Construction method and application of Gpr174 gene conditional knockout mouse model

Abstract

The invention belongs to the technical field of animal model construction, and particularly discloses a construction method and application of a Gpr174 gene conditional knockout mouse model. The construction method comprises the following steps: S1, obtaining Cas9mRNA (Ribonucleic Acid) and guide RNA (Ribonucleic Acid) through in-vitro transcription; s2, performing flox modification on the Gpr174 gene, and constructing a homologous recombinant vector donor DNA (Deoxyribose Nucleic Acid); s3, carrying out microinjection on Cas9mRNA, gRNA and donor DNA (Deoxyribose Nucleic Acid) into a fertilized egg of the C57BL / 6J mouse, so as to obtain an F0-generation mouse; s4, the F0 generation mice and the C57BL / 6J mice are subjected to mating, and positive F1 generation mice are obtained. According to the method, the Gpr174 gene flox mouse capable of being subjected to conditional knockout is successfully constructed, the mouse is further mated with a specific Cre tool mouse to obtain a mouse with specific tissues and cells knocked out of the Gpr174 gene, and the mouse can be applied to related research of a Gpr174 functional mechanism.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a method for constructing a Gpr174 gene conditional knockout mouse model and its application. Background Art

[0002] GPR174 is a G protein-coupled receptor closely associated with immune responses and primarily expressed in lymphoid tissues and immune cells. Previous studies have suggested that GPR174 binds to its ligands, lysophosphatidylserine (LysoPS) and chemokine CC motif ligand 21 (CCL21), and influences cell proliferation and migration through specific Gα subunits. Recent studies have also suggested that GPR174 plays a crucial role in the pathogenesis of inflammatory and autoimmune diseases. Therefore, studying the mechanisms underlying Gpr174 is of great significance. The mouse Gpr174 gene is located on chromosome Chr X: 107, 256, 378-107, 295, 319 (+). Previous studies have primarily used Gpr174 knockout mice, but this technique has limited the ability to delve into the role of Gpr174 in specific tissues or cells. Summary of the Invention

[0003] To solve the above problems, the present invention constructs Gpr174 gene flox mice that can be conditionally knocked out. Further mating of the mice with specific Cre tool mice can obtain mice with Gpr174 gene knockout in specific tissues and cells, which will significantly promote research related to functional mechanisms.

[0004] In order to achieve the above object, the specific technical solutions adopted by the present invention are as follows:

[0005] In a first aspect, the present invention provides a method for constructing a Gpr174 gene conditional knockout mouse model, comprising the following steps:

[0006] S1. Obtain Cas9 mRNA and guide RNA (i.e., gRNA) by in vitro transcription; the guide RNA includes gRNA1 and gRNA2, the sequence of gRNA1 is shown in SEQ ID NO: 1, and the sequence of gRNA2 is shown in SEQ ID NO: 2;

[0007] S2. The Gpr174 gene was floxed to construct a homologous recombination vector donor DNA having a sequence as shown in SEQ ID NO: 3, wherein the vector comprises a 3.0 kb 5' homology arm, a 2.3 kb flox region, and a 3.0 kb 3' homology arm;

[0008] S3. Microinject Cas9 mRNA, gRNA, and donor DNA into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice;

[0009] S4. F0 mice that were positive for PCR amplification and sequencing were mated with C57BL / 6J mice to obtain positive F1 mice.

[0010] Furthermore, in step S2, the fifth exon of the Gpr174-203 transcript is selected as the flox region, and the flox modification is to insert LoxP sequences at both ends of the fifth exon sequence of the Gpr174 gene.

[0011] Furthermore, in step S4, the positive PCR amplification and sequencing identification includes positive identification of 5' homology arm recombination and positive identification of 3' homology arm recombination, and the PCR specific primer sequences used for positive identification of 5' homology arm recombination are shown in SEQ ID NOs: 4-5, and the PCR specific primer sequences used for positive identification of 3' homology arm recombination are shown in SEQ ID NOs: 6-7.

[0012] In a second aspect, the present invention provides a Gpr174 gene conditional knockout mouse model constructed using the above construction method.

[0013] In a third aspect, the present invention provides the use of a Gpr174 gene conditional knockout mouse model constructed using the above-mentioned construction method in the study of Gpr174-related functional mechanisms.

[0014] Furthermore, the Gpr174 gene conditional knockout mouse model was mated with specific Cre tool mice to obtain mice with Gpr174 gene knockout in specific tissues or cells, which were used as research models.

[0015] Furthermore, the research on the functional mechanism of Gpr174 includes the study on GPR174 regulating dendritic cell activation and participating in septic injury. The study used CD11c-cre mice to mate with Gpr174 gene conditional knockout mice to obtain mice with Gpr174 gene specifically knocked out in DCs cells.

[0016] In a fourth aspect, based on the finding that Gpr174 is specifically knocked out in DCs, sepsis in mice is improved, the present invention also provides the following applications:

[0017] (i) Application of a Gpr174 conditional knockout mouse model in DCs for studying the pathogenesis of sepsis or screening sepsis drugs. The Gpr174 conditional knockout mouse model is derived by mating the aforementioned Gpr174 conditional knockout mouse model with CD11c-cre mice, resulting in DCs-specific knockout of the Gpr174 gene. This mouse model improves the phenotypic characteristics of sepsis, enabling its use as an experimental or control model for sepsis drug screening and evaluation of potential therapeutic effects.

[0018] (ii) Application of the Gpr174 gene in DCs cells as a target in the preparation of products for the treatment of sepsis.

[0019] (iii) Use of a Gpr174 gene knockout reagent in DCs cells for the preparation of a product for treating sepsis.

[0020] The present invention has the following beneficial effects:

[0021] 1. This invention utilizes CRISPER / Cas9 technology to generate gene knockout flox mice. This technology uses a guide RNA designed specifically for the target gene to direct the Cas9 nuclease to modify the gene at the insertion site, increasing the efficiency of homologous recombination in the modified region of the gene, and homologously recombining the target fragment into the target site. CRISPER / Cas9 technology is mature, with a short cycle time and high efficiency.

[0022] 2. The present invention selects exon 5 of the Gpr174-203 transcript as the flox region, and the knockout region is approximately 2 kb. Because the translation of this gene starts and ends at exon 5, this region covers the entire coding region, which can effectively knock out the gene and lead to the loss of protein expression.

[0023] 3. The Gpr174 gene is located on chromosome X. This study utilizes the editing tool (CRISPR / Cas9) to specifically target the X-chromosome target site, avoiding off-target effects. Furthermore, a highly specific gRNA sequence was designed to avoid genomic repetitive sequences and pseudogene sites, overcoming the high risk of lethality associated with X-chromosome gene editing and resulting in highly stable and reproducible conditional knockout mice.

[0024] 4. The Gpr174 gene conditional knockout mouse model constructed in the present invention successfully studied the role of Gpr174 in specific cells, demonstrating that after specific knockout of Gpr174 in DCs, the prognosis of sepsis in mice was improved, intestinal damage was alleviated, and systemic inflammatory response was reduced.

[0025] 5. The Gpr174 gene conditional knockout mice constructed by the present invention have the advantages of high survival rate, stable growth and development, and high knockout success rate after mating with Cre mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : Schematic diagram of the construction principle of the Gpr174 gene conditional knockout mouse model of the present invention.

[0027] Figure 2 : The map of the homologous recombination vector donor DNA constructed in Example 1.

[0028] Figure 3 : Sequence (5'→3') of the homologous recombination vector donor DNA constructed in Example 1. The underlined sequences are the 5' homology arm and 3' homology arm sequences, respectively, and the italicized sequences are the flox sequences.

[0029] Figure 4 : Schematic diagram of the positions of the primers used in PCR amplification in Example 1.

[0030] Figure 5 : Graph showing the results of electrophoresis identification of PCR amplification products in Example 1. The left graph shows the identification results for female mice, and the right graph shows the identification results for male mice; in the graphs, WT represents wild type, HO represents homozygote, and HE represents heterozygote.

[0031] Figure 6 : Gpr174 in Example 2 flox / Y Genotyping results of mice mated with Cd11c-Cre mice. The left panel shows the Gpr174-flox genotyping results, where HO represents homozygous offspring (offspring mice) and WT represents wild-type (control). The right panel shows the Cd11c-cre genotyping results, where Transgene represents transgene-positive offspring mice and WT represents transgene-negative wild-type mice.

[0032] Figure 7 : GPR174 protein Gpr174 in Example 2 flox / Y Cd11c Cre and Gpr174 flox / Y Expression in bone marrow-derived DCs isolated and cultured from mice. The left image shows GPR174 protein expression by Western blot, and the right image shows the corresponding protein quantification results.

[0033] Figure 8 : Gpr174 gene conditional knockout mice (Gpr174 flox / Y ) and Gpr174 in DCs-specific knockout mice (Gpr174 flox / Y Cd11cCre ) Comparison of morphology, prognosis, and inflammation in two mouse models of sepsis. In the figure: (A) Schematic diagram of the experimental method; (B) Gpr174 flox / Y and Gpr174 flox / Y Cd11c Cre Representative microscopic morphological features of DCs in mesenteric lymph nodes 72 hours after sepsis modeling in mice; (C) Gpr174 flox / Y and Gpr174 flox / Y Cd11c Cre Comparison of prognosis and weight loss in septic mice; (D) HE staining and Claudin-1 immunohistochemistry detection of Gpr174 flox / Y and Gpr174 flox / Y Cd11c Cre Pathological damage characteristics of the small intestine and colon 72 hours after sepsis model in mice, including intestinal epithelial integrity, inflammatory cell infiltration, and expression of tight junction protein Claudin-1; (E) ELISA detection of Gpr174 flox / Y and Gpr174 flox / Y Cd11c Cre Peripheral blood tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and diamine oxidase (DAO) activity in mice 72 hours after sepsis modeling. * indicates P < 0.05, ** indicates P < 0.01. DETAILED DESCRIPTION

[0034] The present invention utilizes the principle of homologous recombination and adopts the method of homologous recombination of fertilized eggs to perform flox modification on the Gpr174 gene, and constructs a Gpr174 gene conditional knockout mouse model based on this. The principle of constructing this model is as follows Figure 1 As shown in the figure, the brief process is as follows: Cas9 mRNA and guide RNA are obtained by in vitro transcription; homologous recombination vectors are constructed by in-fusion cloning technology; Cas9 mRNA, gRNA and homologous recombination vectors are microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice; F0 generation mice are mated with C57BL / 6J mice to obtain positive F1 generation mice.

[0035] After obtaining mice with conditional knockout of Gpr174 through the present invention, they can be mated with specific Cre tool mice to obtain tissue- or cell-specific knockout mouse models. In a study investigating the role of GPR174 in regulating dendritic cell (DC) activation and its involvement in sepsis-induced intestinal damage, mice with Gpr174-specific knockout in DCs were obtained by mating CD11c-cre mice with Gpr174-specific knockout mice. This study found that mice with Gpr174-specific knockout in DCs had improved sepsis prognosis, alleviated intestinal damage, and reduced systemic inflammatory response.

[0036] The present invention will be further described below with reference to the accompanying drawings and specific examples. In the following examples, the reagents involved are all commercially available conventional reagents unless otherwise specified, and the experimental operations involved are all conventional operations in the art unless otherwise specified.

[0037] Example 1: Construction of Gpr174 gene conditional knockout mouse model

[0038] The target gene information in this example is as follows:

[0039] Target gene name (Ensembl number): Gpr174 (ENSMUSG00000073008); transcript targeted by the protocol (Ensembl number): Gpr174-203 (ENSMUST00000118820.7); exon region targeted by flox: exon 5.

[0040] This example provides a specific method for constructing a Gpr174 gene conditional knockout mouse model, and the specific process is as follows:

[0041] 1. Design the gRNA target sequence for the target genome and perform in vitro transcription based on the sequence to obtain the gRNA for the gene; the gRNA sequence is shown in the following table:

[0042] gRNAs Sequence(5'-3') gRNA1 TGAGAACATCACAGAGCTGTGGG (SEQ ID NO: 1) gRNA2 TTGCTGAATCTATGTTCAAAAGG (SEQ ID NO: 2)

[0043] 2. Construct the donor DNA recombinant plasmid for target fragment recombination (plasmid map as shown in Figure 2 As shown), the vector contains a 3.0 kb 5' homology arm, a 2.3 kb flox region and a 3.0 kb 3' homology arm (the sequence of the donor DNA is SEQ ID NO: 3, as shown). Figure 3The underlined sequences are the 5' homology arm and 3' homology arm sequences, respectively, and the italicized sequences are the flox sequences. The basic backbone of this vector is pBR322. The 5' homology arm sequence, flox region sequence, and 3' homology arm sequence are all amplified from the C57BL / 6 mouse genome. pBR322, the 5' homology arm sequence, flox region sequence, and 3' homology arm sequence are recombined into a complete plasmid using in-fusion recombination and ligation technology.

[0044] 3. Inject the in vitro-transcribed gRNA, Cas9 mRNA, and donor DNA recombinant plasmid into fertilized eggs (zygotes). The injected zygotes were then transplanted into pseudopregnant female mice to generate F0 mice. The Cas9 mRNA was derived from Streptococcus pyogenes, and the sequence (eSpCas9 1.0) was obtained from the literature (doi:10.1126 / science.aad5227).

[0045] 4. The genotype of the obtained F0 generation mice was identified by PCR and sequencing: a 5.9 kb fragment should be amplified from the 5' arm homologous recombination-positive genome, and a 9.0 kb fragment should be amplified from the negative genome; a 6.1 kb fragment should be amplified from the 3' arm homologous recombination-positive genome, and a 9.5 kb fragment should be amplified from the negative genome.

[0046] The following primers, reaction system, and reaction conditions were used for PCR identification of F0 generation mice with positive 5' homology arm recombination:

[0047] Primers:

[0048]

[0049]

[0050] Reaction system:

[0051]

[0052] Reaction conditions:

[0053] step Temperature (℃) time Remark 1 94 3min 2 98 15sec 3 61 15sec 4 68 4min Repeat steps 2-4 35 times 5 68 5min 6 12 Hold

[0054] The following primers were used for PCR identification of F0 generation mice that were positive for 3' homology arm recombination. The reaction system and conditions were the same as those for PCR identification of F0 generation mice that were positive for 5' homology arm recombination.

[0055] Primers:

[0056] Primer Sequence(5'-3') Forward CCTTGAGTGTTGCAGGGATGT (SEQ ID NO: 6) Reverse TCGAAGCATGAGGCAGGTTA (SEQ ID NO: 7)

[0057] 5. Due to the rapid cleavage rate of early fertilized eggs, F0 generation mice are chimeric and may not have stable genetic inheritance. Therefore, further subculture is required to obtain stable F1 generation mice. Therefore, F0 generation mice identified as positive for 5' homology arm recombination and 3' homology arm recombination were mated with wild-type C57BL / 6 mice to obtain F1 generation mice.

[0058] 6. Identify the genotype of F1 generation mice by PCR and electrophoresis. The principle of flox mouse genotype identification based on the Cas9 strategy is: after the loxp site is inserted, the wild type and mutant PCR identification are performed, and the different genotypes are distinguished by the different sizes of the PCR product fragments. The specific primer sequences, reaction system and reaction conditions used for PCR identification of conditional knockout mice are shown in the following table, and the primer positions are shown in the following table. Figure 4 shown.

[0059] Primer Sequence(5'-3') Forward GGTGACATGTCCATGCGGT (SEQ ID NO: 8) Reverse AGTTTTGCCCACCCACTTT (SEQ ID NO: 9)

[0060] Reaction system:

[0061]

[0062] Reaction conditions:

[0063]

[0064] The PCR amplification was tested and identified by electrophoresis. The identification results were as follows: Figure 5 As shown, wild type: a band of 284 bp is visible; heterozygote: a band of 284 and 348 bp is visible; homozygote: a band of 348 bp is visible. Since the Gpr174 gene is located on the X chromosome, the genotype of the female Gpr174 conditional knockout mice obtained in the present invention may be homozygous (HO, Gpr174 flox / flox ) or heterozygotes (HE, Gpr174 flox / + ), and the genotypes of the male mice obtained were all homozygous (HO, Gpr174 flox / Y ).according to Figure 5 The identification results shown indicate that the Gpr174 gene conditional knockout mouse model was successfully constructed.

[0065] Example 2: Application of Gpr174 gene conditional knockout mouse model

[0066] To clarify whether dendritic cells (DCs) affect sepsis-induced intestinal damage through GPR174, mice with conditional knockout of Gpr174 gene function (i.e., mice obtained in Example 1, Gpr174 flox / flox(Y) ) to conduct research. Gpr174 flox / flox(Y)Mice with DCs-specific Gpr174 gene knockout were obtained by mating mice with Cd11c-Cre tool mice. Since the Gpr174 gene is located on the X chromosome, considering the instability factors such as X chromosome inactivation, male mice (i.e., Gpr174 flox / Y ) to conduct research more stably. Figure 6 The results of tail genomic DNA identification of offspring mice obtained by mating two types of mice are shown. The Gpr174-flox genotype of the offspring mice was identified as homozygous (HO), and the Cd11c-cre genotype was identified as positive, which shows that Gpr174 is expressed in DCs-specific knockout mice (Gpr174 flox / Y Cd11c Cre ) was built successfully. Figure 7 It shows that GPR174 protein flox / Y and Gpr174 flox / Y Cd11c Cre Western blot analysis of GPR174 expression on mouse bone marrow-derived DCs showed that GPR174 flox / Y Cd11c Cre The gene was not expressed on mouse bone marrow-derived DCs, confirming the high efficiency of gene knockout at the protein level.

[0067] On this basis, Gpr174 was selected flox / Y Cd11c Cre As experimental mice, Gpr174 flox / Y Mice were used as controls for the study. Figure 8 As shown in A, the cecal ligation and puncture method (CLP) was first used to irradiate Gpr174 flox / Y and Gpr174 flox / Y Cd11c Cre Mice were induced to develop sepsis, and the survival rates and weight changes of the two groups of mice were observed. At the same time, samples were collected from some of the mice 72 hours after modeling to compare the mature morphology of mesenteric DCs, pathological damage of the intestinal mucosa, and the activities of tumor necrosis factor-α, interleukin-6, and diamine oxidase in peripheral blood. The results are as follows:

[0068] Gpr174 administration flox / Y and Gpr174 flox / Y Cd11c Cre Mice were induced with sepsis, and DCs from mesenteric lymph nodes were isolated 72 hours later. Gpr174 was observed under the microscope. flox / Y Mouse-derived DCs are more mature than Gpr174 flox / Y Cd11c Cre The mouse-derived low-dendritic protrusions are visually manifested as a decrease in dendritic processes ( Figure 8B). At the same time, Gpr174 flox / Y Cd11c Cre The survival rate of septic mice was higher than that of WT mice after 7-day follow-up. The weight loss of mice caused by sepsis was significantly increased in Gpr174 flox / Y Cd11c Cre This result suggests that GPR174-specific deletion in DCs improves the prognosis of septic mice ( Figure 8 C).

[0069] By taking small intestine (selecting the terminal ileum) and colon tissues for HE staining and Claudin-1 immunohistochemistry, the study found that 72 hours after giving mice sepsis model, the ileum and colon tissues showed pathological changes such as destruction of mucosal barrier structure, massive infiltration of inflammatory cells, and decreased expression of tight junction protein Claudin-1. flox / Y Cd11c Cre Pathological damage in the ileum and colon of septic mice was more pronounced than that in Gpr174 flox / Y Relative remission in mice ( Figure 8 D).

[0070] The peripheral blood of mice was collected 72 hours after sepsis modeling to measure inflammatory mediators. The results showed that Gpr174 flox / Y Cd11c Cre The levels of TNF-α and IL-6 in peripheral blood of mice were higher than those of Gpr174 flox / Y The level of DAO in mice decreased significantly, reflecting the reduction of systemic inflammatory response. DAO is an intracellular enzyme in the small intestinal mucosal cells of mammals. When the small intestinal mucosal barrier function is damaged, serum DAO activity may increase, which has certain significance for monitoring intestinal mucosal damage in sepsis. flox / Y Cd11c Cre The DAO activity in the peripheral blood of mice was also higher than that in Gpr174 flox / Y mice decreased, suggesting that intestinal damage was alleviated ( Figure 8 E).

[0071] This specific implementation is merely an explanation of the present invention and is not a limitation of the present invention. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A method for constructing a Gpr174 gene conditional knockout mouse model, characterized in that: The following steps are involved: S1. Obtain Cas9 mRNA and guide RNA by in vitro transcription; the guide RNA includes gRNA1 and gRNA2, the sequence of gRNA1 is shown in SEQ ID NO: 1, and the sequence of gRNA2 is shown in SEQ ID NO: 2; S2. The Gpr174 gene is floxed to construct a homologous recombination vector donorDNA having a sequence as shown in SEQ ID NO: 3, wherein the vector comprises a 5' homology arm, a flox region, and a 3' homology arm; S3. Microinject Cas9 mRNA, gRNA, and donor DNA into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice; S4. F0 mice that were positive for PCR amplification and sequencing were mated with C57BL / 6J mice to obtain positive F1 mice.

2. The method for constructing a Gpr174 gene conditional knockout mouse model according to claim 1, characterized in that: In step S2, the fifth exon of the Gpr174-203 transcript is selected as the flox region, and the flox modification is to insert LoxP sequences at both ends of the fifth exon sequence of the Gpr174 gene.

3. The method for constructing a Gpr174 gene conditional knockout mouse model according to claim 1, characterized in that: In step S4, the positive PCR amplification and sequencing identification includes positive identification of 5' homology arm recombination and positive identification of 3' homology arm recombination. The PCR specific primer sequences used for positive identification of 5' homology arm recombination are shown in SEQ ID NOs: 4-5, and the PCR specific primer sequences used for positive identification of 3' homology arm recombination are shown in SEQ ID NOs: 6-7.

4. A Gpr174 gene conditional knockout mouse model constructed using the construction method according to any one of claims 1 to 3.

5. Use of the Gpr174 gene conditional knockout mouse model according to claim 4 in the study of Gpr174 gene-related functional mechanisms.

6. The use according to claim 5, characterized in that The application method is: mating a Gpr174 gene conditional knockout mouse model with a specific Cre tool mouse to obtain mice with Gpr174 gene knockout in specific tissues or cells as a research model.

7. The use according to claim 6, characterized in that The research on the functional mechanism of Gpr174 includes the study on GPR174 regulating dendritic cell activation and participating in septic injury. The study used CD11c-cre mice to mate with Gpr174 gene conditional knockout mice to obtain mice with Gpr174 gene specifically knocked out in DCs cells.

8. The use according to claim 7, characterized in that Mice in which the Gpr174 gene was specifically knocked out in DCs cells showed improved sepsis prognosis, alleviated intestinal damage, and reduced systemic inflammatory response.

9. Application of a DCs cell Gpr174 gene conditional knockout mouse model in the study of the pathological mechanism of sepsis or sepsis drug screening, characterized in that the DCs cell Gpr174 gene conditional knockout mouse model is a mouse in which the Gpr174 gene is specifically knocked out in DCs cells obtained by mating the Gpr174 gene conditional knockout mouse model according to claim 4 with CD11c-cre mice.

Images