptamer-sequence B; wherein sequence A and sequence B are complementary, and then the c-Met aptamer-sequence A and the PD-L1 aptamer-sequence B are treated with DNA ligase, and sequence A and sequence B are complementary ligated to obtain the c-Met / PD-L1-cb-Ap.

5. A use of the c-Met / PD-L1-cb-Ap according to any one of claims 1 to 3, characterized in that: It is used to prepare drugs for targeted cancer treatment.

6. A c-Met / PD-L1-cb-Ap-PROTAC, characterized in that Including c-Met / PD-L1-cb-Ap modified with an E3 ubiquitin ligase ligand; wherein the c-Met / PD-L1-cb-Ap is the c-Met / PD-L1-cb-Ap according to any one of claims 1 to 3 or the c-Met / PD-L1-cb-Ap prepared by the preparation method according to claim 4.

7. The c-Met / PD-L1-cb-Ap-PROTAC according to claim 6, wherein The E3 ubiquitin ligase ligand includes AHPC; Preferably, the AHPC is connected to the T base of c-Met / PD-L1-cb-Ap via the following formula 1:

8. A method for preparing the c-Met / PD-L1-cb-Ap-PROTAC according to claim 6 or 7, characterized in that: Modify E3 ubiquitin ligase ligands directly on c-Met / PD-L1-cb-Ap; Alternatively, an E3 ubiquitin ligase ligand is pre-modified on at least one of the c-Met aptamer and the PD-L1 aptamer, and then ligated using complementary sequences to produce the c-Met / PD-L1-cb-Ap-PROTAC.

9. Use of the c-Met / PD-L1-cb-Ap-PROTAC according to claim 6 or 7 in the preparation of a drug for degrading tyrosine kinase; Preferably, it is used to prepare a drug for degrading EGFR and c-Met; Preferably, it is used to prepare a drug for treating cancer; Preferably, it is used to prepare a drug for treating lung cancer; Preferably, the compound is used for preparing a drug for treating EGFR inhibitor-resistant lung cancer.

10. An anticancer active ingredient, characterized in that: Comprising a pharmaceutically effective amount of the c-Met / PD-L1-cb-Ap-PROTAC according to claim 6 or 7; Preferably, it further comprises an EGFR inhibitor; Preferably, the anticancer active ingredient is an active ingredient against lung cancer; Preferably, the anti-cancer active ingredient is an active ingredient for lung cancer resistant to EGFR inhibitors.

Images