Campylobacter jejuni and salmonella dual RPA-LFD detection method and application thereof

By combining recombinase polymerase amplification with lateral flow test strip technology, specific primers and probes were designed to solve the problem of rapid and simple detection of Campylobacter jejuni and Salmonella, achieve efficient dual detection, and support early diagnosis and prevention of the disease.

CN120666053APending Publication Date: 2025-09-19GUIZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510823783.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to detect Campylobacter jejuni and Salmonella simultaneously, quickly, easily, and with high specificity, resulting in delayed clinical diagnosis and mass animal infections, and a lack of support for precise diagnosis, treatment, and epidemic tracing.

Method used

Recombinase polymerase amplification (RPA) combined with lateral flow cytometry (LFD) technology was used to design Campylobacter jejuni and Salmonella specific primers and probes, and a dual RPA-LFD detection method was established. Rapid detection was achieved by combining biotin- and carboxyfluorescein-labeled amplification products with colloidal gold-labeled antibodies.

Benefits of technology

It has achieved rapid, simple and specific detection of Campylobacter jejuni and Salmonella, supported the early diagnosis and prevention of foodborne diseases, and improved detection efficiency and food hygiene monitoring capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005457454400000091
    Figure BDA0005457454400000091
  • Figure BDA0005457454400000092
    Figure BDA0005457454400000092
  • Figure BDA0005457454400000093
    Figure BDA0005457454400000093
Patent Text Reader

Abstract

The invention relates to the field of microbiological detection, in particular to a campylobacter jejuni and salmonella dual RPA-LFD detection method and application thereof. The invention designs a primer pair and a probe aiming at campylobacter jejuni and salmonella, and provides a kit for detecting the campylobacter jejuni and the salmonella and a dual RPA-LFD detection method for the campylobacter jejuni and the salmonella based on the primer pair and the probe. The method has the advantages of being convenient to operate, high in specificity and high in sensitivity, and instrument-dependence-free instant detection of campylobacter jejuni and salmonella can be achieved. The invention not only has important significance on early-stage rapid diagnosis and prevention and control of campylobacter jejuni and salmonella, but also can provide efficient technical support for food-borne disease outbreak investigation and animal-borne food hygiene detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microbial detection, and in particular to a dual RPA-LFD detection method for Campylobacter jejuni and Salmonella and an application thereof. Background Art

[0002] Campylobacter jejuni (C. jejuni) is a foodborne zoonosis pathogen, responsible for approximately 96 million cases of C. jejuni infection worldwide each year. The bacterium can cause acute diarrhea, abdominal pain, and fever in livestock. After infecting poultry or other animals, it colonizes the intestines and can infect humans through animals or animal products. In most regions of China, diseases caused by C. jejuni have not received sufficient attention. Currently, clinical medical institutions generally lack the capacity to detect C. jejuni, and routine bacterial culture programs for diarrheal patients are still primarily limited to screening for Salmonella and Shigella.

[0003] Salmonella is one of the most common zoonotic pathogens worldwide, infecting approximately 93.8 million people annually and totaling over 1.3 billion cases. The bacterium has numerous hosts, including humans, chickens, ducks, cattle, and sheep, primarily parasitizing the intestines of humans and animals, with an incubation period typically lasting 12-72 hours. Symptoms of infection are similar to those of Campylobacter jejuni, including diarrhea, abdominal pain, and nausea. Due to the highly similar initial symptoms of infection, the two infections can be difficult to distinguish clinically.

[0004] Current clinical diagnosis still relies on traditional culture methods or single molecule detection (such as PCR, real-time fluorescence quantitative PCR), which has defects such as lengthy cycles, complex operations, and inability to identify co-infections, seriously delaying the process of accurate diagnosis and treatment and epidemic tracing. In addition, in the aquaculture industry, the hidden spread of pathogens often causes mass infection of animals, leading to economic losses, increased abuse of antibiotics, and the spread of drug resistance, further increasing the cost of public health prevention and control. Therefore, it is crucial to build a detection method that can meet the needs of different scenarios, achieve accurate analysis or rapid on-site screening, and has both high sensitivity and strong specificity to improve the diagnostic efficiency and prevention and control capabilities of foodborne diseases.

[0005] Recombinase polymerase amplification (RPA) technology was developed by Piepenburg et al. in 2006 and has been widely used for bacteria, viruses, mycoplasmas, parasites, and other organisms. Lateral flow dipstick (LFD) technology is an immunochromatographic-based detection method. The principle of RPA-LFD is that in the RPA reaction, the biotin-labeled amplification product first binds to a carboxyfluorescein (FAM)-labeled probe to form a dual-labeled complex. This complex then specifically binds to a colloidal gold-labeled FAM antibody, resulting in color development and interpretation on the LFD within 5-10 minutes.

[0006] Based on this, the present invention designed RPA primers and probes based on the hipO gene of Campylobacter jejuni and the ttrRSBCA gene of Salmonella, and established a dual RPA-LFD detection method for Campylobacter jejuni and Salmonella, aiming to achieve rapid, simple and specific detection of Campylobacter jejuni and Salmonella, providing technical support for foodborne disease outbreak investigations and animal-derived food hygiene monitoring. Summary of the Invention

[0007] The purpose of the present invention is to provide a dual RPA-LFD detection method for Campylobacter jejuni and Salmonella and its application.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] The kit for detecting Campylobacter jejuni and Salmonella of the present invention comprises: an upstream primer hipO-RPA-F, a downstream primer hipO-RPA-MR, and a probe hipO-RPA-P for detecting Campylobacter jejuni; an upstream primer ttrRSBCA-RPA-F, a downstream primer ttrRSBCA-RPA-R, and a probe ttrRSBCA-RPA-P for detecting Salmonella;

[0010] The upstream primer hipO-RPA-F sequence is shown in SEQ ID NO.5;

[0011] The 5' end of the downstream primer hipO-RPA-MR is labeled with biotin, and the sequence is shown in SEQ ID NO.6;

[0012] The probe hipO-RPA-P is modified with carboxyfluorescein at the 5' end and a DNA polymerase blocking group at the 3' end, and THF is added between the 5' and 3' ends. Its sequence is shown in SEQ ID NO. 7;

[0013] The upstream primer ttrRSBCA-RPA-F sequence is shown in SEQ ID NO.8;

[0014] The 5' end of the downstream primer ttrRSBCA-RPA-R is labeled with digoxigenin, and the sequence is shown in SEQ ID NO.9;

[0015] The 5' end of the probe ttrRSBCA-RPA-P is modified with carboxyfluorescein, the 3' end is modified with a DNA polymerase blocking group, and THF is added between the 5' and 3' ends. The sequence is shown in SEQ ID NO.10.

[0016] Preferably, the kit for detecting Campylobacter jejuni and Salmonella of the present invention further comprises ddH2O, Abuffer, B buffer, RPA lyophilized powder and nucleic acid detection test strips.

[0017] The specific steps of the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella of the present invention are as follows:

[0018] S1, extracting DNA from the sample to be tested;

[0019] S2. Using the DNA extracted in step S1 as a template, the kit according to claim 1 or 2 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip;

[0020] S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the quality control line and the test line, the result is positive. If a band appears on the quality control line but not on the test line, the result is negative.

[0021] Preferably, in the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella described in the present invention, the reaction system of the dual RPA-LFD reaction described in step S2 is: Abuffer 29.4 μL; 0.4-0.8 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.2-1.6 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; DNA template 2.0 μL; ddH2O 11.5 μL; B buffer 2.5 μL; 1 tube of RPA lyophilized powder; 1 Milenia HybriDetect strip.

[0022] Further preferably, in the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella described in the present invention, in the reaction system of the dual RPA-LFD reaction described in step S2: the added amount of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L is 0.8 μL each; the added amount of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L is 1.2 μL each.

[0023] Preferably, in the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella of the present invention, the reaction temperature of the dual RPA-LFD reaction in step S2 is 30°C to 39°C.

[0024] Further preferably, in the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella of the present invention, the reaction temperature of the dual RPA-LFD reaction in step S2 is 37°C.

[0025] Preferably, in the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella of the present invention, the reaction time of the dual RPA-LFD reaction in step S2 is 9 to 15 minutes.

[0026] Further preferably, in the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella of the present invention, the reaction time of the dual RPA-LFD reaction in step S2 is 15 min.

[0027] The application of the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella of the present invention in the detection of Campylobacter jejuni and Salmonella in intestinal contents of animals or humans and in food does not include the diagnosis and treatment of diseases.

[0028] Beneficial effects of the present invention:

[0029] 1. The present invention provides a dual RPA-LFD detection method for simultaneous and rapid detection of Campylobacter jejuni and Salmonella. This method has the advantages of convenient operation, strong specificity, and high sensitivity. It can realize the instant detection of Campylobacter jejuni and Salmonella without relying on instruments. It is of great significance for the early rapid diagnosis and prevention and control of Campylobacter jejuni and Salmonella. At the same time, it provides efficient technical support for foodborne disease outbreak investigations and animal-derived food hygiene testing.

[0030] 2. The present invention optimizes the reaction system of the dual RPA-LFD detection method and gives the optimal parameters of the dual RPA-LFD reaction system as follows: the addition amount of the upstream and downstream primers (concentration of 10 μmol / L) for detecting Campylobacter vacuolaris is 0.8 μL respectively; the addition amount of the upstream and downstream primers (concentration of 10 μmol / L) for detecting Salmonella is 1.2 μL respectively; the optimal reaction temperature of the dual RPA-LFD reaction is 37°C, and the optimal reaction time is 15 min. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results of PCR identification of recombinant plasmids are shown in the figure (A is the PCR identification result of pMD19-T-hipO recombinant plasmid; B is the PCR identification result of pMD19-T-ttrRSBCA recombinant plasmid; M is DL 2000plus DNA Marker, 1 to 5 are pMD19-T-hipO recombinant plasmid and pMD19-T-ttrRSBCA recombinant plasmid, respectively, and N is the negative control);

[0032] Figure 2 Optimization results of the addition amount of dual RPA-LFD primers (in the figure: the addition amounts of hipO-RPA-F / MR and ttrRSBCA-RPA-F / R in 1 to 4 are 1 μL, 1 μL; 0.8 μL, 1.2 μL; 0.6 μL, 1.4 μL; 0.4 μL, 1.6 μL, respectively);

[0033] Figure 3 This is the negative result of the double RPA-LFD test (in the figure: the added amounts of hipO-RPA-F / R and ttrRSBCA-RPA-F / R in 1 to 3 are 0.8 μL and 1.2 μL respectively);

[0034] Figure 4 The results of dual RPA-LFD reaction temperature optimization (in the figure: T1 is the detection line for Salmonella; T2 is the detection line for Campylobacter jejuni; 1 is the negative control; 2 to 7 correspond to the detection results at reaction temperatures of 25°C, 30°C, 33°C, 35°C, 37°C, and 39°C, respectively);

[0035] Figure 5 The results of dual RPA-LFD reaction time optimization are shown in the figure (in the figure: T1 is the detection line for Salmonella; T2 is the detection line for Campylobacter jejuni; 1 is the negative control; 2 to 7 correspond to the detection results when the reaction time is 5 minutes, 7 minutes, 9 minutes, 11 minutes, 13 minutes, and 15 minutes, respectively);

[0036] Figure 6The specificity results of the dual RPA-LFD reaction are shown in the figure (in the figure: 1 to 7 correspond to Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Pasteurella multocida, Bacillus cereus, Proteus mirabilis, and Staphylococcus aureus, respectively; 8 is the negative control; 9 is Salmonella typhimurium and Campylobacter jejuni);

[0037] Figure 7 The sensitivity results of the dual RPA-LFD reaction (in the figure: 1 is the negative control; 2 to 9 correspond to the concentration of 10 6 -10 0 copies / μL of mixed plasmid standards);

[0038] Figure 8 The repeatability results of the double RPA-LFD reaction (in the figure: A, B, C are the test results of repeat 1, repeat 2, and repeat 3 respectively; among them: T1 is the detection line of Salmonella, T2 is the detection line of Campylobacter jejuni, 1 to 4 correspond to the concentration of 10 7 -10 4 copies / μL of mixed plasmid standard, and 5 as negative control). DETAILED DESCRIPTION

[0039] The following is a detailed description of the technical solution of the present invention in conjunction with specific embodiments. The following embodiments are only for explanation and illustration, and do not constitute a limitation of the technical solution of the present invention.

[0040] Example 1

[0041] The kit for detecting Campylobacter jejuni and Salmonella consists of:

[0042] Upstream primer hipO-RPA-F, downstream primer hipO-RPA-MR, and probe hipO-RPA-P for detecting Campylobacter jejuni; upstream primer ttrRSBCA-RPA-F, downstream primer ttrRSBCA-RPA-R, and probe ttrRSBCA-RPA-P for detecting Salmonella; ddH2O, A buffer, B buffer, RPA lyophilized powder, and nucleic acid test strips;

[0043] Among them: the sequence of the upstream primer hipO-RPA-F is shown in SEQ ID NO.5; the 5' end of the downstream primer hipO-RPA-MR is labeled with biotin, and the sequence is shown in SEQ ID NO.6; the 5' end of the probe hipO-RPA-P is modified with carboxyfluorescein, the 3' end is modified with a DNA polymerase blocking group, and THF is added between the 5' and 3' ends, and its sequence is shown in SEQ ID NO.7; the sequence of the upstream primer ttrRSBCA-RPA-F is shown in SEQ ID NO.8; the 5' end of the downstream primer ttrRSBCA-RPA-R is modified with digoxigenin, and the sequence is shown in SEQ ID NO.9; the 5' end of the probe ttrRSBCA-RPA-P is modified with carboxyfluorescein, the 3' end is modified with a DNA polymerase blocking group, and THF is added between the 5' and 3' ends, and its sequence is shown in SEQ ID NO.10.

[0044] Example 2

[0045] The dual RPA-LFD detection method for Campylobacter jejuni and Salmonella is as follows:

[0046] S1, extracting DNA from the sample to be tested;

[0047] S2. Using the DNA extracted in step S1 as a template, the kit described in Example 1 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip;

[0048] S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the quality control line and the test line, the result is positive. If a band appears on the quality control line but not on the test line, the result is negative.

[0049] The reaction temperature of the dual RPA-LFD reaction in step S2 is 37°C, the reaction time is 15 min, and the reaction system is: 29.4 μL of A buffer; 0.8 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.2 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; 2.0 μL of DNA template; 11.5 μL of ddH2O; 2.5 μL of B buffer; 1 tube of RPA lyophilized powder; and 1 Milenia HybriDetect strip.

[0050] Example 3

[0051] The dual RPA-LFD detection method for Campylobacter jejuni and Salmonella is as follows:

[0052] S1, extracting DNA from the sample to be tested;

[0053] S2. Using the DNA extracted in step S1 as a template, the kit described in Example 1 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip;

[0054] S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the quality control line and the test line, the result is positive. If a band appears on the quality control line but not on the test line, the result is negative.

[0055] The reaction temperature of the dual RPA-LFD reaction in step S2 is 39°C, the reaction time is 13 min, and the reaction system is: 29.4 μL of Abuffer; 0.8 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.2 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; 2.0 μL of DNA template; 11.5 μL of ddH2O; 2.5 μL of B buffer; 1 tube of RPA lyophilized powder; and 1 Milenia HybriDetect strip.

[0056] Example 4

[0057] The dual RPA-LFD detection method for Campylobacter jejuni and Salmonella is as follows:

[0058] S1, extracting DNA from the sample to be tested;

[0059] S2. Using the DNA extracted in step S1 as a template, the kit described in Example 1 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip;

[0060] S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the quality control line and the test line, the result is positive. If a band appears on the quality control line but not on the test line, the result is negative.

[0061] The reaction temperature of the dual RPA-LFD reaction in step S2 is 30°C, the reaction time is 9 min, and the reaction system is: 29.4 μL of Abuffer; 0.8 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.2 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; 2.0 μL of DNA template; 11.5 μL of ddH2O; 2.5 μL of B buffer; 1 tube of RPA lyophilized powder; and 1 Milenia HybriDetect strip.

[0062] Example 5

[0063] The dual RPA-LFD detection method for Campylobacter jejuni and Salmonella is as follows:

[0064] S1, extracting DNA from the sample to be tested;

[0065] S2. Using the DNA extracted in step S1 as a template, the kit described in Example 1 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip;

[0066] S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the quality control line and the test line, the result is positive. If a band appears on the quality control line but not on the test line, the result is negative.

[0067] The reaction temperature of the dual RPA-LFD reaction in step S2 is 37°C, the reaction time is 15 min, and the reaction system is: 29.4 μL of Abuffer; 0.6 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.4 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; 2.0 μL of DNA template; 11.5 μL of ddH2O; 2.5 μL of B buffer; 1 tube of RPA lyophilized powder; and 1 Milenia HybriDetect strip.

[0068] Example 6

[0069] The dual RPA-LFD detection method for Campylobacter jejuni and Salmonella is as follows:

[0070] S1, extracting DNA from the sample to be tested;

[0071] S2. Using the DNA extracted in step S1 as a template, the kit described in Example 1 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip;

[0072] S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the quality control line and the test line, the result is positive. If a band appears on the quality control line but not on the test line, the result is negative.

[0073] The reaction temperature of the dual RPA-LFD reaction in step S2 is 37°C, the reaction time is 15 min, and the reaction system is: 29.4 μL of A buffer; 0.4 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.6 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; 2.0 μL of DNA template; 11.5 μL of ddH2O; 2.5 μL of B buffer; 1 tube of RPA lyophilized powder; and 1 Milenia HybriDetect strip.

[0074] In order to further verify the reliability of the present invention and screen out the best solution, the inventors conducted a series of experiments, as follows: 1. Materials and methods

[0075] 1.1 Main strains

[0076] The test strains Campylobacter jejuni standard strain ATCC (33291) were purchased from ATCC, USA; Salmonella Typhimurium wild type MA 3409, Proteus mirabilis, Pseudomonas, Escherichia coli, Pasteurella multocida, Bacillus cereus, Klebsiella pneumoniae, Staphylococcus aureus, Salmonella Enteritis, Salmonella paratyphi B, Salmonella Pullorum, and Salmonella enterica serotype Dublin were all isolated and preserved by the laboratory of the Institute of Animal Diseases, Guizhou University.

[0077] 1.2 Main Reagents

[0078] 2×Taq PCR Master Mix and DL 2000Plus DNA Marker were purchased from VazymE; pMD19-T vector was purchased from TaKaRa; plasmid miniprep kit was purchased from Thermo Scientific; bacterial genomic DNA extraction kit (DP302-02) was purchased from Tiangen Biotechnology; WLN8203KIT DNA isothermal rapid amplification-colloidal gold lateral flow chromatography detection system was purchased from Anpu Future Biotechnology Co., Ltd. (Weifang, China); Milenia HybriDetect (Milenia Biotec-MGHD 2) was purchased from the United Kingdom. company.

[0079] 1.3 Construction of recombinant plasmid

[0080] Specific primers were designed based on the conserved regions of the Campylobacter jejuni hipO gene and the Salmonella ttrRSBCA gene. After PCR amplification, the target product was recovered, ligated with pMD19-T, and transformed into LB solid medium containing Amp. A single colony was picked and inoculated into LB liquid medium containing Amp. The plasmid was extracted and sent to Sangon for sequencing. The specific steps are as follows:

[0081] (1) The recovered single colony was transferred to an eppendorf tube containing 40 μL TE Buffer. After reacting at 95°C for 15 min, the hipO gene and ttrRSBCA gene amplification templates were obtained and PCR amplification was performed. The amplification primer sequences are shown in Table 1.

[0082] The hipO gene sequence is as follows:

[0083] CCCATATGAATTTAATTCCAGAAATACTAGACTTACAAGGCGAATTTGAAA

[0084] AAATTCGTCATCAAATTCATGAAAATCCTGAGCTTGGTTTTGATGAATTAT

[0085] GTACTGCAAAATTAGTGGCGCAAAAATTAAAAGAATTTGGTTATGAGGTT

[0086] TATGAGGAAATAGGAAAAACAGGCGTTGTGGGGGTTTTAAAAAAGGGAA

[0087] ATAGCGATAAAAAAATAGGACTTCGTGCAGATATGGATGCTTTGCCTTTAC

[0088] AAAGAATGCACAAATTTGCCTTATAAAAGCAAAAAAGAAAATGTAATGCAT

[0089] GCTTGTGGTCATGATGGACATACTACTTCTTTATTGCTTGCTGCAAAATATT

[0090] TAGCAAGTCAGAATTTTAATGGCGCTCTAAATCTTTATTTTCAACCTGCTG

[0091] AAGAGGGTTTGGGTGGTGCTAAGGCAATGATAGAAGATGGATTGTTTGAA

[0092] AAATTTGATAGTGATTATGTTTTTGGATGGCACAATATGCCTTTTGGTAGC

[0093] GATAAGAAATTTTATCTTAAAAAAGGTGCGATGATGGCTTCTTCGGATAGT

[0094] TATAGTATTGAAGTTATTGGAAGGGGTGGTCATGGAAGTGCTCCAGAAAA

[0095] GGCAAAAGATCCTATTTATGCTGCTTCTTTGCTTATTGTGGCTTTACAAAGC

[0096] ATAGTATCTCGTAATGTTGATCCTCAAAATTCAGCAGTTGTAAGCATAGGA

[0097] GCTTTTAATGCAGGACATGCTTTTAATATCATTCCAGATATTGCAACGATT

[0098] AAAATGAGTGTTAGAGCATTAGATAATGAAACTAGAAAGCTAACTGAAGA

[0099] AAAAATTTATAAAATTTGTAAAGGTATTGCGCAGGCTAATGATATAGAGA

[0100] TTAAAATCAATAAAAATGTTGTTGCACCAGTGACTATGAATAACGATGAA

[0101] GCTGTGGATTTTGCTAGTGAGGTTGCAAAAGAATTATTTGGCGAAAAAAA

[0102] TTGTGAATTTAATCATCGTCCTTTAATGGCAAGTGAGGATTTTGGATTTTTT

[0103] TGCGAAATGAAAAAATGTGCCTATGCTTTTTTAGAAAATGAAAACGACAT

[0104] TTATTTACATAATTCTAGTTATGTTTTTAATGATAAGCTTTTAGCTAGGGCT

[0105] GCAAGTTATTATGCGAAGCTAGCTTTAAAATACTTAAAATAATCTAGAGC

[0106] The ttrRSBCA gene sequence is as follows:

[0107] TCCGTCAGTGGATTACCGTCGCCCTGTCAGCCAAATATTACGCTGTCGGCT

[0108] GGGTAGCGCTGTGGGTATGCACACTGCTGTTCTGTAGCCTGGCGCTACGCC

[0109] ATCCGTTATCACAGCTAAGACGCGTCCTGCTGGTTCTCAGCGCGCTGGCGC

[0110] TATGTTGGCTGATGCGCTGGACATTGTTGATTCAGGTACAAACCGTCCCCA

[0111] AGTTCAACGCGCAATTTAACCCTTACTCGTTACCAGGCGGAACGGATGGCT

[0112] GGCTGGCTATTCTCGGCACCTTCGGCCTGTGGATAGCGCTACTGATTATTA

[0113] TTCGTGAAACGCTGAACGGACTCACCAGGAGATTACAACATGGCTAATTT

[0114] AACCCGTCGTCAGTGGCTAAAAGTCGGTCTCGCCGTCGGTGGGATGGTCA

[0115] CTTTTGGTCTGAGCTACCGTGATGTGGCGAAACGCGCAATTGATGGCCTGT

[0116] TAAACGGGACGTCCGGCAAGGTAACGCGCGACCGCATCTTTGGCAATGCG

[0117] TTAATTCCGGAGGCGCAGGCGCAAACACACTGGCAGCAAAATCCACAACA

[0118] AACCATCGCCATGACGCAATGCTTCGGCTGTTGGACACAGTGCGGTATCCG

[0119] CGCCCGGGTTAATGCCGATGGCAAAGTGATACGCATCGCCGGCAATCCCT

[0120] ATCACCCCTTGTCGCAGGAACACCCGATTGACTCGTCCGTCCCTTTTAGCG

[0121] AAGCCATGGAGCAACTGGCGGGAGAAAGCGGTCTTGACG

[0122] (2) The amplified product was verified using 1.2% agarose gel, and the amplified product with the correct fragment size was recovered according to the operating instructions of the agarose gel DNA recovery kit to obtain the purified target fragment.

[0123] (3) The purified target fragment was ligated with the pMD19-T vector according to the reaction system (10 μL Solution I, 2 μL pMD19-T, 8 μL target fragment) and the ligation was carried out at 16°C overnight.

[0124] (4) The ligation product was transformed into the DH5α E. coli cloning strain according to the transformation instructions of the DH5α E. coli cloning strain, and spread on LB solid medium containing 0.1% Amp, and cultured at 37°C for 12 hours.

[0125] (5) Select positive clones and transfer them to LB liquid culture medium containing 0.1% Amp, and culture with shaking at 37°C for 12-16 hours; refer to the instructions of the Thermo Scientific plasmid extraction kit to extract the plasmid.

[0126] (6) The extracted plasmids were verified by plasmid PCR. The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3. The positive clone plasmids with the correct fragment size were stored in a -20°C refrigerator.

[0127] Table 1 PCR amplification primer sequences

[0128]

[0129] Table 2 PCR amplification reaction system

[0130]

[0131] Table 3 PCR amplification reaction program

[0132]

[0133] 1.4 Design and synthesis of dual RPA-LFD primers and probes

[0134] Dual RPA primers (hipO-RPA-F / MR, ttrRSBCA-RPA-F / R) and probes (hipO-RPA-P, ttrRSBCA-RPA-P) were designed according to the RPA primer and probe design principles. The sequences of dual RPA-LFD primers and probes are shown in Table 4.

[0135] RPA primers should be designed to minimize dimerization, provide good specificity, and achieve high amplification efficiency. They should be 30-35 bp in length and have a GC content of 30%-70%. Guanine (G) repeats should be avoided within the first 3-5 nucleotides of the 5' end, and the last 3 nucleotides of the 3' end should ideally be guanine (G) and cytosine (C). Product length should ideally be 100-200 bp. Biotin is added to the C. jejuni RPA downstream primer, and digoxin is added to the Salmonella RPA downstream primer to distinguish the two on LFD. Probes should be 45-52 bp in length. Carboxyfluorescein (FAM) is added to the 5' end of both probes. Tetrahydrofuran (THF) is used to replace bases at least 30 bp from the 5' end and 15 bp from the 3' end. A DNA polymerase blocking group (C3 spacer) is attached to the 3' end to prevent the probes from amplifying nonspecific products.

[0136] Table 4 Dual RPA-LFD primer and probe sequences

[0137]

[0138] 1.5 Optimization of primer ratios for dual RPA-LFD

[0139] With a concentration of 10 6 The mixed plasmids with 100 copies / μL were used as templates. The reaction system is shown in Table 5. The optimal primer addition amounts were determined by adding 1 μL and 1 μL of hipO-RPA-F / MR, 0.8 μL and 1.2 μL of ttrRSBCA-RPA-F / R, 0.6 μL and 1.4 μL, and 0.4 μL and 1.6 μL of ttrRSBCA-RPA-F / R, respectively.

[0140] Table 5 Dual RPA-LFD reaction system

[0141]

[0142]

[0143] 1.6 Negative test of double RPA-LFD

[0144] Using sterile ddH2O as the template and the optimal primer addition amount optimized by "1.5 Dual RPA-LFD Primer Ratio Optimization", amplify at 37°C for 15 minutes to ensure that subsequent tests will not cause false positive test strips due to primer-probe aggregation.

[0145] 1.7 Optimization of the dual RPA-LFD reaction system

[0146] According to the system in Table 5, each reagent was added and the concentration of the mixed plasmid template was 10 6 copies / μL, controlled the reaction temperature (25℃, 30℃, 33℃, 35℃, 37℃, 39℃) and reaction time (5min, 7min, 9min, 11min, 13min, 15min), compared the LFD interpretation results, and determined the optimal reaction temperature and time for dual RPA-LFD.

[0147] 1.8 Dual RPA-LFD Specificity

[0148] Double RPA-LFD specificity detection was performed using DNA of Campylobacter jejuni, Salmonella, Escherichia coli, Klebsiella pneumoniae, Pseudomonas, Pasteurella, Bacillus cereus, Proteus mirabilis, and Staphylococcus aureus as templates, and a negative control was set up in the experiment.

[0149] 1.9 Dual RPA-LFD Sensitivity

[0150] The mixed plasmid was serially diluted to 10 6 -10 0 The optimized reaction system was used for double RPA-LFD detection, and a negative control was set up in the experiment.

[0151] 1.10 Dual RPA-LFD Repeatability

[0152] Dilute 3 sets to a concentration of 10 7 -10 4 A mixed plasmid with 100 copies / μL was used, and a set of templates was selected at three different time periods for double RPA-LFD to evaluate the repeatability of the experiment.

[0153] 1.11 Dual RPA-LFD Clinical Sample Testing

[0154] The established dual RPA-LFD was used to test 27 samples of crudely extracted chicken cecal contents and chicken cloaca cotton test paper DNA. The test results were compared with the PCR test results of the standard documents (GB / T41627-2022 and NY / T 4146-2022) issued by the National Standardization Administration of China and the Ministry of Agriculture and Rural Affairs.

[0155] 2. Results and Analysis

[0156] 2.1 Identification of recombinant plasmids

[0157] The results of PCR identification of recombinant plasmids were as follows Figure 1 As shown in the figure (A is the PCR identification result of the pMD19-T-hipO recombinant plasmid; B is the PCR identification result of the pMD19-T-ttrRSBCA recombinant plasmid; M is the DL 2000plus DNA Marker, 1 to 5 are the pMD19-T-hipO and pMD19-T-ttrRSBCA recombinant plasmids, respectively, and N is the negative control). The results show that the band size is consistent with the expected fragment, and no amplification is detected in the negative reaction, indicating that the recombinant plasmid was successfully constructed. The extracted plasmids were serially diluted 10-fold and named pMD19-T-hipO and pMD19-T-ttrRSBCA, respectively, and stored at -20°C until further use.

[0158] 2.2 Dual RPA-LFD primer ratio optimization results

[0159] The optimization results of double RPA-LFD primer addition are as follows Figure 2 As shown in the figure (in the figure: the addition amounts of hipO-RPA-F / MR and ttrRSBCA-RPA-F / R in 1 to 4 are 1μL and 1μL; 0.8μL and 1.2μL; 0.6μL and 1.4μL; and 0.4μL and 1.6μL, respectively). The results show that the color of the test strip is most obvious when the addition amounts of hipO-RPA-F / MR and ttrRSBCA-RPA-F / R are 0.8μL and 1.2μL, respectively. Therefore, these addition amounts were used for subsequent experiments.

[0160] 2.3 Double RPA-LFD negative test

[0161] According to the optimized primer ratio, primers were added and ddH2O was used as template to perform a negative test. The test was repeated three times. The results of the double RPA-LFD negative test were as follows: Figure 3 As shown in the figure (in the figure: the addition amounts of hipO-RPA-F / R and ttrRSBCA-RPA-F / R in steps 1 to 3 were 0.8 μL and 1.2 μL respectively). The results show that none of the three negative tests produced false positive results, indicating that subsequent experiments are feasible. The optimized dual RPA-LFD reaction system is shown in Table 6.

[0162] Table 6 Optimized dual RPA-LFD reaction system

[0163]

[0164] 2.4 Optimization results of the dual RPA-LFD reaction system

[0165] The results of the double RPA-LFD reaction temperature optimization are shown in Figure 4 (In the figure: T1 is the Salmonella test line; T2 is the Campylobacter jejuni test line; 1 is the negative control; 2 to 7 correspond to the test results at reaction temperatures of 25°C, 30°C, 33°C, 35°C, 37°C, and 39°C, respectively.) The results show that, except for the Campylobacter jejuni test line (T2) at 25°C, which showed no color, the Salmonella (T1) and Campylobacter jejuni (T2) test lines at all other temperatures showed color, with the colors being most pronounced at 37°C and 39°C. Therefore, the optimal reaction temperature for dual RPA-LFD was set at 37°C.

[0166] The results of dual RPA-LFD reaction time optimization are shown in Figure 5 (In the figure: T1 is the Salmonella detection line; T2 is the Campylobacter jejuni detection line; 1 is the negative control; 2 to 7 correspond to the test results when the reaction time is 5 minutes, 7 minutes, 9 minutes, 11 minutes, 13 minutes, and 15 minutes, respectively). The reaction temperature is controlled at 37°C. When the reaction time is 9 to 15 minutes, the colors of the two detection lines deepen with the increase of reaction time. Therefore, 15 minutes is selected as the optimal reaction time for dual RPA-LFD.

[0167] 2.5 Dual RPA-LFD specificity results

[0168] The results of dual RPA-LFD reaction specificity are as follows Figure 6 As shown in the figure (in the figure, 1 to 7 correspond to Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Pasteurella multocida, Bacillus cereus, Proteus mirabilis, and Staphylococcus aureus, respectively; 8 is a negative control; 9 is Salmonella typhimurium and Campylobacter jejuni). The results show that only Campylobacter jejuni and Salmonella tested positive, with no cross-reactions with other pathogens, indicating that the established dual RPA-LFD has good specificity.

[0169] 2.6 Dual RPA-LFD Sensitivity Results

[0170] The sensitivity results of dual RPA-LFD are as follows Figure 7 As shown (in the figure: 1 is the negative control; 2 to 9 correspond to the concentration of 10 6 -10 0 The results show that the minimum detection limit of dual RPA-LFD for Salmonella is 4.67×10 1 copies / μL, and the minimum detection limit for Campylobacter jejuni was 3.93×10 3 copies / μL.

[0171] 2.7 Dual RPA-LFD Repeatability Results

[0172] The reproducibility results of the double RPA-LFD reaction are as follows Figure 8 As shown (in the figure: A, B, C are the test results of repeat 1, repeat 2, and repeat 3 respectively; among them: T1 is the detection line of Salmonella, T2 is the detection line of Campylobacter jejuni, 1 to 4 correspond to the concentration of 10 7 -10 4 The results show that the concentration of 10 7 -10 4 When the mixed plasmids with 10 copies / μL were used as templates, the detection lines showed color in all three tests, indicating that the dual RPA-LFD method had good reproducibility.

[0173] 2.8 Dual RPA-LFD Clinical Sample Test Results

[0174] The 27 preserved clinical samples were tested by dual RPA-LFD. The results are shown in Table 7. A total of 3 Campylobacter jejuni-positive samples and 2 Salmonella-positive samples were detected, which were consistent with the test results of the standard methods GB / T 41627-2022 and NY / T 4146-2022.

[0175] Table 7 Dual RPA-LFD and PCR test results in GB / T 41627-2022 and NY / T 4146-2022

[0176]

[0177] 3. Discussion

[0178] The difficulty of RPA-LFD technology lies in the design of primers and probes. Dual RPA primers are designed according to the RPA-LFD primer and probe design principles. Biotin is added to the downstream primer of C. jejuni-RPA and digoxin is added to the downstream primer of Salmonella-RPA to distinguish the two on LFD. The probes are 45-52 bp in length. Carboxyfluorescein (FAM) is added to the 5' end of both probes. Tetrahydrofuran (THF) replaces the bases at least 30 bp from the 5' end and 15 bp from the 3' end of the probe. A DNA polymerase blocking group (C3 spacer) is attached to the 3' end to prevent the probes from amplifying nonspecific products.

[0179] The dual RPA-LFD developed in this study can complete the colonization of Campylobacter jejuni (10 3 copies / μL) and Salmonella (10 1 copies / μL). Currently, among the detection technologies for Campylobacter jejuni, LI et al. [1]The established ICB-LAMP-CRISPR / Cas12a system takes 70 min (8 CFU / mL) to detect. [2] The CRISPR-Cas12b system takes 40 minutes (sensitivity is 11 copies / μL); and in the Salmonella detection technology, Ajay's team [3] The developed method based on dual real-time fluorescence quantitative PCR combined with high-resolution melting curve analysis (qPCR-HRMA) has a minimum detection limit of 10 2 copies / μL, SUO [4] The sensitivity of the digital PCR based on self-priming chip combined with aptamer magnetic beads (Apt-MBs) can reach 90 CFU / mL. In contrast, the method provided in this study is faster (15 min) and more sensitive (10 1 It is superior to existing technologies in terms of 100 copies / μL) and does not require complex temperature control equipment. Rapid screening can be achieved through constant temperature amplification and test strip interpretation. It is especially suitable for grassroots laboratories or on-site food testing scenarios, providing more efficient technical support for the immediate diagnosis of foodborne pathogens.

[0180] In this study, the colorimetric display of the Salmonella detection line (T1) detected by dual RPA-LFD was significantly stronger than that of the C. jejuni detection line (T2), and its detection sensitivity for Salmonella plasmid standards was 100 times that of Campylobacter jejuni. This may be because the digoxigenin label of the Salmonella primer is more competitive than the biotin label of the Campylobacter primer, resulting in Salmonella having a greater amplification advantage when competing for limited amplification raw materials (recombinase, polymerase, and single-stranded DNA binding protein), resulting in the dual RPA-LFD detection sensitivity for Salmonella being significantly better than that for Campylobacter jejuni.

[0181] Although the present invention has been described in detail above using general descriptions, specific embodiments, and experiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

[0182] References:

[0183] [1]Li C,Chen X,Wen R,et al.Immunocapture Magnetic Beads Enhanced theLAMP-CRISPR / Cas12a Method for the Sensitive,Specific,and Visual Detection ofCampylobacter jejuni[J].Biosensors(Basel).2022,12(3).

[0184] [2]Huang Y,Gu D,Xue H,et al.Rapid and Accurate Campylobacter jejuniDetection With CRISPR-Cas12b Based on Newly Identified Campylobacter jejuni-Specific and-Conserved Genomic Signatures[J].Front Microbiol.2021,12:649010.

[0185] [3]Ajay G,Vishnuraj M R,Aravind Kumar N,et al.Anovel duplex qPCR-HRMAtechnique for simultaneous detection of Listeria monocytogenes and Salmonellatyphimurium in meat products[J].Food Chem.2025,474:143245.

[0186] [4]Suo Y,Yin W,Zhu Q,et al.A Specific and Sensitive Aptamer-BasedDigital PCR Chip for Salmonella typhimurium Detection[J].Biosensors(Basel).2022,12(7).

Claims

1. A kit for detecting Campylobacter jejuni and Salmonella, characterized in that: The kit comprises: an upstream primer hipO-RPA-F, a downstream primer hipO-RPA-MR and a probe hipO-RPA-P for detecting Campylobacter jejuni; an upstream primer ttrRSBCA-RPA-F, a downstream primer ttrRSBCA-RPA-R and a probe ttrRSBCA-RPA-P for detecting Salmonella; The upstream primer hipO-RPA-F sequence is shown in SEQ ID NO.5; The 5' end of the downstream primer hipO-RPA-MR is labeled with biotin, and the sequence is shown in SEQ ID NO.6; The probe hipO-RPA-P is modified with carboxyfluorescein at the 5' end and a DNA polymerase blocking group at the 3' end, and THF is added between the 5' and 3' ends. The sequence is shown in SEQ ID NO.

7. The upstream primer ttrRSBCA-RPA-F sequence is shown in SEQ ID NO.8; The 5' end of the downstream primer ttrRSBCA-RPA-R is labeled with digoxigenin, and the sequence is shown in SEQ ID NO.9; The 5' end of the probe ttrRSBCA-RPA-P is modified with carboxyfluorescein, the 3' end is modified with a DNA polymerase blocking group, and THF is added between the 5' and 3' ends. The sequence is shown in SEQ ID NO.

10.

2. The kit for detecting Campylobacter jejuni and Salmonella according to claim 1, characterized in that: The kit also includes ddH2O, A buffer, B buffer, RPA lyophilized powder and nucleic acid detection test strips.

3. A dual RPA-LFD detection method for Campylobacter jejuni and Salmonella, characterized in that: The specific steps are as follows: S1, extracting DNA from the sample to be tested; S2. Using the DNA extracted in step S1 as a template, the kit according to claim 1 or 2 is used to perform a double RPA-LFD reaction on the sample DNA to be tested, and the reaction product is detected using a nucleic acid detection test strip; S3. Analyze the test results of the nucleic acid test strip. If bands appear on both the control line and the test line, the result is positive. If a band appears on the control line but no band appears on the test line, the result is negative.

4. The detection method according to claim 3, characterized in that The reaction system for the dual RPA-LFD reaction in step S2 is as follows: 29.4 μL of A buffer; 0.4-0.8 μL each of hipO-RPA-F and hipO-RPA-MR at a concentration of 10 μmol / L; 1.2-1.6 μL each of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R at a concentration of 10 μmol / L; 0.3 μL each of probe hipO-RPA-P and probe ttrRSBCA-RPA-P at a concentration of 10 μmol / L; 2.0 μL of DNA template; 11.5 μL of ddH2O; 2.5 μL of B buffer; 1 tube of RPA lyophilized powder; and 1 Milenia HybriDetect strip.

5. The detection method according to claim 4, characterized in that In the reaction system of the dual RPA-LFD reaction described in step S2: the added amount of hipO-RPA-F and hipO-RPA-MR with a concentration of 10 μmol / L is 0.8 μL each; the added amount of ttrRSBCA-RPA-F and ttrRSBCA-RPA-R with a concentration of 10 μmol / L is 1.2 μL each.

6. The detection method according to claim 3, characterized in that The reaction temperature of the dual RPA-LFD reaction in step S2 is 30°C to 39°C.

7. The detection method according to claim 6, characterized in that The reaction temperature of the dual RPA-LFD reaction in step S2 is 37°C.

8. The detection method according to claim 3, characterized in that The reaction time of the dual RPA-LFD reaction in step S2 is 9 to 15 minutes.

9. The detection method according to claim 8, characterized in that The reaction time of the dual RPA-LFD reaction in step S2 is 15 min.

10. Use of the dual RPA-LFD detection method for Campylobacter jejuni and Salmonella according to claim 3 in the detection of Campylobacter jejuni and Salmonella in intestinal contents of animals or humans, or in food, excluding the diagnosis and treatment of diseases.