Specific primer pair, probe, kit and method for detecting coffee
By designing specific primer pairs and probes for coffee chloroplast genome fragments, the problem of low efficiency in DNA extraction from roasted coffee was solved, high stability and specificity detection of coffee samples was achieved, and the technical requirements for coffee detection were met.
Patent Information
- Application Number
- CN202510985627.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-09-19
AI Technical Summary
Existing fluorescent quantitative PCR technology is difficult to effectively detect coffee components in roasted coffee because the roasting process causes DNA breakage, reduces the success rate of DNA extraction, and lacks effective specific primer and probe design.
A specific primer pair and specific probe were designed for the coffee chloroplast genome fragment (ndhF gene region) for fluorescence quantitative PCR detection. The specific probe was modified with the fluorescent group FAM at the 5' end and the quenching group MGB at the 3' end, combined with a specific fluorescence quantitative PCR detection procedure.
It achieves high stability and specificity detection of coffee samples, solves the problem of low efficiency of DNA extraction from roasted coffee, and provides fast and reliable technical support for the safety supervision of coffee and its products.
Smart Images
Figure CN120666094A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological detection, and in particular relates to a specific primer pair, a probe, a kit and a method for detecting coffee. Background Art
[0002] As one of the most consumed beverages worldwide, coffee quality, authenticity, and ingredient testing are crucial for protecting consumer rights and regulating market order. However, because existing coffee is primarily roasted coffee beans and related products, which undergo high-temperature roasting and subsequent processing, DNA fragmentation occurs during the roasting and subsequent processing. The success rate of DNA extraction from these products is significantly lower than that from fresh coffee cherries or green beans. This presents technical challenges for coffee testing, and there are no reports on the use of fluorescent quantitative PCR for coffee testing. Summary of the Invention
[0003] In view of this, the object of the present invention is to provide a specific primer pair, probe, kit and method for detecting coffee. The present invention designs a specific primer pair and specific probe for a specific fragment on the coffee chloroplast genome fragment (ndhF gene region). The specific primer pair and specific probe are used to perform fluorescent quantitative PCR detection on the DNA of the sample to be tested to determine whether the sample contains coffee.
[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0005] The present invention provides a specific primer pair for detecting coffee, wherein the specific primer pair comprises a forward primer and a reverse primer;
[0006] The forward primer sequence is shown in SEQ ID NO.1;
[0007] The reverse primer sequence is shown in SEQ ID NO.2.
[0008] The present invention provides a specific probe for detecting coffee, and the specific probe is shown as SEQ ID NO.3.
[0009] Preferably, the 5' end of the specific probe is modified with a fluorescent group FAM, and the 3' end is modified with a quenching group MGB.
[0010] The present invention also provides a kit for detecting coffee, which comprises the specific primer pair and the specific probe.
[0011] Preferably, the kit further comprises a premixed solution and water.
[0012] Preferably, the premixed solution is Fast qPCRMix.
[0013] The present invention also provides a method for detecting coffee, comprising the following steps:
[0014] (1) Extracting DNA from the sample to be tested to obtain the target DNA fragment;
[0015] (2) using the target DNA fragment as a template and using the kit to perform fluorescent quantitative PCR detection on the obtained target DNA fragment;
[0016] (3) If fluorescence appears, it indicates that the sample to be tested contains coffee. If no fluorescence appears, it indicates that the sample to be tested does not contain coffee.
[0017] Preferably, the fluorescent quantitative PCR detection system comprises the following components in 20 μL: 1 μL of target DNA, 10 μL of Fast qPCR Mix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 10 μM specific probe, and 6 μL of dH2O.
[0018] Preferably, the procedure of the fluorescence quantitative PCR detection is: pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, for a total of 40 cycles; and collecting the corresponding fluorescence at 60°C.
[0019] Compared with existing technologies, the present invention offers the following advantages: A specific primer pair and probe are designed for a specific fragment of the coffee chloroplast genome (the ndhF gene region). This specific primer pair and probe are then used to perform fluorescent quantitative PCR on DNA from a sample to determine whether the sample contains coffee. This method overcomes the challenges of designing stable and highly specific primers for coffee-derived genes and the low efficiency of extracting roasted coffee DNA, thus filling a gap in coffee testing using fluorescent quantitative PCR technology. This provides faster and more reliable technical support for the safety monitoring of coffee and its products. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is the result of the standard plasmid gradient dilution test;
[0021] Figure 2 This is the test result diagram of positive samples;
[0022] Figure 3 This is the negative control test result diagram;
[0023] Figure 4 is the probe standard curve;
[0024] Figure 5 This is a detection chart for other easily false plant-derived ingredients in coffee;
[0025] Figure 6 : This is a diagram for the validation of interspecific adaptability of Arabica, where 1 is a positive standard control 1, 2 is a positive standard control 2, 3 is raw Geisha 1, 4 is raw Geisha 2, 5 is raw Typica 1, 6 is raw Typica 2, 7 is raw Catimum 1, 8 is raw Catimum 2, 9 is roasted Geisha 1, 10 is roasted Geisha 2, 11 is roasted Typica 1, 12 is roasted Typica 2, 13 is roasted Catimum 1, 14 is roasted Catimum 2, 15 is roasted Sagem 1, 16 is roasted Sagem 2, 17 is roasted Dere 296-1, 18 is roasted Dere 296-2, 19 is roasted Kona-1, 20 is roasted Kona-2, and 21 and 22 are blank controls;
[0026] Figure 7 The effects of specific primers and probes designed for different gene regions on amplification efficiency were investigated. DETAILED DESCRIPTION
[0027] The present invention provides a specific primer pair for detecting coffee, wherein the specific primer pair comprises a forward primer and a reverse primer;
[0028] The forward primer sequence is shown in SEQ ID NO.1, and is as follows:
[0029] AAAAGATCGACTAATCGTTCTATGAT;
[0030] The reverse primer sequence is shown in SEQ ID NO.2, and is as follows:
[0031] AAACCGATTGAATGACGAGTCATTT.
[0032] The present invention provides a specific probe for detecting coffee. The specific probe is shown in SEQ ID NO. 3, and is specifically as follows:
[0033] TTTCGATTTTTATAGATTAG.
[0034] In the present invention, the 5' end of the specific probe is modified with a fluorescent group FAM, and the 3' end is modified with a quenching group MGB.
[0035] The present invention also provides a kit for detecting coffee, which comprises the specific primer pair and the specific probe.
[0036] In the present invention, the kit further comprises a premixed solution and water; the premixed solution is FastqPCRMix.
[0037] The present invention also provides a method for detecting coffee, comprising the following steps:
[0038] (1) Extracting DNA from the sample to be tested to obtain the target DNA fragment;
[0039] (2) using the target DNA fragment as a template and using the kit to perform fluorescent quantitative PCR detection on the obtained target DNA fragment;
[0040] (3) If fluorescence appears, it indicates that the sample to be tested contains coffee. If no fluorescence appears, it indicates that the sample to be tested does not contain coffee.
[0041] In the present invention, the fluorescent quantitative PCR detection system is based on 20 μL and includes the following components: 1 μL of target DNA, 10 μL of Fast qPCR Mix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 10 μM specific probe, and 6 μL of dH2O.
[0042] In the present invention, the procedure of the fluorescent quantitative PCR detection is: pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, a total of 40 cycles; collecting the corresponding fluorescence at 60°C.
[0043] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0044] Example 1 Probe and Primer Design Sequence
[0045] Using known coffee (Coffea arabica L.) gene sequences from NCBI and other gene databases, we screened for a coffee chloroplast genome fragment (primers targeting the hypervariable spacer downstream of the ndhF gene in the coffee chloroplast). This sequence, a non-coding intergenic spacer in coffee chloroplast DNA, is 100% specific for the genus Coffea and highly resistant to degradation, enabling accurate identification of coffee species and varieties, even after dark roasting. Primers and Taq-Man fluorescent probes based on this coffee-specific fragment were designed using PrimeriExpress software (see Table 1). The amplification conditions for fluorescent quantitative PCR are shown in Table 2, and the amplification system is shown in Table 3. Primers and probes were synthesized by Beijing Qingke Biotechnology Co., Ltd.; primers were PAGE-grade, and probes were HPLC-grade.
[0046] Table 1 Probe and primer design sequences
[0047]
[0048] Table 2 Amplification conditions
[0049]
[0050] Table 3 Amplification system
[0051] Components Add volume Fast qPCR Mix (probe) 10 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL Probe (10 μM) 1 μL DNA template 1 μL <![CDATA[dH2O]]> 6μL
[0052] Example 2
[0053] 2.1 Green Coffee Bean Extraction Method
[0054] Green coffee beans were initially ground using a food grinder, freeze-dried using liquid nitrogen, and then finely ground in a mortar and pestle. The ground beans were then passed through a 40-mesh sieve to obtain green coffee bean powder. DNA from the green coffee beans was extracted using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver. 5.0. The extraction procedures were performed in full accordance with the kit's instructions.
[0055] 2.2 Roasted coffee bean extraction method
[0056] Roasted coffee beans and related products undergo high-temperature roasting, which causes DNA fragmentation during the roasting and subsequent processing. The success rate of DNA extraction from these products is significantly lower than that from fresh coffee cherries or green beans. By comparing and screening commonly available kits for processed foods, we optimized the extraction process. Ultimately, we determined that the DNA extraction kit for processed foods produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. performed the best.
[0057] Extraction steps:
[0058] (1) Roasted coffee beans were freeze-dried using liquid nitrogen, and the processed roasted coffee beans were ultrafinely ground using a mortar and sieved to obtain roasted coffee powder with a particle size of 0.3 mm.
[0059] (2) Weigh 100 mg of ground roasted coffee powder, add 500 μL of buffer GMO1 and 20 μL of Proteinase K (20 mg / mL), and vortex for 1 min.
[0060] (3) Incubate at 56°C for at least 2 h. Shake once every 15 min during the incubation period.
[0061] (4) Add 200 μL of buffer GMO2, mix thoroughly, and vortex for 1 min. Let stand at room temperature for 10 min.
[0062] (5) Centrifuge at 12,000 rpm for 5 min and transfer the supernatant to a new centrifuge tube.
[0063] (6) Add 350 μL of isopropanol to the supernatant, mix thoroughly, centrifuge at 12,000 rpm for 3 min, gently discard the supernatant, and retain the precipitate.
[0064] (7) Add 700 μL of 70% ethanol, vortex for 10 seconds, centrifuge at 12,000 rpm for 2 minutes, discard the supernatant, and repeat this step twice.
[0065] (8) Open the lid and invert for 5-10 minutes at room temperature to completely dry the residual ethanol. Add 30 μL of elution buffer TE and vortex for 1 minute to obtain the DNA solution.
[0066] Example 3 Standard plasmid gradient dilution detection
[0067] Preparation of a standard plasmid (commissioned by Beijing Qingke Biotechnology Co., Ltd.): Insert the target gene into the Qingke pClone007 Versatile Simple Vector cloning vector to obtain a standard plasmid. Specifically, insert the target gene between base pairs 395-396 of the cloning vector. The sequence of the target gene is shown in SEQ ID NO. 4, and the sequence of the Qingke pClone007 Versatile Simple Vector cloning vector is shown in SEQ ID NO. 5.
[0068] SEQ ID NO.4: AAAAGATCGACTAATCGTTCTATGATGAAAAATT TTCGATTTTTATAGATTAGTCGTACCTATACAATAATCTATTATTAATATAAATGACTCGTCATTCAATCGGTTT;
[0069]
[0070] Dilution test method: The obtained standard plasmid was diluted 10-fold in a series (10^2 to 10^8 copies / μL) with TE buffer. Three technical replicates were set for each dilution, and samples of green coffee beans and cooked coffee beans were tested simultaneously. qPCR detection was performed according to the system in Table 3. The results of the standard plasmid serial dilution test are shown in Table 4 and Figures 1 to 3 .
[0071] Table 4 Standard plasmid gradient dilution test data
[0072]
[0073]
[0074]
[0075] Depend on Figures 1 to 3 It can be seen that the linear range is 10^2~10^8 copies / μL and the amplification is effective (R 2 >0.99), with no nonspecific amplification (NTC no signal). The minimum detection limit was 10^2 copies / μL (CT value = 11.79 ± 0.03). The standard deviation of the CT values (Ct SD) within each gradient was ≤0.192, indicating good reproducibility (Table 4). This method is stable and reliable. Genes were detected in both roasted and green coffee bean DNA, with CT values ≤31 for roasted coffee beans and ≤23 for green coffee beans.
[0076] Example 4 Probe Standard Curve Construction
[0077] The standard plasmid obtained in Example 3 was diluted 10-fold in a gradient (10^3 to 10^7 copies / μL) with TE buffer. Three technical replicates were set for each dilution, and qPCR detection was performed according to the system in Table 3. The results are shown in Table 5 and Figure 4 .
[0078] Table 5 Probe standard curve
[0079]
[0080] From Table 5 and Figure 4 It can be seen that the standard curve equation of the probe constructed based on the standard plasmid is y=-3.3939x+44.842 (y is the CT value, x is the copy number log value), the amplification efficiency is 97.1%, and the linear correlation coefficient R 2 =1. This method is 10 2 ~10 6 The linearity was good within the range of copies / μL, and the minimum detection limit was 2.22×104 This curve can be used for absolute quantification of coffee DNA, providing a basis for accurate detection of coffee components in actual samples.
[0081] Example 5 Specificity Detection
[0082] The coffee-specific primers and probes in Example 1 of the present invention were used to amplify green coffee beans, roasted coffee beans, and other non-coffee (soybean, corn, pea) samples to verify the specificity of the coffee primers and probes. The results are shown in Table 6 and Table 7. Figure 5 .
[0083] Table 6 Amplification results of different samples
[0084] sample Ct value in conclusion Roasted coffee beans-1 34.23 Positive Roasted coffee beans-2 35.75 Positive Green coffee beans-1 18.06 Positive Green coffee beans-2 19.28 Positive soybeans Undetected No cross-reaction corn Undetected No cross-reaction pea Undetected No cross-reaction
[0085] The experimental results are as follows Figure 5 As shown, the specific primers and probes of the present invention can significantly amplify the DNA of 7 coffee beans, but not other food crops, indicating that the coffee-specific primers and probes of the present invention are species-specific.
[0086] Example 6 Verification of interspecific adaptability of Arabica
[0087] The coffee-specific primers and probes provided in Example 1 were used to amplify different coffee bean varieties (green coffee bean varieties include: Gesha, Catimu, Typica, and roasted coffee bean varieties include: Gesha, Typica, Catimu, Sachim, Dere 296, and Kona) to verify the interspecies adaptability of coffee primers and probes. The method used was the same as that in Table 3 and Example 2. The results are shown in Table 3. Figure 6 .
[0088] Depend on Figure 6 As shown, successful detection was achieved across all Arabica species. The green coffee varieties tested included Gesha, Catimu, and Typica. The roasted varieties tested included Gesha, Typica, Catimu, Sachim, Dere 296, and Kona. The coffee primer probes used in the detection system of this invention significantly amplified all tested coffee varieties. The CT values for green coffee beans ranged from 20-24; those for roasted coffee beans ranged from 33-39.
[0089] Application Examples
[0090] 1. Basis for comparison target selection:
[0091] In addition, based on the coffee chloroplast genome database, specific primers and probes were designed for specific fragments in the ycf1 gene region of the coffee chloroplast genome, as shown in Table 7. The primers and probes were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0092] Table 7 Comparative primer probe sequences
[0093]
[0094] 2. Experimental Methods
[0095] Samples: 4 batches of green coffee beans (purchased from Gaosheng Coffee Estate, Baoshan City, Yunnan Province), with 1 replicate for each batch.
[0096] Detection: The primer probes of the present invention (SEQ ID NO. 1-3) and the comparative primer probes (SEQ ID NO. 6-8) were used in parallel for detection under the qPCR system and procedure of Example 1. The results are shown in Table 8 and Table 9. Figure 7 .
[0097] Table 8 Comparison of amplification performance of different target genes
[0098]
[0099] From Table 8 and Figure 7 It can be seen that both sets of primers can significantly amplify, and the CT values are ≤23, but the CT values of the primers of the present invention are smaller than those of the ycf1 primers. Figure 7 It can be seen that the amplification efficiency of the target of the present invention is significantly higher than that of the ycf1 primer in both the standard plasmid and the sample.
[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A specific primer pair for detecting coffee, characterized in that: The specific primer pair includes a forward primer and a reverse primer; The forward primer sequence is shown in SEQ ID NO.1; The reverse primer sequence is shown in SEQ ID NO.
2.
2. A specific probe for detecting coffee, characterized in that: The specific probe is shown in SEQ ID NO.
3.
3. The specific probe according to claim 2, characterized in that The 5' end of the specific probe is modified with a fluorescent group FAM, and the 3' end is modified with a quenching group MGB.
4. A kit for detecting coffee, characterized in that: The kit comprises the specific primer pair according to claim 1 and the specific probe according to claim 2 or 3.
5. The kit according to claim 4, characterized in that The kit also includes a premix solution with water.
6. The kit according to claim 5, characterized in that The premixed solution is Fast qPCR Mix.
7. A method for detecting coffee, characterized in that: The following steps are involved: (1) Extracting DNA from the sample to be tested to obtain the target DNA fragment; (2) using the target DNA fragment as a template and using the kit according to any one of claims 4 to 6 to perform fluorescent quantitative PCR detection on the obtained target DNA fragment; (3) If fluorescence appears, it indicates that the sample to be tested contains coffee. If no fluorescence appears, it indicates that the sample to be tested does not contain coffee.
8. The method according to claim 7, characterized in that The fluorescent quantitative PCR detection system is based on 20 μL and includes the following components: 1 μL of target DNA, 10 μL of Fast qPCR Mix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 10 μM specific probe, and 6 μL of dH2O.
9. The method according to claim 7, characterized in that The procedure of the fluorescence quantitative PCR detection is as follows: pre-denaturation at 95°C for 5 min, 1 cycle; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, for a total of 40 cycles; and collection of the corresponding fluorescence at 60°C.