Assay method and kit
The template oligonucleotide is hybridized with the nucleic acid primer and extended to form an extended oligonucleotide, the labeled probe is combined and the template oligonucleotide is cut, and the use of an anchoring reagent improves the sensitivity and stability of the immunoassay, solving the problems of complexity and high cost in the prior art.
Patent Information
- Application Number
- CN202380093629.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-04-20
- Filing Date
- 2023-12-19
- Publication Date
- 2025-09-19
AI Technical Summary
Existing immunoassay methods are complex and costly, require multi-step optimization procedures, and have long sensitivity and run times.
A template oligonucleotide is hybridized with a nucleic acid primer and extended to form an extended oligonucleotide, a labeled probe is bound and the extension is terminated by cleavage of the template oligonucleotide, and an anchoring agent and a detection oligonucleotide are used to improve sensitivity and stability.
The measurement process is simplified, the sensitivity is improved, the nonspecific background signal is reduced, and the measurement signal stability and temperature adaptability are enhanced.
Smart Images

Figure CN120677251A_ABST
Abstract
Description
[0001] Sequence Listing
[0002] This application contains a sequence listing submitted electronically in XML file format, and the sequence listing is hereby incorporated by reference in its entirety. The XML copy, created on December 18, 2023, is named 0076-0065WO1_SL.xml and is 80,962 bytes in size. Technical Field
[0003] The present invention provides components for performing assays, such as sandwich immunoassays, methods utilizing the components, and compositions and kits comprising the components. Background Art
[0004] Immunoassays, such as sandwich immunoassays, are commonly used to detect analytes in samples. Methods for improving assay sensitivity often involve analyte-dependent, multi-step optimization procedures that require numerous additional assay components and / or instrumentation, increasing complexity and cost. Furthermore, optimized assays may require longer run times and / or complex analytical methods. Summary of the Invention
[0005] In an embodiment, the present invention provides a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising: (1) the analyte; and (2) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase to form an extended oligonucleotide; (c) binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detection oligonucleotide capable of binding to the extended oligonucleotide. detection label; and (d) detecting the detectable label, thereby detecting the analyte, wherein the second complex is bound to a surface, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), further wherein the surface comprises an anchoring reagent; (v) the surface comprises an anchoring reagent, the anchoring reagent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v).
[0006] In an embodiment, the present invention provides a kit for detecting an analyte, the kit comprising the following in one or more vials, containers or compartments: (a) a capture reagent that binds to the analyte; (b) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer or is capable of being linked to a nucleic acid primer; (c) a labeled probe comprising (1) a detection oligonucleotide and (2) a detectable label; and (d) a template oligonucleotide that is capable of hybridizing to the nucleic acid primer and comprises the same sequence as the detection oligonucleotide; wherein the detection reagent comprises a protein or polypeptide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the kit further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and wherein the kit further comprises an anchoring reagent; (v) the kit further comprises an anchoring reagent, the anchoring reagent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or any combination of (vi) (i), (ii), and (v).
[0007] In an embodiment, the present invention provides a composition for labeling a surface, the composition comprising: a labeled probe, the labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to an extended oligonucleotide, the extended oligonucleotide being bound to the surface, wherein the extended oligonucleotide is formed by extending a nucleic acid primer based on a template oligonucleotide by a polymerase, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extended oligonucleotide is bound to the surface via an anchoring agent; (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or any combination of (vi) (i), (ii), and (v). In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the extension of the nucleic acid primer is performed by rolling circle amplification (RCA).
[0008] In an embodiment, the present invention provides a composition for labeling a surface, the composition comprising: (a) a nucleic acid primer directly or indirectly immobilized on a surface; (b) a template oligonucleotide comprising (1) a first region complementary to the nucleic acid primer; and (2) a second region comprising the same sequence as a detection oligonucleotide; (c) a polymerase; and (d) a labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to an extended oligonucleotide, the extended oligonucleotide being bound to the surface, wherein the extended oligonucleotide is detected by the polymerase based on the template. The oligonucleotide is formed by extending the nucleic acid primer, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extended oligonucleotide is bound to the surface by an anchoring agent; (v) the surface comprises an anchoring agent, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or any combination of (vi) (i), (ii) and (v). In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the extension of the nucleic acid primer is performed by rolling circle amplification (RCA).
[0009] In an embodiment, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising a nucleic acid primer, a template oligonucleotide, a polymerase and a nuclease, wherein: the capture reagent is immobilized on a surface; the capture reagent and the detection reagent are bound to the analyte; the nucleic acid primer is hybridized to the template oligonucleotide; the polymerase is capable of extending the nucleic acid primer; and the nuclease is capable of cleaving the template oligonucleotide.
[0010] In an embodiment, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide and an anchoring reagent comprising an anchoring oligonucleotide, wherein: the capture reagent and the anchoring reagent are immobilized on a surface; the capture reagent and the detection reagent are bound to the analyte; the anchoring oligonucleotide comprises a modified nucleic acid selected from the group consisting of peptide nucleic acid (PNA), locked nucleic acid (LNA), bridged nucleic acid (BNA), a nucleoside comprising a 2' modification or a combination thereof, optionally wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH) or a combination thereof; and the extended oligonucleotide comprises an anchor complement bound to the anchoring oligonucleotide.
[0011] In an embodiment, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide and a labeled probe comprising the detection oligonucleotide, wherein: the capture reagent and the detection reagent are bound to the analyte; the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof, wherein the modified nucleic acid is selected from PNA, LNA, BNA, a 2'-modified nucleoside or a combination thereof, optionally wherein the 2'-modified nucleoside comprises a 2'-O-methyl modification (2'-Ome), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH) or a combination thereof; and the extended oligonucleotide is bound to the detection oligonucleotide.
[0012] In an embodiment, the present invention provides an oligonucleotide comprising any one of SEQ ID NOs: 7-15 or SEQ ID NO: 17. In an embodiment, the present invention provides an oligonucleotide consisting of any one of SEQ ID NOs: 7-15 or SEQ ID NO: 17. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The following drawings constitute part of this specification and are included to further illustrate exemplary embodiments of certain aspects of the present invention.
[0014] Figure 1A and 1B Exemplary modified nucleic acids according to the embodiments herein are shown. Figure 1A Adapted from Duffy et al., BMC Biology 18:112 (2020). Figure 1B Exemplary bridged nucleic acids (BNAs) are shown.
[0015] Figure 2A Shown are representative results of comparative assays performed using a detection oligonucleotide that is 23 nucleotides in length and lacks any modified nucleic acid ("DNA-23") and a detection oligonucleotide that is 10 nucleotides in length and includes 6 locked nucleic acids (LNAs) ("LNA-10 / 6"), as described in the Examples herein. Figure 2B Representative results are shown for a comparative assay using a detection oligonucleotide that is 23 nucleotides in length and does not have any modified nucleic acid ("Detect23") and a detection oligonucleotide that is 10 nucleotides in length and includes 5 LNAs ("Detect10+5L(A)"), as described in the Examples herein.
[0016] Figures 3A-3DRepresentative results of assays performed according to the examples herein are shown, wherein Figures 3A-3D The restriction enzymes DdeI, HpaII, AluI and StuI shown in were added to cleave the template oligonucleotides as described herein.
[0017] Figure 4 Shown are representative results of a calibration assay for template oligonucleotide cleavage using varying concentrations of DdeI, as described in the Examples herein. Also shown are the Hill slopes of the assays.
[0018] Figure 5 Shown are representative results of a kinetic assay performed with three different concentrations of DdeI (0 U / well, 0.005 U / well, or 0.05 U / well) and at three different temperatures (20°C, 23.5°C, and 27°C), as described in the Examples herein.
[0019] Figures 6A-6B Shown are representative results of an assay where the addition of the restriction enzyme ApoI significantly reduced the temperature dependence of the assay. Figure 6A ECL signal results are shown. Figure 6B Shown are ECL signals normalized to the ECL signal at 1 hour at 27°C.
[0020] Figures 7A-7C Shown are representative results of two assays performed at room temperature (23.5°C) where the addition of the restriction enzyme TspRI improved the stability of the ECL signal over time. Figure 7A Shown is the ECL signal for detecting the biotinylated primer on streptavidin. Figure 7B Shown are ECL signals normalized to the ECL signal at the 1 hour time point. Figure 7C Shown are the ECL signals of the IL-5 immunoassay normalized to the ECL signal at the 1 hour time point.
[0021] Figures 8A-8B The dependence of anchoring oligonucleotide ("anchor") length on background signal from samples containing anti-ssDNA antibodies and the improvement of adding ssDNA to block this sample interference are shown. Anchors include the following modified nucleotides: 2'-O-methylated (A12-OM) and locked nucleic acid bases LNA9-1, LNA9-2, LNA9-3, LNA9-6, LNA9-7, LNA9-8, LNA 9-9, and A9+3L.
[0022] Figures 9A-9B The stability of the ECL signal is shown as the percentage of the ECL signal retained as the scrubber speed is increased. Figure 9AThe shorter A9+3L6OM anchor containing LNA and 2'-OMe bases showed the same Figure 9B Similar stability to the A25DNA-based anchor.
[0023] Figures 10A-10B Shown are the reduction and range of nonspecific signal (maximum to minimum) when using anchors with modified bases (A9+3L6OM (and PEG spacer) and A9+4L) compared to a DNA-based anchor (A25) when used in combination with ssDNA in sample dilution. Figure 10B Results for A9-no Peg, A9-1 Peg, and A9-2 Peg are shown, where A9 and Figure 9A The same as A9+3L6OM in.
[0024] Figure 11A The relative stabilities at different wash rates for three anchor oligonucleotides are shown: (i) DNA-based (A25), (ii) LNA-based (A9+4L), and (iii) 2'-OMe-based (A9+3L6OM), demonstrating the improved performance of the modified anchors in shorter sequences.
[0025] Figure 11B Representative results are shown for assays performed according to the embodiments herein, wherein an anchor oligonucleotide of 25 nucleotides in length without any modified nucleic acid ("A25") has primers at varying concentrations, and a detection oligonucleotide of 23 nucleotides in length without any modified nucleic acid ("D23"), or a detection oligonucleotide of 10 nucleotides in length including an LNA and / or 2'-OMe modified nucleic acid as described herein ("D10A+D10B").
[0026] Figure 11C Representative results are shown for assays performed according to the embodiments herein, wherein an anchor oligonucleotide of 9 nucleotides in length comprising LNA and 2'-OMe nucleotides ("A9+3L6OM") has primers at varying concentrations, and either a detection oligonucleotide of 23 nucleotides in length without any modified nucleic acid ("D23"), or a detection oligonucleotide of 10 nucleotides in length comprising LNA and / or 2'-OMe modified nucleic acid as described herein ("D10A+D10B").
[0027] Figure 11DRepresentative results are shown for an assay performed according to the Examples herein, in which primers were added at two concentrations, and either 0.05 U / well or 0.1 U / well DdeI was added for cleavage of the template oligonucleotide, and a detection oligonucleotide ("D10A+D10B") that was 10 nucleotides in length and included an LNA and / or 2'-OMe modified nucleic acid.
[0028] Figure 11E Representative results are shown for an assay performed according to the Examples herein, in which TspRI was added for cleavage of the template oligonucleotide, an anchor oligonucleotide (A9+3L6OM, comprising LNA and / or 2'-OMe modified nucleic acids), and a detection oligonucleotide ("D10A+D10B") 10 nucleotides in length and comprising LNA and / or 2'-OMe modified nucleic acids were added. This demonstrates the improved stability of the ECL signal to the washer flow rate according to this assay improvement combination.
[0029] Figure 12 Representative results for assays performed with different combinations of detection oligonucleotides and template oligonucleotides, according to the Examples herein, are shown. D10A+5L: A 10-nucleotide (nt) detection oligonucleotide with 5 LNAs; used with a 61-nt template. D10A+5L5OM: A 10-nt detection oligonucleotide with 5 LNAs and 5 2'-OMe nucleotides; used with a 61-nt template. D10A+5L-58A: A 10-nt detection oligonucleotide with 5 LNAs; used with a 58-nt template. D10A+5L5OM-58A: A 10-nt detection oligonucleotide with 5 LNAs and 5 2'-OMe nucleotides; used with a 58-nt template. D10A+5L / D10B+6L: A mixture of D10A+5L and D10B+6L; used with a 61-nt template. D10A+5L5OM / D10B+6L: A mixture of D10A+5L5OM and D10B+6L; used with a 61-nt template. NSB: nonspecific binding.
[0030] Figure 13 Shown are representative results from assays in which a single-stranded oligonucleotide (SSO) stabilizer, ultrathermostable single-stranded DNA binding protein (ET SSB), was added during the extension reaction. The top panel shows the results when ET SSB was added before the polymerase. The bottom panel shows the results when ET SSB was added after the polymerase.
[0031] Figure 14 Representative results of assays performed with different concentrations of ET SSB are shown. The four panels show the addition of ET SSB at 0, 5, 15 or 60 minutes after polymerase.
[0032] Figure 15 Shown are representative results of assay signal fold increase over 24 hours of extension when ET SSB was added 0 min, 5 min, 15 min, or 60 min after polymerase.
[0033] Figure 16 Shown are representative results of the ratio of assay signal at 24 hours to 4 hours in the presence of ET SSB or control reactions without ET SSB.
[0034] Figure 17 An exemplary diagram of the embodiments herein is shown. Figure 17 In the left panel of FIG, the anchoring agent portion of the capture agent-anchoring agent hybrid comprises a first binding partner that binds to a second binding partner on a surface. Figure 17 In the right panel of FIG, the capture reagent portion of the capture reagent-anchor reagent hybrid is directly immobilized to the surface.
[0035] Figure 18 An exemplary illustration of an embodiment of the present invention is shown. A capture reagent and an anchoring reagent ("anchor") are immobilized on a surface. The capture reagent is complexed with an analyte, a first detection reagent comprising a first nucleic acid probe ("PC1"), and a second detection reagent comprising a second nucleic acid probe ("PC2"). A bridging oligonucleotide ("BO") comprising a nucleic acid primer hybridizes with PC1 and PC2. The nucleic acid primer of BO is capable of hybridizing with a template oligonucleotide and extending to form an extended oligonucleotide. A labeled probe capable of binding to the extended oligonucleotide is also shown.
[0036] Figure 19A and 19B An exemplary diagram of the embodiments herein is shown. Figure 19A and 19B In a method of detecting a first complex comprising a capture reagent, an analyte ("A"), and a detection reagent, an extended oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extended oligonucleotide comprises a binding sequence. Figure 19A In the embodiment, the binding sequence is capable of binding to a surface, which may comprise an anchoring agent. Figure 19B In the present invention, an anchoring agent is linked to another capture agent on the surface, and the binding sequence binds to the anchoring agent linked to the capture agent.
[0037] Figure 20An exemplary diagram of an embodiment of the present invention is shown. A first complex comprising a capture reagent, an analyte ("A"), and a detection reagent is formed, and an extended oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extended oligonucleotide comprises a binding moiety (e.g., a hapten, which can be incorporated into the extended oligonucleotide via a hapten-labeled dNTP) that is bound to an anchoring agent (e.g., a protein or antibody that binds to the binding moiety).
[0038] Figure 21 An exemplary diagram of an embodiment herein is shown. A first detection reagent comprising a first nucleic acid primer hybridizes to a first region of a template oligonucleotide, and a second detection reagent comprising a second nucleic acid primer hybridizes to a second region of the template oligonucleotide. Both the first nucleic acid primer and the second nucleic acid primer can be extended to form a first extended oligonucleotide and a second extended oligonucleotide as described herein.
[0039] Figure 22 An exemplary diagram of an embodiment of the present invention is shown. A first complex comprising a capture reagent, an analyte ("A"), and a detection reagent is formed, and an extended oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extended oligonucleotide is capable of forming a secondary structure comprising a detectable enzymatic activity (e.g., an aptamer that binds heme). The enzymatic activity, such as peroxidase activity, is detected, thereby detecting the analyte as described herein.
[0040] Figure 23 The exemplary diagram of the embodiment herein is shown.Anchoring reagent is fixed on surface (for example, protein blotting membrane), and forms the first complex from the surface, and the first complex comprises analyte and the first detection reagent and the second detection reagent that respectively comprise the first nucleic acid primer and the second nucleic acid primer.The first nucleic acid primer and the second nucleic acid primer are hybridized with template oligonucleotide, and the template oligonucleotide can be connected to form a circular template.The first nucleic acid primer or the second nucleic acid primer are extended to form extended oligonucleotide.Extended oligonucleotide can be combined with a probe through detectably labeled. DETAILED DESCRIPTION
[0041] Unless otherwise defined herein, the scientific and technical terms used in this disclosure should have the meanings commonly understood by those of ordinary skill in the art. In addition, unless the context otherwise requires, singular terms should include pluralities, and plural terms should include the singular.
[0042] The articles "a" and "an" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.
[0043] Use of the term "or" in the claims is intended to mean "and / or" unless explicitly stated to refer only to alternatives or the alternatives are mutually exclusive, although this disclosure supports definitions referring only to alternatives and to "and / or."
[0044] As used herein, the terms "comprising" (and any variations or forms of comprising, such as "comprise" and "comprises"), "having" (and any variations or forms of having, such as "have" and "has"), "including" (and any variations or forms of including, such as "includes" and "include"), or "containing" (and any variations or forms of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0045] The use of the term "for example" and its corresponding abbreviation "eg" means that the specific term referenced is a representative example and embodiment of the present disclosure, and unless otherwise expressly stated, the representative examples and embodiments are not intended to be limited to the specific example referenced or referenced.
[0046] As used herein, "about" can mean plus or minus 10% of the value provided. Where a range is provided, the range is inclusive. "About" can additionally or alternatively mean within 10% of the value, or within 5% of the value, or in some cases within 2.5% of the value; or "about" can mean rounded to the nearest significant figure.
[0047] As used herein, "between" is a range that includes the ends of the range. For example, a number between x and y specifically includes the numbers x and y and any number that falls between x and y.
[0048] As used herein, the term "simultaneously" with respect to one or more events (e.g., contacting a template oligonucleotide with a polymerase and a nuclease) means that the events occur at exactly the same time or at substantially the same time, for example, the simultaneous events described herein can be less than or about 10 minutes apart, less than or about 5 minutes apart, less than or about 2 minutes apart, less than or about 1 minute apart, less than or about 30 seconds apart, less than or about 15 seconds apart, or less than or about 5 seconds apart.
[0049] As used herein, the term "level" in the context of an analyte refers to the amount, concentration, or biological activity or chemical reactivity (collectively referred to as "activity") of the analyte. The term "level" may also refer to the rate of change of the amount, concentration, or activity of a biomarker. "Level" may also refer to the absolute amount of an analyte in a sample or the relative amount of an analyte, including an amount or concentration determined under steady-state or non-steady-state conditions. "Level" may also refer to an assay signal related to the amount, concentration, activity, or rate of change of an analyte. The level of an analyte may be determined relative to a control component in a sample.
[0050] As used herein, "nucleic acid" refers to one (i.e., a single nucleotide monomer) or multiple nucleotides. In embodiments where "nucleic acid" refers to more than one nucleotide, the nucleotides can be covalently linked to form a polymer structure, such as a "polynucleotide," "oligonucleotide," or "nucleic acid sequence." The term "nucleic acid" includes ribonucleic acid (RNA) (e.g., RNA nucleotide monomers) and deoxyribonucleic acid (DNA) (e.g., DNA nucleotide monomers). "Nucleotide" includes a core base and a sugar, which together form a "nucleoside" and a phosphate. "Standard" nucleotides herein are nucleotides having adenine, guanine, thymine, uracil, or cytosine bases, deoxyribose or ribose sugars, and a phosphate.
[0051] As used herein, a "modified nucleic acid" refers to one (i.e., a single nucleotide monomer) or multiple nucleotides that contain modifications in the bases, sugars, and / or backbones of standard nucleotides. In an embodiment, the modified nucleic acid comprises naturally occurring modifications, such as methylation of the 2'-O atom of the ribose ring, modification at C5 of the pyrimidine base, etc., which can be found in natural oligonucleotides but are not part of a standard DNA or RNA nucleotide. In an embodiment, the modified nucleic acid comprises non-naturally occurring modifications, such as locked nucleic acid monomers (LNA) or peptide nucleic acid monomers (PNA), which can be synthesized using techniques known in the art. Exemplary modified nucleic acids are further described, for example, in Duffy et al., BMC Biology 18:112 (2020) and in Figure 1A Shown in , adapted from Duffy et al., BMC Biology 18:112 (2020).
[0052] "Peptide nucleic acid" or "PNA" refers to a DNA mimic in which the deoxyribose phosphate backbone is replaced by a pseudopeptide polymer to which nucleobases are attached. As used herein, the terms "peptide nucleic acid" and "PNA" include a single PNA monomer or more than one PNA monomer. In general, PNAs hybridize with a higher affinity and specificity to complementary DNA or RNA (e.g., an extended oligonucleotide described herein) than to unmodified naturally occurring nucleic acids (e.g., DNA or RNA). PNAs are further described, for example, in Pellestor et al., European Journal of Human Genetics 12:694-700 (2004).
[0053] "Locked nucleic acid" or "LNA" refers to a modified RNA nucleotide in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom to the 4'-C atom. As used herein, the terms "locked nucleic acid" and "LNA" include a single LNA monomer or more than one LNA monomer. Non-limiting examples of LNA are described, for example, in Beigelman et al., Nucleic Acids Research, 23(21):4434-4442 (1995).
[0054] "Bridged nucleic acid" or "BNA" refers to a modified RNA nucleotide containing a bridge linkage between the 2'-O atom and the 4'-C atom of the ribose sugar. As used herein, the term "bridged nucleic acid" or "BNA" comprises a single BNA monomer or more than one BNA monomer. In embodiments, the bridge linkage of the BNA comprises an amine, sulfur, oxygen, or a combination thereof. Examples of BNAs are Figure 1B Additional exemplary BNAs include, but are not limited to, 3'-amino-2',4'-BNA; 2',4'-BNA-2-pyridone; 2',4'-ENA; 2',4'-BNA-1-isoquinolone; 2',4'-BNA NC [NH]; 2',4'-BNA NC [NMe]; and 2',4'-BNA NC[NBn]. See, e.g., Obika et al., Tetrahedron Letters 38(50):8735-8738 (1997); Koshkin et al., Tetrahedron 54(14):3607-3630 (1998); Obika et al., Chemical Communications 19:1992-1993 (2001); and Soler-Bistué et al., Molecules 24(12):2297 (2019).
[0055] In an embodiment, the present invention provides assays, such as sandwich immunoassays, that utilize novel components to improve assay sensitivity, increase assay signal, reduce non-specific background signal and non-specific binding interactions of assay components, and / or improve assay robustness to changes in temperature and / or assay run time. In an embodiment, the assay comprises: extending a nucleic acid primer to form an extended oligonucleotide; binding the extended oligonucleotide to an anchor oligonucleotide; binding a labeled probe comprising a detection oligonucleotide to the extended oligonucleotide; and detecting the labeled probe bound to the extended oligonucleotide, wherein the amount of extended oligonucleotide corresponds to the amount of analyte. In an embodiment, the present invention provides detection oligonucleotides, for example, comprising RNA, modified nucleic acids, or a combination thereof. In an embodiment, the present invention provides anchor oligonucleotides, for example, comprising modified nucleic acids. In an embodiment, the present invention provides an efficient extension step, for example, by cleaving a template oligonucleotide. In an embodiment, the present invention provides compositions and kits comprising the components disclosed herein.
[0056] In an embodiment, the present invention provides a method for detecting an analyte, the method comprising:
[0057] (a) contacting a template oligonucleotide with a first complex comprising: (1) the analyte; and (2) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer;
[0058] (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide;
[0059] (c) binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and
[0060] (d) detecting the detectable label, thereby detecting the analyte,
[0061] wherein the second complex is bound to a surface, and wherein:
[0062] (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof;
[0063] (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide;
[0064] (iii) a combination of (i) and (ii);
[0065] (iv) One or both of (i) and (ii), further wherein the surface comprises an anchoring agent;
[0066] (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or
[0067] (vi) Any combination of (i), (ii) and (v).
[0068] In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; the method comprises terminating extension by cleaving the template oligonucleotide. In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and the surface comprises an anchoring agent. In embodiments, the method comprises terminating extension by cleaving the template oligonucleotide; and the surface comprises an anchoring agent. In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; the method comprises terminating extension by cleaving the template oligonucleotide; and the surface comprises an anchoring agent. In embodiments, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10. In embodiments, the cleavage comprises contacting a nuclease with the template oligonucleotide, wherein the nuclease comprises one or more restriction enzymes as shown in Table 1. In an embodiment, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI or a combination thereof. In an embodiment, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6 or 16. In an embodiment, the anchor oligonucleotide comprises the sequence of any one of SEQ ID NOs: 11, 17 and 21-37.
[0069] Table 1. Exemplary restriction enzymes
[0070]
[0071] In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10; and one or both of the following:
[0072] The method comprises terminating extension by cleavage of a template oligonucleotide, e.g., comprising a sequence of any one of SEQ ID NOs: 5, 6, or 16; and
[0073] The surface comprises an anchoring agent.
[0074] In embodiments, the method comprises terminating extension by cleavage of a template oligonucleotide, e.g., comprising a sequence of any one of SEQ ID NOs: 5, 6, or 16; wherein the cleavage comprises contacting a nuclease with the template oligonucleotide, wherein the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and one or both of:
[0075] The detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and
[0076] The surface comprises an anchoring agent.
[0077] In embodiments, the surface comprises an anchoring agent, wherein the anchoring agent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11 and 21-37, and one or both of:
[0078] The detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and
[0079] The method comprises terminating extension by cleavage of the template oligonucleotide, eg, comprising the sequence of any one of SEQ ID NO: 5, 6, or 16.
[0080] In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10;
[0081] The method comprises terminating extension by cleaving the template oligonucleotide, e.g., comprising a sequence of any one of SEQ ID NOs: 5, 6, or 16, wherein the cleavage comprises contacting the template oligonucleotide with a nuclease, wherein the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and
[0082] The surface comprises an anchoring agent.
[0083] In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10;
[0084] The method comprises terminating extension by cleaving the template oligonucleotide, for example comprising a sequence of any one of SEQ ID NOs: 5, 6, or 16; and
[0085] The surface comprises an anchoring agent, wherein the anchoring agent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 21-37.
[0086] In an embodiment, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof;
[0087] The method comprises terminating extension by cleaving the template oligonucleotide, e.g., comprising a sequence of any one of SEQ ID NOs: 5, 6, or 16, wherein the cleavage comprises contacting the template oligonucleotide with a nuclease, wherein the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and
[0088] The surface comprises an anchoring agent, wherein the anchoring agent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 21-37.
[0089] In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10;
[0090] The method comprises terminating extension by cleaving the template oligonucleotide, e.g., comprising a sequence of any one of SEQ ID NOs: 5, 6, or 16, wherein the cleavage comprises contacting the template oligonucleotide with a nuclease, wherein the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and
[0091] The surface comprises an anchoring agent, wherein the anchoring agent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 21-37.
[0092] Detection Reagents
[0093] In embodiments, the method comprises contacting a template oligonucleotide with a first complex comprising an analyte and a detection reagent. In embodiments, the detection reagent specifically binds to the analyte. In embodiments, the detection reagent comprises a nucleic acid primer.
[0094] In an embodiment, the detection reagent comprises a protein or polypeptide, an antibody or its antigen-binding fragment, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope or an aptamer. In an embodiment, the detection reagent comprises an antibody or a variant thereof, including its antigen / epitope binding portion, an antibody fragment or derivative, an antibody analog, an engineered antibody or a substance that binds to an antigen in a manner similar to an antibody. In an embodiment, the detection reagent comprises at least one heavy chain or light chain complementary determining region (CDR) of an antibody. In an embodiment, the detection reagent comprises at least two CDRs from one or more antibodies. In an embodiment, the detection reagent comprises an antibody or its antigen-binding fragment. In an embodiment, the detection reagent comprises an antigen-binding domain that specifically binds to an epitope of an analyte. In an embodiment, the detection reagent comprises an oligonucleotide. In an embodiment, the analyte comprises an oligonucleotide, and the detection reagent and analyte comprise complementary oligonucleotides.
[0095] Nucleic acid primers
[0096] In an embodiment, the detection reagent is connected to a nucleic acid primer. In an embodiment, the detection reagent comprises an oligonucleotide, and the nucleic acid primer is located at the 5' end or the 3' end of the oligonucleotide. In an embodiment, the detection reagent comprises an antibody or an antigen-binding fragment thereof, and the nucleic acid primer is conjugated to the detection reagent. The conjugation of nucleic acids to biomolecules such as antibodies or antigen-binding fragments thereof is known to those of ordinary skill in the art. For example, the conjugation of nucleic acid primers to detection reagents is described in WO 2020 / 180645.
[0097] In embodiments, the nucleic acid primer is about 10 to about 30 nucleotides in length, or about 12 to about 28 nucleotides in length, or about 13 to about 26 nucleotides in length, or about 14 to about 24 nucleotides in length, or about 11 to about 22 nucleotides in length, or about 12 to about 21 nucleotides in length, or about 13 to about 20 nucleotides in length, or about 13 to about 18 nucleotides in length, or about 14 to about 19 nucleotides in length. In embodiments, the nucleic acid primer is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides in length.
[0098] In an embodiment, the nucleic acid primer is about 14 nucleotides in length or about 15 nucleotides in length.In an embodiment, the nucleic acid primer comprises or consists of a sequence shown in Table 2.
[0099] Table 2. Exemplary nucleic acid primer sequences
[0100] 5'-GACAGAACTAGACAC-3' SEQ ID NO: 1 5'-ACAGAACTAGACAC-3' SEQ ID NO:2 5'-GACAGAACTAGACA-3' SEQ ID NO:3 5'-TGCACAGCTCGACGC-3' SEQ ID NO:4
[0101] In an embodiment, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 1-4. In an embodiment, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 1-4.
[0102] Template oligonucleotide
[0103] In embodiments, the nucleic acid primer comprises a complementary region to a template oligonucleotide. In embodiments, the template oligonucleotide is a template for nucleic acid amplification, e.g., by polymerase chain reaction (PCR); nick and extension amplification (NEAR); isothermal amplification methods such as strand displacement amplification (SDA), helicase-dependent amplification (HDA), or rolling circle amplification (RCA); or a combination thereof.
[0104] In an embodiment, the template oligonucleotide is about 40 to about 100 nucleotides in length, or about 50 to about 78 nucleotides in length, or about 53 to about 76 nucleotides in length, or about 50 to about 70 nucleotides in length, or about 53 to about 61 nucleotides in length, or about 54 to about 61 nucleotides in length. In an embodiment, the template oligonucleotide is about 53, about 54, about 55, about 56, about 57, about 58, about 59, about 60, about 61, about 62, about 63, about 64, about 65, about 66, about 67, about 68, about 69, about 70, about 71, about 72, about 73, about 74, about 75, or about 76 nucleotides in length.
[0105] In an embodiment, the template oligonucleotide comprises the sequence 5'-GTTCTGTC-3' at its 5' end and the sequence 5'-GTGTCTA-3' at its 3' end. In an embodiment, the template oligonucleotide comprises or consists of the sequence shown in Table 3.
[0106] Table 3. Exemplary template oligonucleotide sequences
[0107]
[0108] In an embodiment, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6 and 16. In an embodiment, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 5, 6 and 16.
[0109] In an embodiment, the template oligonucleotide comprises one or more linker oligonucleotides, wherein the one or more linker oligonucleotides can be connected to form a circular template. In an embodiment, the 5' end and 3' end of the template oligonucleotide can hybridize with the first and second districts of the nucleic acid primer. In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the template oligonucleotide is a circular oligonucleotide, and the method comprises hybridizing the circular oligonucleotide with the nucleic acid primer to form a second complex as described herein. In an embodiment, the template oligonucleotide is a linear oligonucleotide, wherein the 5' end and 3' end of the linear oligonucleotide can be connected to form a circular oligonucleotide. In an embodiment, the 5' end and 3' end of the linear oligonucleotide are connected after the 5' end and 3' end of the template oligonucleotide hybridize with the first and second districts of the nucleic acid primer. In an embodiment, the template oligonucleotide is a linear oligonucleotide, and the method comprises connecting the 5' end and 3' end of the linear oligonucleotide before, during or after the nucleic acid primer hybridizes with the template oligonucleotide, thereby forming a circular template.
[0110] In an embodiment, the nucleic acid primer is hybridized with the template oligonucleotide to form a second complex, and the nucleic acid primer is extended by PCR. In an embodiment, the nucleic acid primer is hybridized with the template oligonucleotide to form a second complex, and the nucleic acid primer is extended by NEAR. In an embodiment, the template oligonucleotide is a circular oligonucleotide, and the nucleic acid primer is hybridized with the circular oligonucleotide, and the nucleic acid primer is extended by RCA. In an embodiment, the nucleic acid primer is hybridized with the template oligonucleotide, the template oligonucleotide is connected to form a circular template, and the nucleic acid primer is extended by RCA. In an embodiment, the extension (e.g., PCR, NEAR or RCA) is carried out at about 15°C to about 35°C, or about 18°C to about 30°C or about 20°C to about 27°C. In an embodiment, the extension (e.g., PCR, NEAR or RCA) is performed for about 5 minutes to about 120 minutes, or about 5 minutes to about 90 minutes, or about 45 minutes to about 90 minutes, or about 30 minutes to about 60 minutes, or about 15 minutes to about 30 minutes, or about 10 minutes to about 20 minutes, or about 5 minutes to about 10 minutes. In an embodiment, the nucleic acid primer is extended to form an extended oligonucleotide.
[0111] polymerase
[0112] In an embodiment, the nucleic acid primer is extended by a polymerase. In an embodiment, the polymerase can perform PCR, NEAR or isothermal amplification methods (such as SDA, HDA or RCA). In an embodiment, the polymerase can perform SDA, i.e., displace the downstream DNA encountered during synthesis. In an embodiment, the polymerase can perform multiple displacement amplification (MDA). Non-limiting examples of polymerases that can perform PCR, NEAR, SDA, HDA and / or RCA include Taq polymerase, Vent polymerase, T4 polymerase, T7 polymerase, Phi29 polymerase, Bst polymerase, polymerases from Bacillus (Bacillus) phage Nf, Karezi and BeachBum (also referred to herein as "Nf polymerase", "Karezi polymerase" and "BeachBum polymerase") and polymerases from other Phi29-like phages, for example, as described in Stanton et al., "Viruses" 13:1557 (2021).
[0113] In embodiments, the polymerase comprises strand displacement activity and is referred to herein as "SD polymerase". In embodiments, the SD polymerase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a DNA polymerase from a bacteriophage. In embodiments, the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence having at least 80% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence having at least 90% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In an embodiment, the SD polymerase is a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.
[0114] Template cutting
[0115] In an embodiment, the method further comprises terminating the extension of the nucleic acid primer by the cutting template oligonucleotide. It is surprising to find that the cutting of the template oligonucleotide produces a more stable determination endpoint, which provides many advantages, including for example: allowing determination without the need for strict determination time and / or temperature conditions; Shortening the amplification time while improving the reproducibility of amplification, such as between multiple holes of an assay plate; Allowing determination of optimal determination signal; and controlling background signal. The determination that can be performed without strict timing and / or temperature requirements provides valuable flexibility, for example, in the case where the assay plate is processed in batches (for example, in non-instrumented instant (POC) devices and automated instruments) and may not allow optimal determination timing, for example, due to time arrangement constraints.
[0116] In embodiments, the cleavage comprises contacting the nuclease with the template oligonucleotide. In embodiments, the template oligonucleotide is contacted with the nuclease and the polymerase simultaneously or substantially simultaneously. Surprisingly, it has been discovered that fine-tuning the ratio of polymerase to nuclease within the same reaction can result in a more robust assay procedure. Including a nuclease in the polymerase allows both enzymes to function together and achieves the desired result of reducing the temperature and time sensitivity of the reaction, thereby improving assay robustness. Fine-tuning enzymatic activity, such as polymerase amplification of the template and nuclease cleavage, as well as preventing further polymerase activity, optimizes assay robustness. When the two enzymatic activities are appropriately matched, the reaction is governed by a balance between the two enzymatic activities within the reaction: polymerase amplification of the template oligonucleotide and nuclease amplification, preventing further amplification of the template oligonucleotide by the polymerase. This balance of opposing activities, defined by the concentrations of the polymerase and nuclease, results in an amount of extended oligonucleotide formed in the reaction that is insensitive to changes in temperature and time, rendering the reaction substantially unaffected by temperature and / or time. In embodiments, the reaction is performed at approximately 20°C to approximately 27°C while maintaining a substantially consistent assay signal. In embodiments, the use of polymerases and nucleases allows the assay to be performed without the need for a temperature-controlled incubator.
[0117] In embodiments, the nuclease specifically cleaves the template oligonucleotide. In embodiments, the nuclease does not cleave a nucleic acid primer or an extended oligonucleotide. In embodiments, the nuclease specifically cleaves a double-stranded oligonucleotide, such as a double-stranded DNA, double-stranded RNA, or double-stranded DNA / RNA hybrid. In embodiments, the double-stranded DNA, double-stranded RNA, or double-stranded DNA / RNA hybrid comprises a template oligonucleotide and a nucleic acid primer hybridized thereto.
[0118] In an embodiment, each of the template oligonucleotide and the nucleic acid primer comprises single-stranded DNA, which forms a double-stranded DNA oligonucleotide when hybridized. In an embodiment, the nuclease specifically cuts the double-stranded oligonucleotide formed by hybridization of the template oligonucleotide and the nucleic acid primer. In an embodiment, the nuclease is a restriction endonuclease (also referred to as a restriction enzyme). Non-limiting examples of usable restriction endonucleases include the restriction enzymes shown in Table 1. In an embodiment, the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI or a combination thereof.
[0119] In an embodiment, one of the template oligonucleotide or the nucleic acid primer comprises single-stranded DNA, and the other comprises single-stranded RNA, and the single-stranded DNA and the single-stranded RNA form a double-stranded DNA / RNA hybrid when hybridized. In an embodiment, the nuclease specifically cuts the DNA / RNA hybrid formed by the hybridization of the template oligonucleotide and the nucleic acid primer. Non-limiting examples of nucleases capable of cutting DNA / RNA hybrids include RNase H (including RNase H1, H2 and H3) and restriction endonucleases AvaII, AvrII, BanI, Sau3AI, BstNI, NciI, MvaI, BcnI and MspI. In an embodiment, the nuclease is an endoribonuclease. Non-limiting examples of the endoribonuclease include RNase III, RNase A, RNase T1, RNase T2 and RNase H. In an embodiment, the nuclease is RNase H2.
[0120] In an embodiment, the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator and cleaves the template oligonucleotide. In an embodiment, the DNA damage indicator is not present in the nucleic acid primer or the extended oligonucleotide, and the nuclease does not bind to or cleave the nucleic acid primer or the extended oligonucleotide.
[0121] In an embodiment, the DNA damage indicator comprises a nucleobase that is not normally present in DNA, and the nuclease cuts DNA containing such a nucleobase. In an embodiment, the DNA damage indicator comprises a uracil base, and the nuclease comprises uracil-N-glycosylase (UNG). UNG may leave an abasic site at the cleavage point. In an embodiment, the cleavage further comprises providing an abasic site endonuclease. In an embodiment, the abasic site endonuclease comprises uracil-DNA glycosylase (UDG), apurinic / apyrimidinic (AP) endonuclease 1 (APE1), endonuclease IV, or a combination thereof.
[0122] In an embodiment, the DNA damage indicator comprises deoxyinosine and the nuclease comprises endonuclease V. In an embodiment, the DNA damage indicator comprises a damaged purine and the nuclease comprises an enzyme that repairs the damaged purine. In an embodiment, the damaged purine comprises 8-oxoguanine (8oxoG) and the nuclease comprises formamidopyrimidine DNA glycosylase (Fpg).
[0123] As described herein, the method comprising terminating the extension by cutting the template oligonucleotide provides several advantages over the method not comprising the termination. In an embodiment, the assay signal range produced by the method comprising the termination is more stable than the method not comprising the termination, and is less prone to change based on assay temperature and / or extension time. As used herein, "assay signal range" refers to the ratio of the maximum signal to the minimum signal of an assay performed under specified conditions (e.g., an assay temperature range of 20°C to 30°C or an extension time range of about 5 minutes to about 90 minutes).
[0124] In an embodiment, the method comprising terminating the extension as described herein is less sensitive to changes in assay temperature than a method not comprising said termination. In an embodiment, the extension comprises RCA, and the termination comprises cleaving the template oligonucleotide as described herein, for example with a nuclease as described herein. In an embodiment, the RCA is performed at about 15°C to about 35°C, or about 18°C to about 30°C, or about 20°C to about 27°C. In an embodiment, the range of assay signals generated by the method is substantially unchanged when the method is performed at about 20°C to about 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, or 30°C.
[0125] In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 4-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 4-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 3-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal produced by the method varies by no more than 1.5-fold over the assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C.
[0126] In embodiments, the range of the assay signal generated by the methods described herein varies by no more than ±50% over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal generated by the methods described herein varies by no more than ±40% over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal generated by the methods described herein varies by no more than ±30% over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the range of the assay signal generated by the methods described herein varies by no more than ±20% over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the method does not vary by more than ±10% over an assay temperature range of about 17°C to about 30°C, or about 18°C to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C.
[0127] In embodiments, the methods described herein comprising terminating the extension are less sensitive to variations in extension time than methods not comprising such terminating. In embodiments, the extension comprises RCA, and the terminating comprises cleaving the template oligonucleotide as described herein. In embodiments, the extension comprises RCA, and the terminating comprises cleaving the template oligonucleotide as described herein, e.g., with a nuclease as described herein. In embodiments, the RCA is performed at about 15°C to about 35°C, or about 18°C to about 30°C, or about 20°C to about 27°C. In embodiments, the range of assay signals generated by the method is substantially unchanged when the method is performed over an extended time range of about 5 minutes to about 150 minutes, or about 10 minutes to about 120 minutes, or about 15 minutes to about 90 minutes, or about 20 minutes to about 60 minutes, or about 30 minutes to about 45 minutes, or about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, about 60 minutes, about 75 minutes, about 90 minutes, about 105 minutes, or about 120 minutes.
[0128] In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 5 to about 120 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 30 to about 120 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 20 to about 90 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 10 to about 45 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 5 to about 30 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of 5 to about 15 minutes.
[0129] In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 5 to about 90 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 45 to about 90 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 30 to about 60 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 15 to about 30 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of about 10 to about 20 minutes. In embodiments, the range of the assay signal generated by the methods described herein varies no more than 5-fold, no more than 4-fold, no more than 3-fold, or no more than 2-fold over an extended time range of 5 to about 10 minutes.
[0130] In an embodiment, the method comprising terminating the extension as described herein has a more stable assay endpoint compared to a method not comprising said termination. In an embodiment, the method comprising terminating the extension provides extended oligonucleotides of consistent length. In an embodiment, the extension comprises RCA, and the termination comprises cutting the template oligonucleotide as described herein. In an embodiment, the extension comprises RCA, and the termination comprises cutting the template oligonucleotide as described herein, for example with a nuclease as described herein. In an embodiment, the RCA is performed at about 15°C to about 35°C, or about 18°C to about 30°C, or about 20°C to about 27°C. In an embodiment, the method comprising the termination forms shorter extended oligonucleotides compared to a method not comprising said termination.
[0131] Extended oligonucleotides
[0132] In embodiments, the length of the extended oligonucleotide formed by the methods described herein is about 100 to about 100,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 200 to about 75,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 500 to about 50,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 700 to about 20,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 1,000 to about 15,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 2,000 to about 10,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 3,000 to about 8,000 bases. In embodiments, the length of the extended oligonucleotide formed by the methods is about 4,000 to about 7,000 bases. In embodiments, the extended oligonucleotides formed by the methods are about 5000 to about 6000 bases in length.
[0133] In embodiments, the length of the extended oligonucleotides formed by the methods described herein is about 100 to about 80,000 bases, or about 200 to about 60,000 bases, or about 500 to about 50,000 bases. In embodiments, the length of the extended oligonucleotides formed by the methods described herein is about 4,000 to about 100,000 bases, or about 7,500 to about 75,000 bases, or about 9,000 to about 40,000 bases. In embodiments, the length of the extended oligonucleotides formed by the methods described herein is about 1,000 to about 50,000 bases, or about 2,000 to about 25,000 bases, or about 3,000 to about 13,000 bases. In embodiments, the extended oligonucleotides formed by the methods are about 100 to about 8000 bases, or about 500 to about 6000 bases, or about 1000 to about 4500 bases in length.
[0134] In embodiments, the length of an extended oligonucleotide formed by a method described herein is about 1% to about 60%, or about 2% to about 50%, or about 3% to about 45%, or about 4% to about 40%, or about 5% to about 35%, or about 6% to about 32%, or about 8% to about 30%, or about 10% to about 28%, or about 12% to about 25%, or about 15% to about 22%, or about 18% to about 20% of an extended oligonucleotide formed by a method that does not comprise the termination and is otherwise substantially the same as the method described herein (i.e., "substantially the same method that does not comprise the termination").
[0135] In embodiments, the length of the extended oligonucleotide formed by the methods described herein is about 1% to about 50%, about 3% to about 40%, or about 5% to about 35% of the extended oligonucleotide formed by substantially the same method not comprising the termination. In embodiments, the length of the extended oligonucleotide formed by the methods described herein is about 2% to about 40%, about 4% to about 37%, or about 6% to about 32% of the extended oligonucleotide formed by substantially the same method not comprising the termination. In embodiments, the length of the extended oligonucleotide formed by the methods described herein is about 1% to about 20%, about 1% to about 15%, or about 1% to about 10% of the extended oligonucleotide formed by substantially the same method not comprising the termination.
[0136] In embodiments, the extended oligonucleotide formed by polymerase extension of a nucleic acid primer as described herein comprises a single-stranded oligonucleotide. In embodiments, the extended oligonucleotide is capable of binding to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide, and (2) a detectable label. In embodiments, the template oligonucleotide comprises a region comprising the same sequence as the detection oligonucleotide, thereby generating an extended oligonucleotide comprising a sequence complementary to the detection oligonucleotide, also referred to herein as a "detection oligonucleotide complement."
[0137] Detection oligonucleotides
[0138] In embodiments, the extended oligonucleotide is bound to a detection oligonucleotide, for example, by hybridization of a complementary oligonucleotide. In embodiments, the detection oligonucleotide comprises a single-stranded oligonucleotide. In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof.
[0139] Surprisingly found that the detection oligonucleotides provided herein reduce the inhibition of polymerase (e.g., SD polymerase described herein), and the detection oligonucleotides are short oligonucleotides having a length of about 3 to about 30 nucleotides, a length of about 5 to about 25 nucleotides, or a length of about 6 to about 12 nucleotides, and comprise RNA and / or modified nucleic acids as described herein. The inhibition of polymerase is reduced so that the detection oligonucleotide can be added to the assay reaction simultaneously or substantially simultaneously with the polymerase, which reduces assay complexity. The additional advantages of shorter detection oligonucleotides include, for example, that multiple (e.g., at least 2 or at least 3) detection oligonucleotides can be combined with the extended oligonucleotides described herein, which increases the assay signal; and compared to conventional detection oligonucleotides, shorter oligonucleotides require lower costs and less work to produce and verify. Compared to conventional detection oligonucleotides described in WO 2014 / 165061; WO 2014 / 160192; and WO 2015 / 175856, the detection oligonucleotides provided herein still produce higher assay signals even when provided at lower concentrations. In an embodiment, incorporating RNA and / or modified nucleic acids into the short detection oligonucleotides described herein significantly reduces the assay background signal. In an embodiment, the detection oligonucleotides comprising RNA and / or modified nucleic acids have a higher binding affinity for the extended oligonucleotides compared to detection oligonucleotides of the same length and not comprising any RNA or modified nucleic acids, and thus reduce non-specific binding and less background signal. It was further unexpectedly discovered that RNA oligonucleotides can be used as detection oligonucleotides, which was not feasible before because RNA is unstable and sensitive to RNases. Therefore, surprisingly, RNA-based detection oligonucleotides provide performance comparable to DNA-based detection oligonucleotides in the methods of the present invention, without the need for additional measures to maintain an RNase-free environment. Modified nucleic acids are further described herein.
[0140] In embodiments, the detection oligonucleotide comprises RNA. In embodiments, the detection oligonucleotide consists of RNA. In embodiments, the detection oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide consists of a modified nucleic acid. In embodiments, the detection oligonucleotide comprises a combination of RNA and a modified nucleic acid. In embodiments, the modified nucleic acid is a modified RNA nucleic acid. In embodiments, the modified nucleic acid is a modified DNA nucleic acid.
[0141] In an embodiment, the modified nucleic acid comprises a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a nucleoside comprising a 2' modification, or a combination thereof. In an embodiment, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof. In an embodiment, the detection oligonucleotide comprises a single modified nucleic acid, e.g., a PNA monomer, an LNA monomer, a BNA monomer, or a single nucleoside comprising a 2' modification. In an embodiment, the detection oligonucleotide comprises more than one modified nucleic acid, e.g., more than one PNA, LNA, BNA monomer and / or a nucleoside comprising a 2' modification.
[0142] In an embodiment, the detection oligonucleotide comprises one or more PNAs. In an embodiment, the detection oligonucleotide comprises one or more LNAs. In an embodiment, the detection oligonucleotide comprises one or more BNAs. PNAs, LNAs, and BNAs are further described herein.
[0143] In an embodiment, the detection oligonucleotide comprises one or more nucleosides comprising a 2' modification, also referred to herein as "2'-modified nucleosides". In an embodiment, the 2'-modified nucleosides comprise a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof. See, for example, Duffy et al., BMC Biology 18:112 (2020).
[0144] In an embodiment, the detection oligonucleotide comprises modified nucleic acid, and the modified nucleic acid comprises backbone modification, such as in the phosphate backbone of one or more nucleotides.Exemplary backbone modifications include but are not limited to using phosphorothioate, borane phosphate, methyl phosphonate, phosphoramidate (such as, morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite or 3 '-O-phosphopropylamino substitute phosphate.See, for example, Wickstrom et al., " Advanced Drug Delivery Comments (AdvDrug Deliver Rev) " 87:25-34 (2015).
[0145] In an embodiment, the detection oligonucleotide is composed of modified nucleic acids, i.e., each nucleotide of the detection oligonucleotide comprises a modified nucleic acid as described herein. In an embodiment, each modified nucleic acid of the detection oligonucleotide comprises PNA, LNA, BNA, comprises a 2'-modified nucleoside, or a combination thereof. In an embodiment, the detection oligonucleotide composed of modified nucleic acids has reduced nonspecific binding and lower background signal compared to detection oligonucleotides comprising only unmodified nucleic acids or a combination of modified and unmodified nucleic acids.
[0146] In an embodiment, the detection oligonucleotide is about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length or about 8 to about 12 nucleotides in length. In an embodiment, the detection oligonucleotide is about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 nucleotides in length. As used herein, the detection oligonucleotide provided herein is short enough so that a plurality of detection oligonucleotides, for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 18 detection oligonucleotides can be combined with the extended oligonucleotides described herein. Further, the detection oligonucleotides provided herein are short enough so that polymerase activity, such as the polymerase activity of the SD polymerase described herein, is not substantially inhibited in the presence of the detection oligonucleotide. As used herein, when referring to enzyme activity under different conditions (e.g., the presence or absence of a detection oligonucleotide), the term "substantially" means that the enzyme activity changes (increases or decreases) by no more than 20%, more than 15%, more than 10%, more than 5%, or more than 1% under the different conditions.
[0147] In embodiments, the methods described herein comprise contacting a nucleic acid primer with (i) a polymerase and (ii) a labeled probe comprising a detection oligonucleotide described herein simultaneously or substantially simultaneously, wherein the polymerase extends the nucleic acid primer to form an extended oligonucleotide that binds to the detection oligonucleotide of the labeled probe, and wherein the polymerase activity of the polymerase is substantially uninhibited by the detection oligonucleotide. In some embodiments, the activity of the polymerase remains substantially the same in the presence of the detection oligonucleotide, e.g., a change of no more than 20%, no more than 15%, no more than 10%, no more than 5%, or no more than 1%, compared to the activity of the polymerase under the same conditions except for the absence of the detection oligonucleotide. In embodiments, the polymerase is an SD polymerase described herein. In embodiments, the SD polymerase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a DNA polymerase from a bacteriophage. In embodiments, the phage is Phi29, Nf, Karezi, or BeachBum.
[0148] In an embodiment, the detection oligonucleotide comprises or consists of a sequence as shown in Table 4. As used herein in nucleic acid sequences, a lowercase "m" before a nucleobase indicates a 2'-O-methyl modification in the nucleobase. As used herein in nucleic acid sequences, a "+" before a nucleobase indicates LNA.
[0149] Table 4. Exemplary detection oligonucleotide sequences
[0150] mG+A+G+T+C+CmGmUmCmU SEQ ID NO:7 C+A+G+T+G+AA+TGC SEQ ID NO:8 G+A+G+T+C+C+GTCT SEQ ID NO:9 G+A+G+T+C+CGTCT SEQ ID NO: 10
[0151] In an embodiment, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 7-10 and 12-15. In an embodiment, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 7-10 and 12-15.
[0152] Detectable label
[0153] In an embodiment, the labeled probe comprises detection oligonucleotide and detectable label as described herein.In an embodiment, the labeled probe comprises more than one detectable label.In an embodiment, the labeled probe comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 detectable labels.In an embodiment, one or more detectable labels are connected with the detection oligonucleotide, for example, with the 5' end or 3' end of the detection oligonucleotide. The method of connecting detectable label to oligonucleotide (for example, detection oligonucleotide as described herein) is known to those of ordinary skill in the art, and is described in, for example, WO 2020 / 180645.
[0154] In an embodiment, detectable label can be detected by light scattering, light absorption, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, magnetic field or its combination. In an embodiment, the method is a multiplex method capable of detecting at least two unique analytes, and the detectable label of each unique analyte comprises different detectable signals. Multiplex methods are further described herein. In an embodiment, detectable label comprises a fluorescent label, and different fluorescence characteristics (e.g., fluorescence wavelength and / or intensity) are associated with each unique analyte, thereby allowing unique analytes to be distinguished from each other.
[0155] In embodiments, the detectable label is an ECL label. In embodiments, the labeled probe comprises about 1 to 10, or about 2 to 5, or about 3 to 4 ECL labels. In embodiments, the labeled probe comprises three ECL labels. In embodiments, the ECL label comprises an electrochemiluminescent organometallic complex of ruthenium, osmium, iridium, rhenium, and / or a lanthanide metal. In embodiments, the ECL label comprises an organometallic complex comprising at least one substituted bipyridine ligand, wherein the substituted bipyridine ligand comprises at least one sulfonate group. In embodiments, the ECL label comprises an organometallic complex comprising at least two substituted bipyridine ligands, wherein each substituted bipyridine ligand comprises at least one sulfonate group. Exemplary ECL labels can be found in US 5,714,089; US 6,136,268; US 6,316,607; US 6,468,741; US 6,479,233; US 6,808,939 and US 9,499,573.
[0156] In embodiments, the method comprises detecting the detectable label. In embodiments, the detection comprises measuring light scattering, light absorption, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, magnetic field or a combination thereof. In embodiments, the measured amount of the detectable label is used to determine the amount of analyte present in the sample.
[0157] In an embodiment, the method comprises detecting the amount of detectable label present in the second complex on the surface. In an embodiment, the second comprises an analyte, a detection reagent bound to the analyte, an extended oligonucleotide formed by a nucleic acid primer on the detection reagent, and a labeled probe bound to the extended oligonucleotide. In an embodiment, the surface comprises particles. In an embodiment, the surface comprises the holes of a multi-well plate. Surfaces are further described herein. In an embodiment, the surface comprises particles, the detectable label comprises a fluorescent label, and the method comprises detecting the fluorescent label by a particle analysis method. The method of analyzing, for example, particles comprising fluorescent labels is known to those of ordinary skill in the art. In an embodiment, the particle analysis method comprises detecting the detectable label by flow cytometry. In an embodiment, the particle analysis method comprises fixing the particles on a particle collection surface, and detecting the detectable label on the fixed particles. In an embodiment, the particles are fixed in a single layer on the particle collection surface. In an embodiment, the particle collection surface comprises an electrode. In an embodiment, the particle collection surface comprises a slide (e.g., a microscope slide), a chip or a flow cell. In an embodiment, immobilized particles are detected by imaging a particle collection surface and determining the number of particles comprising a detectable label (e.g., a fluorescent label). In an embodiment, the detectable label comprises an ECL label and the surface comprises an electrode. In an embodiment, the electrode comprises a carbon ink electrode. In an embodiment, the detection comprises applying a voltage waveform (e.g., an electric potential) to the electrode to generate an ECL signal. In an embodiment, the surface comprises particles, and the method comprises collecting particles on the electrode and applying a voltage waveform (e.g., an electric potential) to the electrode to generate an ECL signal.
[0158] Anchoring reagent
[0159] In an embodiment, the second complex formed by hybridization of the template oligonucleotide and the nucleic acid primer is bound to the surface. In an embodiment, the surface comprises an anchoring agent. In an embodiment, the anchoring agent is bound to the extended oligonucleotide formed by extending the nucleic acid primer. In an embodiment, the second complex is bound to the surface by binding the extended oligonucleotide to the anchoring agent on the surface. In an embodiment, the binding of the extended oligonucleotide to the anchoring agent stabilizes the second complex on the surface. In an embodiment, the binding of the extended oligonucleotide to the anchoring agent promotes the binding of the labeled probe to the extended oligonucleotide and improves the assay signal. Anchoring agents are further described, for example, in WO 2014 / 165061; WO 2014 / 160192; WO 2015 / 175856; and WO 2020 / 180645.
[0160] In an embodiment, the template oligonucleotide comprises a region comprising the same sequence as the anchor oligonucleotide, thereby producing an extended oligonucleotide comprising a sequence complementary to the anchor oligonucleotide, also referred to herein as the "anchor oligonucleotide complement". In an embodiment, the template oligonucleotide comprises a first region comprising the same sequence as the detection oligonucleotide and a second region comprising the same sequence as the anchor oligonucleotide, thereby producing an extended oligonucleotide comprising a first sequence complementary to the detection oligonucleotide and a second sequence complementary to the anchor oligonucleotide. In an embodiment, the extended oligonucleotide is combined with an anchoring agent prior to or simultaneously with binding to a labeled probe as described herein. In an embodiment, the extended oligonucleotide is combined with an anchoring agent prior to contacting with the labeled probe. In an embodiment, the extended oligonucleotide is contacted with an anchoring agent and a labeled probe simultaneously or substantially simultaneously.
[0161] In an embodiment, the anchoring agent comprises an oligonucleotide, an aptamer, an aptamer ligand, an antibody, an antigen, a ligand, a receptor, a hapten, an epitope, or a mimotope. In an embodiment, the anchoring agent comprises an aptamer ligand, and the extended oligonucleotide comprises an aptamer. In an embodiment, the anchoring agent comprises an oligonucleotide binding protein, and the extended oligonucleotide comprises a sequence capable of binding to the protein. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide. In an embodiment, the anchoring oligonucleotide comprises a single-stranded oligonucleotide. In an embodiment, the anchoring oligonucleotide comprises a double-stranded oligonucleotide.
[0162] In embodiments, binding the extended oligonucleotide to the anchoring agent comprises forming a triple helix between the anchoring oligonucleotide and the extended oligonucleotide. In embodiments, binding the extended oligonucleotide to the anchoring agent comprises denaturing the extended oligonucleotide to expose a single-stranded oligonucleotide region prior to binding. In embodiments, binding the extended oligonucleotide to the anchoring agent comprises exposing the extended oligonucleotide to a helicase activity prior to binding. In embodiments, binding the extended oligonucleotide to the anchoring agent comprises exposing the extended oligonucleotide to a nuclease treatment prior to binding. In embodiments, the extended oligonucleotide comprises one or more hapten-modified bases, and the anchoring agent comprises one or more antibodies specific for a hapten. In embodiments, the hapten of the hapten-modified base comprises digoxigenin, and the anchoring agent comprises an anti-digoxigenin antibody. In embodiments, the extended oligonucleotide comprises one or more ligand-modified bases, and the anchoring agent comprises one or more receptors specific for a ligand. In embodiments, the anchoring reagent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide and the extended oligonucleotide comprise complementary oligonucleotides, and binding the extended oligonucleotide to the anchoring reagent comprises hybridization of complementary oligonucleotides.
[0163] In an embodiment, the anchoring reagent provided herein comprises a length of about 3 to about 30 short oligonucleotides of nucleotide. Unexpectedly found that the short anchoring oligonucleotide has the stability of improvement during the mensuration washing step. Yet, shorter anchoring oligonucleotide may increase the sample matrix interference effect. The inventor further finds that the combination of short anchoring oligonucleotide length and modified nucleic acid provides improved mensuration stability, and does not increase the sample matrix interference. In an embodiment, compared with the anchoring oligonucleotide that does not comprise any modified nucleic acid, the anchoring oligonucleotide that comprises modified nucleic acid has the sample matrix interference and the background signal of reduction.
[0164] In an embodiment, the anchoring oligonucleotide comprises modified nucleic acid. Modified nucleic acid is further described herein. In an embodiment, the modified nucleic acid comprises modified base, modified sugar and / or modified backbone. In an embodiment, the modified nucleic acid comprises PNA, LNA, BNA, comprises 2' modified nucleosides or its combination. In an embodiment, the nucleosides comprising 2' modifications comprise 2'-OMe, 2'-MOE, 2'-F, 2'-OH or its combination. In an embodiment, the modified nucleic acid comprises backbone modification, for example, with thiophosphate, borane phosphate, methylphosphonate, phosphoramidate (for example, morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or its combination alternative phosphate backbone.
[0165] In an embodiment, the anchor oligonucleotide comprises a single modified nucleic acid, e.g., a PNA monomer, an LNA monomer, a BNA monomer, or a single nucleoside comprising a 2' modification. In an embodiment, the anchor oligonucleotide comprises more than one modified nucleic acid, e.g., more than one PNA, LNA, BNA monomer and / or a nucleoside comprising a 2' modification.
[0166] In an embodiment, the anchoring oligonucleotide is composed of a modified nucleic acid, i.e., wherein each nucleotide of the anchoring oligonucleotide comprises a modified nucleic acid as described herein. In an embodiment, each modified nucleic acid of the anchoring oligonucleotide comprises a PNA, an LNA, a BNA, a 2'-modified nucleoside, or a combination thereof. In an embodiment, the anchoring oligonucleotide composed of a modified nucleic acid has reduced non-specific binding and a lower background signal compared to an anchoring oligonucleotide comprising only unmodified nucleic acid or a combination of modified and unmodified nucleic acids.
[0167] In embodiments, the anchor oligonucleotide is about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length, or about 8 to about 12 nucleotides in length. In embodiments, the anchor oligonucleotide is about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In embodiments, the anchor oligonucleotides provided herein are sufficiently short such that the extended oligonucleotide binds to the anchor oligonucleotide with an affinity that is at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, or at least 10 times greater than that of an anchor oligonucleotide that is greater than about 30 nucleotides in length. In embodiments, anchor oligonucleotides that are about 4 to about 20 nucleotides in length and comprise a modified nucleic acid as described herein provide equivalent assay performance when present on a surface at the same concentration as an anchor oligonucleotide that is at least or about 25 nucleotides in length and does not comprise any modified nucleic acid.
[0168] In an embodiment, the anchor oligonucleotide comprises or consists of the sequence: mU+AmGmUmA+C+AmGmC (SEQ ID NO: 11), wherein the lowercase "m" before the nucleobase indicates a 2'-O-methyl modification in the nucleobase, and the "+" before the nucleobase indicates an LNA as described herein. In an embodiment, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 20-37. In an embodiment, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 11, 17, and 20-37.
[0169] In an embodiment, before step (a) of the method described herein, the anchoring agent is fixed on the surface. In an embodiment, before the nucleic acid primer is extended to form an extended oligonucleotide as described herein, the anchoring agent is fixed on the surface. In an embodiment, as described herein, before the extended oligonucleotide is combined with a labeled probe, the anchoring agent is fixed on the surface. In an embodiment, before detecting the detectable label of the labeled probe combined with the extended oligonucleotide, the anchoring agent is fixed on the surface. For example, the method and opportunity of fixing the anchoring agent on the surface are further described in US2022 / 0341923.
[0170] In an embodiment, the anchoring agent is directly fixed to the surface, for example, by covalently fixed to the surface via a covalent bond as described herein. In an embodiment, the covalent bond is formed by a reaction between a sulfhydryl group on the anchoring agent and the surface. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide is directly fixed to the surface. In an embodiment, the anchoring agent is indirectly fixed to the surface, for example, via a secondary binding partner as described herein. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide is indirectly fixed to the surface. In an embodiment, the anchoring agent is connected to a first binding partner, the surface comprises a second binding partner, and the anchoring agent is fixed to the surface via the interaction of the first binding partner and the second binding partner. In an embodiment, the first binding partner and the second binding partner comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners, or intercalator-target molecule pairs. In an embodiment, the first binding partner and the second binding partner comprise a cross-reactive moiety, for example, a thiol and a maleimide or iodoacetamide; an aldehyde and a hydrazide; or an azide and an alkyne or cycloalkyne. In an embodiment, the first binding partner comprises biotin, and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody, or a combination thereof. In an embodiment, the first binding partner and the second binding partner are bound to each other via a bridging agent that binds both the first binding partner and the second binding partner. In an embodiment, the bridging agent comprises at least two binding sites, wherein each of the first binding partner and the second binding partner binds to a different binding site. In an embodiment, the bridging agent comprises streptavidin or avidin, and each of the first binding partner and the second binding partner is biotin.
[0171] In an embodiment, the anchoring agent comprises an anchoring oligonucleotide and a first binding partner, wherein the first binding partner is connected to a nucleotide of the anchoring oligonucleotide. In an embodiment, the first binding partner is connected to an internal nucleotide of the anchoring oligonucleotide. In an embodiment, the first binding partner is located at the 5' end of the anchoring agent. In an embodiment, the first binding partner is located at the 3' end of the anchoring agent. In an embodiment, the first binding partner is connected to the 5' or 3' terminal nucleotide of the anchoring oligonucleotide. In an embodiment, the anchoring agent comprises a spacer located between the first binding partner and the anchoring oligonucleotide. In an embodiment, the spacer comprises polyethylene glycol (PEG), and the PEG comprises about 1 to about 50, or about 2 to about 40, or about 3 to about 30, or about 4 to about 20, or about 5 to about 10, or about 1 to about 15, or about 2 to about 10, or about 3 to about 8, or about 4 to about 7, or about 5 to about 6 ethylene glycol units. In embodiments, the spacer comprises a PEG comprising about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ethylene glycol units. In embodiments, the first binding partner is located at the 3' end of the anchoring agent, and the anchoring agent comprises a PEG spacer comprising about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units. In embodiments, the anchoring agent comprises a 3' terminal nucleotide attached to a first end of the PEG spacer and a first binding partner attached to a second end of the PEG spacer, wherein the PEG spacer comprises about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units.
[0172] The first complex and the second complex
[0173] In an embodiment, a first complex comprising an analyte and a detection reagent is bound to a surface. In an embodiment, the first complex further comprises a capture reagent, wherein the capture reagent specifically binds to the analyte and is fixed to a surface or capable of being fixed to a surface. In an embodiment, the capture reagent is directly fixed to the surface, for example, by a covalent bond between the capture reagent and the surface. In an embodiment, the covalent bond is formed by a reaction between a sulfhydryl group on the capture reagent and the surface. In an embodiment, the capture reagent is indirectly fixed to the surface, for example, by a secondary binding partner. In an embodiment, the capture reagent is connected to a first binding partner, which is bound to a second binding partner fixed to the surface. In an embodiment, the first binding partner and the second binding partner comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners, or intercalator-target molecule pairs. In an embodiment, the first binding partner and the second binding partner comprise a cross-reactive moiety, for example, a thiol and a maleimide or iodoacetamide; an aldehyde and a hydrazide; or an azide and an alkyne or cycloalkyne. In an embodiment, the first binding partner comprises biotin, and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody, or a combination thereof. In an embodiment, the first binding partner and the second binding partner are bound to each other via a bridging agent that binds both the first binding partner and the second binding partner. In an embodiment, the bridging agent comprises at least two binding sites, wherein each of the first binding partner and the second binding partner binds to a different binding site. In an embodiment, the bridging agent comprises streptavidin or avidin, and each of the first binding partner and the second binding partner is biotin.
[0174] In an embodiment, the capture reagent comprises a protein or polypeptide, an antibody or its antigen-binding fragment, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In an embodiment, the capture reagent comprises an antibody or a variant thereof, including its antigen / epitope binding portion, an antibody fragment or derivative, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In an embodiment, the capture reagent comprises at least one heavy chain or light chain complementary determining region (CDR) of an antibody. In an embodiment, the capture reagent comprises at least two CDRs from one or more antibodies. In an embodiment, the capture reagent comprises an antibody or its antigen-binding fragment. In an embodiment, the capture reagent comprises an antigen-binding domain that specifically binds to an epitope of an analyte. In an embodiment, the capture reagent comprises an oligonucleotide. In an embodiment, the analyte comprises an oligonucleotide, and the capture reagent and analyte comprise complementary oligonucleotides.
[0175] In embodiments, each of the capture reagent and the detection reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, each of the capture reagent and the detection reagent comprises an oligonucleotide.
[0176] In embodiments, the methods of the present invention further comprise forming the first complex prior to contacting the first complex with the template oligonucleotide as described herein. In embodiments, the methods of the present invention further comprise forming the first complex substantially simultaneously with contacting the components of the first complex with the template oligonucleotide as described herein. In embodiments, the capture agent is immobilized on the surface prior to forming the first complex. In embodiments, the capture agent is immobilized on the surface after forming the first complex.
[0177] In embodiments, the first complex is formed by contacting a sample comprising the analyte with the detection reagent. In embodiments, the first complex is formed by contacting a sample comprising the analyte with the capture reagent and the detection reagent. In embodiments, the first complex is formed by contacting a sample comprising the analyte with, first, the capture reagent and second, the detection reagent. In embodiments, the first complex is formed by contacting a sample comprising the analyte with, first, the detection reagent and second, the capture reagent. In embodiments, the first complex is formed by contacting a sample comprising the analyte with, simultaneously or substantially simultaneously, the capture reagent and the detection reagent.
[0178] In an embodiment, the method comprises contacting a sample comprising the analyte with a detection reagent and template oligonucleotide as described herein simultaneously or substantially simultaneously. In an embodiment, the method comprises contacting a sample comprising the analyte with a detection reagent, template oligonucleotide, and polymerase as described herein simultaneously or substantially simultaneously. In an embodiment, the method comprises contacting a sample comprising the analyte with a detection reagent, template oligonucleotide, polymerase, and labeled probe as described herein simultaneously or substantially simultaneously. In an embodiment, the method comprises contacting a sample comprising the analyte with a detection reagent, template oligonucleotide, polymerase, labeled probe, and nuclease as described herein simultaneously or substantially simultaneously.
[0179] In embodiments, the method comprises forming a first complex comprising the analyte and the detection reagent, and contacting the first complex with a template oligonucleotide as described herein. In embodiments, the method comprises forming a first complex comprising the analyte and the detection reagent, and contacting the first complex with a template oligonucleotide and a polymerase simultaneously or substantially simultaneously. In embodiments, the method comprises forming a first complex comprising the analyte and the detection reagent, and contacting the first complex with a template oligonucleotide, a polymerase, and a labeled probe simultaneously or substantially simultaneously. In embodiments, the method comprises forming a first complex comprising the analyte and the detection reagent, and contacting the first complex with a template oligonucleotide, a polymerase, a labeled probe, and a nuclease simultaneously or substantially simultaneously.
[0180] In embodiments, the method comprises contacting a sample comprising the analyte with a capture reagent, detection reagent, and template oligonucleotide as described herein simultaneously or substantially simultaneously. In embodiments, the method comprises contacting a sample comprising the analyte with a capture reagent, detection reagent, template oligonucleotide, and polymerase as described herein simultaneously or substantially simultaneously. In embodiments, the method comprises contacting a sample comprising the analyte with a capture reagent, detection reagent, template oligonucleotide, polymerase, and labeled probe as described herein simultaneously or substantially simultaneously. In embodiments, the method comprises contacting a sample comprising the analyte with a capture reagent, detection reagent, template oligonucleotide, polymerase, labeled probe, and nuclease as described herein simultaneously or substantially simultaneously.
[0181] In embodiments, the method comprises forming a first complex comprising the analyte, the capture reagent, and the detection reagent, and contacting the first complex with a template oligonucleotide as described herein. In embodiments, the method comprises forming a first complex comprising the analyte, the capture reagent, and the detection reagent, and contacting the first complex with a template oligonucleotide and a polymerase simultaneously or substantially simultaneously. In embodiments, the method comprises forming a first complex comprising the analyte, the capture reagent, and the detection reagent, and contacting the first complex with a template oligonucleotide, a polymerase, and a labeled probe simultaneously or substantially simultaneously. In embodiments, the method comprises forming a first complex comprising the analyte, the capture reagent, and the detection reagent, and contacting the first complex with a template oligonucleotide, a polymerase, a labeled probe, and a nuclease simultaneously or substantially simultaneously.
[0182] surface
[0183] In embodiments, the first complex and / or the second complex described herein are bound to a surface, for example, via a capture reagent and / or an anchoring reagent as described herein. In embodiments, the surface comprises particles. In some embodiments, the particles comprise microspheres. In embodiments, the particles comprise paramagnetic beads. In embodiments, the particles comprise beads capable of being analyzed by flow cytometry. In embodiments, flow cytometry assays comprise detectable labels as described herein, such as fluorescently labeled particles. In embodiments, flow cytometry can distinguish particles comprising different fluorescent labels (e.g., different fluorescence wavelengths and / or intensities). In embodiments, flow cytometry can distinguish particles of different sizes. In embodiments, the particles comprise beads, which can be immobilized on a particle collection surface for detection as described herein, such as by imaging. In embodiments, particles (e.g., beads) can be immobilized in a single layer on a particle collection surface. In embodiments, immobilization comprises drop-casting a solution comprising particles (e.g., beads) onto a particle collection surface and evaporating the solution to form a film comprising particles on the particle collection surface, or catalyzing gelatin in a solution to immobilize the particles on the particle collection surface, or a combination thereof. In embodiments, the particle collection surface comprises an electrode. In embodiments, the particle collection surface comprises a glass surface. In embodiments, the particle collection surface comprises a slide (e.g., a microscope slide), a chip, or a flow cell. In embodiments, the immobilized particles are detected by imaging the particle collection surface and determining the number of particles comprising a detectable label. In embodiments, the surface comprises a cartridge. In embodiments, the surface comprises the wells of a multiwell plate. Non-limiting examples of plates include MSD SECTOR TM and MSD Assay plates, such as MSDGOLD TM 96-well small spot streptavidin plate.
[0184] In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and the anchoring reagent are located on two different binding domains on the surface. In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and the anchoring reagent are located on the same binding domain on the surface. In embodiments, the surface comprises particles, wherein the capture reagent and the anchoring reagent are located on the same particle. In embodiments, the capture reagent is within about 1 nm to about 500 nm, about 5 nm to about 250 nm, about 10 nm to about 200 nm, or about 15 nm to about 150 nm of the anchoring reagent on the surface. In embodiments, the capture reagent is less than 1 μm from the anchoring reagent on the surface. In embodiments, the capture reagent is less than 500 nm from the anchoring reagent on the surface. In embodiments, the capture reagent is less than 200 nm from the anchoring reagent on the surface.
[0185] In an embodiment, the surface comprises an electrode. In an embodiment, the electrode comprises a carbon ink electrode. In an embodiment, the detectable label comprises an ECL label. In an embodiment, detecting the detectable label comprises applying a voltage waveform (e.g., an electric potential) to the electrode to generate an ECL signal. In an embodiment, the surface comprises particles, and detecting the detectable label comprises collecting the particles on the electrode and applying a voltage waveform (e.g., an electric potential) to the electrode to generate an ECL signal.
[0186] Multiple methods
[0187] In an embodiment, described method is the multiplex method that can detect multiple (for example, at least two) analytes.In an embodiment, multiplex method detects about 2 kinds to about 15 kinds or about 3 kinds to about 14 kinds or about 4 kinds to about 13 kinds or about 4 kinds to about 12 kinds or about 5 kinds to about 11 kinds or about 6 kinds to about 10 kinds or about 7 kinds to about 9 kinds of analytes simultaneously or substantially simultaneously.In an embodiment, multiplex method comprises repeating one or more method steps to detect at least 2 kinds, for example, about 2 kinds to about 15 kinds or about 3 kinds to about 14 kinds or about 4 kinds to about 13 kinds or about 4 kinds to about 12 kinds or about 5 kinds to about 11 kinds or about 6 kinds to about 10 kinds or about 7 kinds to about 9 kinds of analytes.In an embodiment, each method step in method step is carried out in parallel to every kind of analyte.Carry out the method for multiple determination in for example US10,189,023 and US10,201,812, there is other description.In an embodiment, every kind of unique analyte is associated with the different detectable labels comprising different detectable signals. In an embodiment, detectable label comprises fluorescent label, and different fluorescence characteristics (for example, fluorescence wavelength and / or intensity) are associated with each unique analyte, thereby allowing, for example, by flow cytometry, analyte to be distinguished from each other, and the amount of the analyte associated with each fluorescence characteristic can be determined. Fluorescent dyes with different fluorescence characteristics are known to those of ordinary skill in the art. In an embodiment, each unique analyte is associated with different surfaces, for example, with particles of different sizes. In an embodiment, the analyte related to different particle sizes can be separated, for example, by flow cytometry, and the number of particles of each size is determined, thereby determining the amount of the analyte associated with each particle size.
[0188] In embodiments, each analyte is present in a different first complex. In embodiments, each first complex comprises a different analyte and its corresponding detection reagent. In embodiments, each first complex comprises a different analyte and its corresponding capture reagent and detection reagent. In embodiments, the surface comprises a plurality of different binding domains, and each analyte forms a first complex in a different binding domain. In embodiments, the surface comprises a plurality of capture reagents, wherein each capture reagent is immobilized on a different binding domain and on the surface, and wherein each capture reagent is capable of specifically binding to one of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 analytes. In embodiments, the surface is contacted with at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 analytes, wherein each analyte forms a first complex in its corresponding binding domain.
[0189] In an embodiment, a plurality of different binding domains are located on a single surface. In an embodiment, the surface comprises a multi-well plate, and each binding domain is located in different holes. In an embodiment, the surface comprises a multi-well plate, and each binding domain is located in different areas of the hole. In an embodiment, a plurality of different binding domains are located on one or more surfaces. In an embodiment, the surface comprises particles, and each binding domain is located on different particles. In an embodiment, the particles are arranged into a particle array. In an embodiment, the particles are encoded to allow identification of specific particles and to distinguish each binding domain. In an embodiment, for example, by flow cytometry, the binding domains can be separated from each other. In an embodiment, each unique analyte is associated with different detectable labels comprising different detectable signals, as described herein. In an embodiment, each different detectable label comprises different fluorescence characteristics (e.g., wavelength and / or intensity), thereby allowing unique analytes on particles to be identified based on different fluorescence characteristics by flow cytometry. In an embodiment, each unique analyte is associated with different particle sizes, thereby allowing unique analytes on particles to be identified based on different particle sizes by flow cytometry. In an embodiment, the surface is a multi-well plate comprising detachable holes, and each binding domain is located in different holes. In an embodiment, the surface comprises one or more particles, and each particle can be separated from the remaining particles. Methods of separating particles are known in the art and include, for example, flow cytometry, magnetic separation, affinity separation, and the like.
[0190] Analytes and samples
[0191] In an embodiment, the sample is a biological sample. In an embodiment, the sample is an environmental sample. In an embodiment, the sample is obtained from a human subject. In an embodiment, the sample is obtained from an animal subject. In an embodiment, the sample comprises mammalian fluid, secretion or excrement. In an embodiment, the sample is purified mammalian fluid, secretion or excrement. In an embodiment, the mammalian fluid, secretion or excrement is whole blood, plasma, serum, sputum, tears, lymph, synovial fluid, pleural effusion, urine, sweat, cerebrospinal fluid, ascites, milk, feces, bronchial lavage fluid, saliva, amniotic fluid, nasal secretions, vaginal secretions, surface biopsy, sperm, semen / seminal fluid (semen / seminal fluid), wound secretions and excrement, or therefrom extract, purify or its diluent. Other exemplary samples include but are not limited to physiological samples, samples containing cell suspensions, such as mucosal swabs, tissue aspirates, tissue homogenates, cell cultures and cell culture supernatants. In an embodiment, the sample is whole blood, serum, plasma, cerebrospinal fluid, urine, saliva, or extracted, purified, or a dilution thereof. In an embodiment, the sample is serum or plasma. In an embodiment, the plasma is in EDTA, heparin, or citrate. The sample can be obtained from a single source as described herein, or can contain a mixture from two or more sources.
[0192] Analytes that can be measured using the methods of the present invention include, but are not limited to, proteins, toxins, nucleic acids, microorganisms, viruses, cells, fungi, spores, carbohydrates, lipids, glycoproteins, lipoproteins, polysaccharides, drugs, hormones, steroids, nutrients, metabolites, and any modified derivatives of the foregoing molecules, or any complex comprising one or more of the foregoing molecules or a combination thereof. The level of the analyte of interest in a sample can be indicative of a disease or disease condition, or it can simply indicate whether a subject has been exposed to the analyte.
[0193] In an embodiment, the analyte comprises a biomarker. As used herein, the term "biomarker" refers to a biological substance indicating a normal or abnormal process, such as a disease, infection, or environmental exposure. A biomarker can be a small molecule such as a ligand, a signaling molecule, or a peptide, or a macromolecule such as an antibody, a receptor, or a protein and a protein complex. The change in biomarker levels can be related to the risk or progression of a disease or an abnormality, or to the susceptibility or responsiveness of a disease or an abnormality to a given treatment. Biomarkers can be used to diagnose the presence of an individual's disease risk or disease, or for customizing individual treatment of a disease (e.g., selecting a drug therapy or an administration regimen). When assessing potential drug therapy, biomarkers can be used as substitutes for natural endpoints (such as survival rate or irreversible morbidity). If treatment changes a biomarker directly related to improving health, then biomarkers can serve as "surrogate endpoints" for assessing clinical benefit. Biomarkers are further described, for example, in Mayeux, NeuroRx 1(2):182-188 (2004); Strimbu et al., Curr Opin HIV AIDS 5(6):463-466 (2010); and Bansal et al., Statist Med 32:1877-1892 (2013). The term "biomarker," when used in the context of a particular organism (e.g., a human, a non-human primate, or another animal), refers to a biomarker that is native to that particular organism. Unless otherwise indicated, biomarkers referred to herein include human biomarkers. In embodiments, the biomarker includes an immune response biomarker. In embodiments, the biomarker includes an antibody or a fragment thereof, such as an antigen-binding fragment of an antibody.
[0194] In an embodiment, the analyte comprises exosomes. In an embodiment, the sample comprises purified exosomes. Exosomes, also known as extracellular vesicles or EVs, are small membrane vesicles released by most cell types. The release and subsequent uptake of exosomes is a method of intercellular communication and plays a role in the regulation of many physiological and pathological processes. Exosomes have been shown to contain a variety of signaling molecules, including but not limited to surface-bound and cytoplasmic proteins, lipids, mRNA, and miRNA, and it has been shown that the identity and concentration of these species in each exosome can be used to infer their cellular origin and function. Therefore, the genomic or proteomic profile of a patient's total exosome population can provide valuable prognostic information for various pathological conditions, including cancer, infectious diseases, kidney and liver diseases, and traumatic brain injury. In an embodiment, the analyte comprises an internal analyte of an exosome, such as a cargo protein, lipid, or nucleic acid. Detection of exosomes is further described, for example, in WO 2015 / 175856; WO 2019 / 222708; WO 2020 / 086751; and WO 2022 / 051481.
[0195] Measurement format
[0196] In an embodiment, the method provided herein is a competitive assay format. Generally speaking, in competitive assays, such as competitive immunoassays or competitive inhibition assays, analytes and competitors compete for binding to capture agents and / or detection agents. In such assays, the analyte is typically measured indirectly by directly measuring the competitor. As used herein, a "competitor" refers to a compound that can bind to the same capture agent and / or detection agent as the analyte, such that the capture agent and / or detection agent can only bind to the analyte or the competitor, but not both. In an embodiment, a competitive assay is used to detect and measure analytes that cannot bind to more than one capture agent and / or detection agent, such as small molecule analytes or analytes that do not have a different binding site. In an embodiment, a competitive assay is used to detect and measure antibody biomarkers. Examples of competitive immunoassays include US 4,235,601; US 4,442,204; and the competitive immunoassays described in US 5,028,535.
[0197] The methods herein can be performed in a single assay chamber, such as a single well of an assay plate. The methods herein can also be performed in an assay chamber of an assay cartridge. For example, assay modules, such as assay plates or assay cartridges, are described in US 8,343,526; US 9,731,297; US 9,921,166; US 10,184,884; US 10,281,678; US 10,272,436; US 2004 / 0022677; US 2004 / 0189311; US 2005 / 0052646; US 2005 / 0142033; US 2018 / 0074082; and US 2019 / 0391170 for performing assays and apparatus suitable for the present invention.
[0198] The methods herein can be performed manually, using automated techniques, or both. Automated techniques can be partially automated, such as one or more modular instruments, or fully integrated automated instruments. Exemplary automated systems and devices are described in WO 2018 / 017156, WO 2017 / 015636, and WO 2016 / 164477.
[0199] Assay devices consistent with the embodiments herein can be used, for example, to perform assays in a multiwell plate format having one or more of the following desirable attributes: (i) high sensitivity, (ii) large dynamic range, (iii) small size and weight, (iv) array-based multiplexing capability, (v) automated operation; and (vi) the ability to process multiple plates. The devices and methods can be used with a variety of assay detection technologies, including but not limited to techniques for measuring one or more detectable signals. Some aspects are suitable for electrochemiluminescence measurements, and in particular, embodiments suitable for use with multiwell plates with integrated electrodes (and assay methods using these plates), such as those described in U.S. Patents 7,842,246; 7,807,448; and 10,281,678.
[0200] Reagent test kit
[0201] In an embodiment, the present invention provides a kit for detecting an analyte, the kit comprising the following in one or more vials, containers or compartments:
[0202] (a) a capture reagent that binds to the analyte;
[0203] (b) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer or is capable of being linked to a nucleic acid primer;
[0204] (c) a labeled probe comprising (1) a detection oligonucleotide and (2) a detectable label; and
[0205] (d) a template oligonucleotide capable of hybridizing to the nucleic acid primer and comprising a sequence identical to that of the detection oligonucleotide; wherein the detection reagent comprises a protein or polypeptide, and wherein:
[0206] (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof;
[0207] (ii) the kit further comprises a nuclease capable of cleaving the template oligonucleotide;
[0208] (iii) a combination of (i) and (ii);
[0209] (iv) one or both of (i) and (ii), and wherein the kit further comprises an anchoring agent;
[0210] (v) the kit further comprises an anchoring reagent, the anchoring reagent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or
[0211] (vi) Any combination of (i), (ii) and (v).
[0212] In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a nuclease capable of cleaving a template oligonucleotide. In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and an anchoring agent. In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; an anchoring agent; and a surface. In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and a surface comprising an anchoring agent. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NO: 7-10. In embodiments, the nuclease comprises one or more restriction enzymes, as shown in Table 1. In embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchoring reagent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.
[0213] In embodiments, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and an anchoring agent. In embodiments, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; an anchoring agent; and a surface. In embodiments, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a surface comprising an anchoring agent. In embodiments, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10. In embodiments, the anchoring agent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.
[0214] In an embodiment, the kit comprises: a nuclease capable of cleaving the template oligonucleotide; and an anchoring agent. In an embodiment, the kit comprises: a nuclease capable of cleaving the template oligonucleotide; an anchoring agent; and a surface. In an embodiment, the kit comprises: a nuclease capable of cleaving the template oligonucleotide; and a surface comprising an anchoring agent. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the nuclease comprises one or more restriction enzymes as shown in Table 1. In an embodiment, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In an embodiment, the template oligonucleotide comprises the sequence of any one of SEQ ID NO: 5, 6, or 16. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises the sequence of any one of SEQ ID NO: 11, 17, or 20-37.
[0215] In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and an anchoring agent. In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; an anchoring agent; and a surface. In an embodiment, the kit comprises: a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and a surface comprising an anchoring agent. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NO: 7-10. In an embodiment, the nuclease comprises one or more restriction enzymes, as shown in Table 1. In embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchoring reagent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.
[0216] Labeled probe
[0217] In an embodiment, the test kit includes a labeled probe, and the labeled probe includes a detection oligonucleotide and a detectable label. Detectable oligonucleotide and detectable label are further described herein. In an embodiment, detectable label can be detected by light scattering, light absorption, fluorescence, chemiluminescence, ECL, bioluminescence, phosphorescence, radioactivity, magnetic field or a combination thereof. In an embodiment, the test kit is used to implement a multiplex method capable of detecting at least two analytes, as described herein, and the detectable label of every kind of analyte includes different detectable signals. In an embodiment, detectable label includes a fluorescent label, and different fluorescence characteristics (for example, fluorescence wavelength and / or intensity) are associated with each unique analyte, thereby allowing analytes to be distinguished from each other. In an embodiment, detectable label is an ECL label. In an embodiment, the labeled probe includes about 1 to 10 or about 2 to 5 or about 3 to 4 ECL labels. In an embodiment, the labeled probe includes three ECL labels. ECL labels are further described herein.
[0218] In embodiments, the detection oligonucleotide of the labeled probe comprises RNA, a modified nucleic acid, or a combination thereof, as described herein. In embodiments, the detection oligonucleotide comprises RNA. In embodiments, the detection oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide comprises a combination of RNA and a modified nucleic acid. In embodiments, the modified nucleic acid is a modified RNA nucleic acid. In embodiments, the modified nucleic acid is a modified DNA nucleic acid.
[0219] In an embodiment, the modified nucleic acid comprises PNA, LNA, BNA, comprises 2' modified nucleosides or a combination thereof. In an embodiment, the modified nucleic acid comprises PNA, LNA, BNA, comprises 2' modified nucleosides or a combination thereof. In an embodiment, the 2' modified nucleosides comprise 2'-OMe, 2'-MOE, 2'-F, 2'-OH or a combination thereof. In an embodiment, the modified nucleic acid comprises backbone modifications, such as in the phosphate backbone of one or more nucleotides. In an embodiment, backbone modifications comprise thiophosphate, borane phosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or a combination thereof. Modified nucleic acids, such as PNA, LNA, BNA and comprising 2' modified nucleosides are further described herein.
[0220] In an embodiment, the detection oligonucleotide comprises a single modified nucleic acid, e.g., a PNA monomer, an LNA monomer, a BNA monomer, or a single nucleoside comprising a 2' modification. In an embodiment, the detection oligonucleotide comprises more than one modified nucleic acid, e.g., more than one PNA, LNA, BNA monomer, and / or a nucleoside comprising a 2' modification.
[0221] In an embodiment, the detection oligonucleotide consists of a modified nucleic acid, wherein each nucleotide of the detection oligonucleotide comprises a modified nucleic acid as described herein. In an embodiment, each modified nucleic acid of the detection oligonucleotide comprises PNA, LNA, BNA, comprises a 2'-modified nucleoside, or a combination thereof.
[0222] In an embodiment, the detection oligonucleotide has a length of about 3 to about 30 nucleotides, or a length of about 4 to about 25 nucleotides, or a length of about 4 to about 20 nucleotides, or a length of about 5 to about 18 nucleotides, or a length of about 6 to about 15 nucleotides or a length of about 8 to about 12 nucleotides. In an embodiment, the detection oligonucleotide has a length of about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 nucleotides. In an embodiment, the detection oligonucleotide comprises or consists of a sequence as shown in Table 4 herein.
[0223] In an embodiment, the detection oligonucleotide is connected to a detectable label via a conjugated bond. The conjugation of detectable labels to oligonucleotides is known to those of ordinary skill in the art. In an embodiment, the detection oligonucleotide comprises a 3' amino modifier, an internal amino modifier, an internal spacer, or a combination thereof. In an embodiment, the detectable label is connected to the detection oligonucleotide via a 3' amino modifier, an internal amino modifier, and / or an internal spacer. In an embodiment, the detection oligonucleotide comprises a sequence as shown in Table 5. Lowercase "m" and "+" symbols are as defined herein. As used herein, "iAmMC6T" refers to an amino-modified C6 dT linker; "iSp18" refers to an 18-atom hexaethylene glycol spacer; and "3AmMO" refers to a 3' amino modifier. See, for example, "Attachment Chemistry / Linkers Modifications",
[0224] idtdna.com / site / Catalog / Modifications / Category / 2.
[0225] Table 5. Additional exemplary detection oligonucleotide sequences
[0226] sequence SEQ ID NO mG+A+G+T+C+CmGmUmCmU / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / 12 C+A+G+T+G+AA+TGC / iAmMC6T / / iSp18 / iAmMC6T / / iSp18 / / 3AmMO / 13 G+A+G+T+C+C+GTCT / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / 14 G+A+G+T+C+CGTCT / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / 15
[0227] In an embodiment, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 12-15. In an embodiment, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 12-15.
[0228] polymerase
[0229] In an embodiment, the kit comprises a labeled probe comprising a detection oligonucleotide as described herein; and a polymerase. Polymerases are further described herein. In an embodiment, the polymerase is capable of extending a nucleic acid primer on a detection reagent. In an embodiment, the polymerase is capable of performing PCR, NEAR, or an isothermal amplification method (such as SDA, HDA, or RCA). In an embodiment, the polymerase is capable of performing MDA. In an embodiment, the polymerase comprises strand displacement activity (i.e., is an SD polymerase). In an embodiment, the SD polymerase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with a DNA polymerase from a bacteriophage (e.g., Phi29, Nf, Karezi, or BeachBum). In embodiments, the SD polymerase comprises an amino acid sequence having at least 80% or at least 90% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase is a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the activity of the polymerase is not substantially inhibited by the detection oligonucleotides described herein.
[0230] Template oligonucleotide
[0231] In an embodiment, the test kit comprises a template oligonucleotide, wherein the template oligonucleotide is capable of hybridizing with a nucleic acid primer and comprises a sequence identical to a detection oligonucleotide, which enables the generation of an extended oligonucleotide comprising a sequence complementary to the detection oligonucleotide. Template oligonucleotides are further described herein. In an embodiment, the template oligonucleotide is a template for nucleic acid amplification by a polymerase as described herein. In an embodiment, the template oligonucleotide has a length of about 40 to about 100 nucleotides, or a length of about 50 to about 78 nucleotides, or a length of about 53 to about 76 nucleotides, or a length of about 50 to about 70 nucleotides, or a length of about 53 to about 61 nucleotides or a length of about 54 to about 61 nucleotides. In embodiments, the template oligonucleotide is about 53, about 54, about 55, about 56, about 57, about 58, about 59, about 60, about 61, about 62, about 63, about 64, about 65, about 66, about 67, about 68, about 69, about 70, about 71, about 72, about 73, about 74, about 75, or about 76 nucleotides in length.
[0232] In an embodiment, the template oligonucleotide comprises one or more linker oligonucleotides, wherein the one or more linker oligonucleotides can be connected to form a circular template. In an embodiment, the 5' end and 3' end of the template oligonucleotide can hybridize with the first region and the second region of the nucleic acid primer on the detection reagent. In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the template oligonucleotide is a linear oligonucleotide, wherein the 5' end and the 3' end of the linear oligonucleotide can be connected to form a circular oligonucleotide. In an embodiment, the template oligonucleotide comprises 5'-GTTCTGTC-3' at its 5' end and 5'-GTGTCTA-3' at its 3' end. In an embodiment, the template oligonucleotide comprises or consists of the sequence shown in Table 3 herein. In an embodiment, the template oligonucleotide is 5'-phosphorylated. In an embodiment, the 5'-phosphorylation of the template oligonucleotide enables its 5' end and 3' end to be connected, as described herein. In an embodiment, the template oligonucleotide comprises the sequence
[0233] / 5Phos / GTTCTGTCATATTTCAGTGAATGCGAGTCCGTCTAAGAGAGTAGT ACAGCAAGAGTGTCTA (SEQ ID NO: 16).
[0234] In an embodiment, the template oligonucleotide comprises the sequence of SEQ ID NO: 5 or 6. In an embodiment, the template oligonucleotide consists of the sequence of SEQ ID NO: 5 or 6.
[0235] Nuclease
[0236] In an embodiment, the kit comprises a nuclease capable of cleaving the template oligonucleotide. Nucleases are further described herein. In an embodiment, the nuclease specifically cleaves the template oligonucleotide. In an embodiment, the nuclease does not cleave a nucleic acid primer or an extended oligonucleotide. In an embodiment, the nuclease specifically cleaves a double-stranded oligonucleotide, such as a double-stranded DNA, double-stranded RNA, or a double-stranded DNA / RNA hybrid. In an embodiment, the double-stranded DNA, double-stranded RNA, or double-stranded DNA / RNA hybrid comprises a template oligonucleotide and a nucleic acid primer hybridized thereto.
[0237] In an embodiment, the nuclease cleaves the double-stranded portion of the template oligonucleotide that hybridizes to the nucleic acid primer. In an embodiment, the template oligonucleotide and the nucleic acid primer each comprise single-stranded DNA. In an embodiment, the nuclease is a restriction endonuclease. Exemplary restriction endonucleases are provided herein. In an embodiment, the nuclease comprises one or more restriction enzymes, as shown in Table 1. In an embodiment, the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.
[0238] In an embodiment, the nuclease cleaves the double-stranded portion of the template oligonucleotide that forms a DNA / RNA hybrid with the nucleic acid primer. In an embodiment, the template oligonucleotide comprises single-stranded DNA, and the nucleic acid primer comprises single-stranded RNA. In an embodiment, the template oligonucleotide comprises single-stranded RNA, and the nucleic acid primer comprises single-stranded DNA. Exemplary nucleases capable of cleaving DNA / RNA hybrids are provided herein. In an embodiment, the nuclease is RNase H2.
[0239] In an embodiment, the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator and cleaves the template oligonucleotide. In an embodiment, the DNA damage indicator is not present in the nucleic acid primer or the extended oligonucleotide, and the nuclease does not bind to or cleave the nucleic acid primer or the extended oligonucleotide. DNA damage indicators and their corresponding excision enzymes are further described herein. In an embodiment, the DNA damage indicator comprises a uracil base, and the nuclease comprises UNG. In an embodiment, the kit further comprises an abasic site endonuclease that further assists UNG in cleaving the template oligonucleotide. In an embodiment, the abasic site endonuclease comprises UDG, APE1, endonuclease IV, or a combination thereof. In an embodiment, the DNA damage indicator comprises deoxyinosine, and the nuclease comprises endonuclease V. In an embodiment, the DNA damage indicator comprises a damaged purine, and the nuclease comprises an enzyme that repairs the damaged purine. In embodiments, the damaged purine comprises 8oxoG and the template-cleaving enzyme comprises Fpg.
[0240] Anchoring reagent
[0241] In an embodiment, the test kit comprises an anchoring reagent. In an embodiment, the anchoring reagent is lyophilized. In an embodiment, the anchoring reagent is provided in solution. Anchoring reagents are further described herein. In an embodiment, the template oligonucleotide of the test kit comprises a region comprising the same sequence as the anchoring oligonucleotide, which enables the generation of extended oligonucleotides comprising a sequence complementary to the anchoring oligonucleotide. In an embodiment, the template oligonucleotide of the test kit comprises (i) a first region comprising the same sequence as the detection oligonucleotide as described herein, and (ii) a second region comprising the same sequence as the anchoring oligonucleotide, which enables the generation of extended oligonucleotides comprising (I) a first sequence complementary to the detection oligonucleotide and (II) a second sequence complementary to the anchoring oligonucleotide.
[0242] In an embodiment, the anchoring agent comprises an oligonucleotide, an aptamer, an aptamer ligand, an antibody, an antigen, a ligand, a receptor, a hapten, an epitope, or a mimotope. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide. In an embodiment, the anchoring oligonucleotide comprises a single-stranded oligonucleotide. In an embodiment, the anchoring oligonucleotide comprises a double-stranded oligonucleotide.
[0243] In an embodiment, the anchoring oligonucleotide comprises a modified nucleic acid. Modified nucleic acid is further described herein. In an embodiment, the modified nucleic acid comprises a modified base, a modified sugar and / or a modified backbone. In an embodiment, the modified nucleic acid comprises PNA, LNA, BNA, comprises a nucleoside or a combination thereof comprising 2' modifications. In an embodiment, the nucleoside comprising 2' modifications comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH or a combination thereof. In an embodiment, the modified nucleic acid comprises a backbone modification, such as in the phosphate backbone of one or more nucleotides. In an embodiment, the backbone modification comprises phosphorothioate, borane phosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or a combination thereof. Modified nucleic acid is further described herein, such as PNA, LNA, BNA and comprises a nucleoside or a combination thereof comprising 2' modifications.
[0244] In an embodiment, the anchoring agent consists of a modified nucleic acid, wherein each nucleotide of the anchoring oligonucleotide comprises a modified nucleic acid as described herein. In an embodiment, each modified nucleic acid of the anchoring oligonucleotide comprises PNA, LNA, BNA, comprises a 2'-modified nucleoside, or a combination thereof.
[0245] In an embodiment, the anchoring oligonucleotide has a length of about 3 to about 30 nucleotides, or a length of about 4 to about 25 nucleotides, or a length of about 4 to about 20 nucleotides, or a length of about 5 to about 18 nucleotides, or a length of about 6 to about 15 nucleotides or a length of about 8 to about 12 nucleotides. In an embodiment, the anchoring oligonucleotide has a length of about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 nucleotides. In an embodiment, the anchoring oligonucleotide comprises or consists of the sequence mU+AmGmUmA+C+AmGmC (SEQ ID NO: 11). In an embodiment, the anchoring oligonucleotide comprises biotin at the 3' end, for example, for fixing the anchoring agent to a surface as described herein. In an embodiment, the anchor oligonucleotide comprises the sequence mU+AmGmUmA+C+AmGmC / 3Bio / (SEQ ID NO: 17). In an embodiment, the anchor oligonucleotide comprises a thiol at the 3' end, e.g., for fixing the anchoring agent to a surface as described herein. In an embodiment, the anchor oligonucleotide comprises the sequence of any one of SEQ ID NOs: 20-37.
[0246] Capture reagent
[0247] In embodiments, the kit comprises a capture reagent. In embodiments, the capture reagent is lyophilized. In embodiments, the capture reagent is provided in solution. Capture reagents are further described herein. In embodiments, the capture reagent comprises a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In embodiments, the capture reagent comprises an antibody or variant thereof, including an antigen / epitope-binding portion thereof, an antibody fragment or derivative thereof, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In embodiments, the capture reagent comprises at least one heavy chain or light chain complementary determining region (CDR) of an antibody. In embodiments, the capture reagent comprises at least two CDRs from one or more antibodies. In embodiments, the capture reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, the capture reagent comprises an antigen-binding domain that specifically binds to an epitope of an analyte. In embodiments, the capture reagent comprises an oligonucleotide. In embodiments, the analyte comprises an oligonucleotide, and the capture reagent comprises an oligonucleotide complementary to the analyte.
[0248] surface
[0249] In an embodiment, the kit comprises a surface, and each of the capture reagent and the anchoring reagent is capable of being immobilized on the surface. In an embodiment, the kit comprises a surface, and each of the capture reagent and the anchoring reagent is provided on the surface. In an embodiment, the kit comprises a surface, wherein the anchoring reagent is immobilized on the surface, and the capture reagent is not provided on the surface and is capable of being immobilized on the surface. In an embodiment, the kit comprises a surface, wherein the capture reagent is immobilized on the surface, and the anchoring reagent is not provided on the surface and is capable of being immobilized on the surface. Immobilization of the capture reagent and / or anchoring reagent on a surface is further described herein.
[0250] In an embodiment, the capture reagent is fixed or can be fixed on the surface by a covalent bond between the capture reagent and the surface, such as a reaction between a thiol group of the capture reagent and the surface. In an embodiment, the capture reagent is connected to a first binding partner, which can bind to a second binding partner fixed on the surface. In an embodiment, the first binding partner and the second binding partner comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners or intercalator-target molecule pairs. In an embodiment, the first binding partner and the second binding partner comprise a cross-reactive portion, for example, a thiol and a maleimide or iodoacetamide; an aldehyde and a hydrazide; or an azide and an alkyne or cycloalkyne. In an embodiment, the first binding partner comprises biotin and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody or a combination thereof. In embodiments, the first binding partner and the second binding partner are bound to each other via a bridging agent that binds both the first binding partner and the second binding partner. In embodiments, the bridging agent comprises at least two binding sites, wherein each of the first binding partner and the second binding partner binds to a different binding site. In embodiments, the bridging agent comprises streptavidin or avidin, and the first binding partner and the second binding partner are each biotin.
[0251] In an embodiment, the capture reagent is fixed or can be fixed on the surface by a covalent bond between the anchoring reagent and the surface, such as a reaction between a thiol group of the anchoring reagent and the surface. In an embodiment, the anchoring reagent is connected to a first binding partner, which is capable of binding to a second binding partner fixed on the surface. In an embodiment, the first binding partner and the second binding partner comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners or intercalator-target molecule pairs. In an embodiment, the first binding partner and the second binding partner comprise a cross-reactive portion, such as a thiol and a maleimide or iodoacetamide; an aldehyde and a hydrazide; or an azide and an alkyne or cycloalkyne. In an embodiment, the first binding partner comprises biotin and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody or a combination thereof. In embodiments, the first binding partner and the second binding partner are bound to each other via a bridging agent that binds both the first binding partner and the second binding partner. In embodiments, the bridging agent comprises at least two binding sites, wherein each of the first binding partner and the second binding partner binds to a different binding site. In embodiments, the bridging agent comprises streptavidin or avidin, and the first binding partner and the second binding partner are each biotin.
[0252] In an embodiment, the anchoring agent comprises an anchoring oligonucleotide and a first binding partner, wherein the first binding partner is connected to a nucleotide of the anchoring oligonucleotide. In an embodiment, the first binding partner is connected to an internal nucleotide of the anchoring oligonucleotide. In an embodiment, the first binding partner is located at the 5' end of the anchoring agent. In an embodiment, the first binding partner is located at the 3' end of the anchoring agent. In an embodiment, the first binding partner is connected to the 5' or 3' terminal nucleotide of the anchoring oligonucleotide. In an embodiment, the anchoring agent comprises a spacer located between the first binding partner and the anchoring oligonucleotide. In an embodiment, the spacer comprises PEG, and the PEG comprises about 1 to about 50, or about 2 to about 40, or about 3 to about 30, or about 4 to about 20, or about 5 to about 10, or about 1 to about 15, or about 2 to about 10, or about 3 to about 8, or about 4 to about 7, or about 5 to about 6 ethylene glycol units. In embodiments, the spacer comprises a PEG comprising about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ethylene glycol units. In embodiments, the first binding partner is located at the 3' end of the anchoring agent, and the anchoring agent comprises a PEG spacer comprising about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units. In embodiments, the anchoring agent comprises a 3' terminal nucleotide attached to a first end of the PEG spacer and a first binding partner attached to a second end of the PEG spacer, wherein the PEG spacer comprises about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units.
[0253] In embodiments, the first binding partner of the capture reagent and the first binding partner of the anchoring reagent are substantially non-cross-reactive, i.e., the first binding partner of the capture reagent and the first binding partner of the anchoring reagent bind to different second binding partners on the surface. In embodiments, the first binding partner of the capture reagent and the first binding partner of the anchoring reagent are capable of binding to the same second binding partner on the surface.
[0254] Surfaces are further described herein. In embodiments, the surface comprises particles. In some embodiments, the particles comprise microspheres. In embodiments, the particles comprise paramagnetic beads. In embodiments, the surface comprises a cartridge. In embodiments, the surface comprises wells of a multiwell plate. Non-limiting examples of plates include SECTOR TM and MSD Assay plates, e.g. GOLD TM96-well small spot streptavidin plate. In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and the anchoring reagent are immobilized or capable of being immobilized on two different binding domains on the surface. In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and the anchoring reagent are immobilized or capable of being immobilized on the same binding domain on the surface. In embodiments, the surface comprises particles, wherein the capture reagent and the anchoring reagent are immobilized or capable of being immobilized on the same particle. In embodiments, the capture reagent is within about 1 nm to about 500 nm, about 5 nm to about 250 nm, about 10 nm to about 200 nm, or about 15 nm to about 150 nm of the anchoring reagent on the surface. In embodiments, the capture reagent is less than 1 μm from the anchoring reagent on the surface. In embodiments, the capture reagent is less than 500 nm from the anchoring reagent on the surface. In embodiments, the capture reagent is less than 200 nm from the anchoring reagent on the surface.
[0255] In an embodiment, the surface comprises an electrode. In an embodiment, the electrode comprises a carbon ink electrode. In an embodiment, the surface comprises particles, and the kit further comprises an electrode for collecting particles. In an embodiment, the kit further comprises a reagent for immobilizing a capture and / or anchoring agent to the surface.
[0256] Detection Reagents
[0257] In an embodiment, the kit comprises a detection reagent, wherein the detection reagent comprises a protein or polypeptide. In an embodiment, the detection reagent is lyophilized. In an embodiment, the detection reagent is provided in the form of a solution. Detection reagents are further described herein. In an embodiment, the detection reagent comprises an antibody or a variant thereof, including an antigen / epitope binding portion thereof, an antibody fragment or derivative, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In an embodiment, the detection reagent comprises at least one heavy chain or light chain complementary determining region (CDR) of an antibody. In an embodiment, the detection reagent comprises at least two CDRs from one or more antibodies. In an embodiment, the detection reagent comprises an antibody or an antigen-binding fragment thereof. In an embodiment, the detection reagent comprises an antigen-binding domain that specifically binds to an epitope of an analyte. In an embodiment, the detection reagent comprises a protein or polypeptide antigen. In an embodiment, the detection reagent comprises a protein or polypeptide ligand or receptor.
[0258] In an embodiment, the detection reagent comprises a nucleic acid primer or is capable of being linked to a nucleic acid primer. Nucleic acid primers and their conjugation to proteins or polypeptides, such as antibodies or antigen-binding fragments thereof, are further described herein. In an embodiment, the nucleic acid primer comprises a conjugated moiety for conjugation to the detection reagent. In an embodiment, the conjugated moiety is located at the 5' end or the 3' end of the nucleic acid primer. In an embodiment, the conjugated moiety comprises a thiol. In an embodiment, the nucleic acid primer comprises a 5'-thiol.
[0259] In embodiments, the nucleic acid primer is about 10 to about 30 nucleotides in length, or about 12 to about 28 nucleotides in length, or about 13 to about 26 nucleotides in length, or about 14 to about 24 nucleotides in length, or about 11 to about 22 nucleotides in length, or about 12 to about 21 nucleotides in length, or about 13 to about 20 nucleotides in length, or about 13 to about 18 nucleotides in length, or about 14 to about 19 nucleotides in length. In embodiments, the nucleic acid primer is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides in length. In an embodiment, the nucleic acid primer is about 14 nucleotides in length or about 15 nucleotides in length. In an embodiment, the nucleic acid primer comprises or consists of a sequence as described in Table 2 herein. In an embodiment, the nucleic acid primer comprises the sequence
[0260] / 5ThioMC6-D / GACAGAACTAGACAC (SEQ ID NO: 18), wherein "5ThioMC6-D" refers to a 5' thiol modifier C6 SS modification. In an embodiment, the 5' thiol modifier enables the nucleic acid primer to be conjugated to a detection reagent as described herein.
[0261] Additional embodiments
[0262] In an embodiment, the kit further comprises a calibration reagent, a blocking reagent, a diluent, a stabilizer, a buffer, a ligase, a reagent for conjugating the nucleic acid primer to the detection reagent, a co-reactant for the detectable label, a detergent, a salt, a preservative, or a combination thereof.
[0263] In an embodiment, the kit comprises a calibration reagent. In an embodiment, the calibration reagent comprises a known amount of an analyte. In an embodiment, the kit comprises multiple calibration reagents comprising a range of concentrations of the analyte. In an embodiment, the multiple calibration reagents comprise concentrations of the analyte that are close to the upper and lower limits of quantitation of the method. In an embodiment, the multiple calibration reagents span the entire dynamic range of the method. In an embodiment, the calibration reagent is a positive control reagent. In an embodiment, the calibration reagent is a negative control reagent. In an embodiment, a positive control reagent or a negative control reagent is used to provide a basis for comparison of the sample to be measured with the method of the present invention. In an embodiment, the calibration reagent is lyophilized. In an embodiment, the calibration reagent is provided in the form of a solution.
[0264] In an embodiment, the kit comprises a blocking agent. In an embodiment, the blocking agent reduces non-specific binding of components other than tau to capture reagents and detection reagents described herein. Exemplary blocking agents include but are not limited to mBSA, sheared poly (A), polyBSA-I, mIgG, Tween, polyBSA-II, yeast RNA, mBSA+poly (a) and / or polyBSA+poly (A). In an embodiment, the kit further comprises a diluent for one or more components of the kit. In an embodiment, the kit comprising the above-mentioned components includes a reserve concentration of the components that is 5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 125 times, 150 times or more times the concentration of the working concentration of the method provided herein. In an embodiment, the kit further comprises a stabilizer, for example, for storing one or more components of the kit.
[0265] In an embodiment, the kit comprises a buffer, e.g., an assay buffer, a reconstitution buffer, a storage buffer, a read buffer, or a combination thereof. In an embodiment, the kit further comprises a co-reactant, e.g., for performing an electrochemiluminescence measurement. Exemplary co-reactants are described, e.g., in WO 2020 / 142313.
[0266] In an embodiment, the kit comprises a ligase. In an embodiment, the ligase is capable of ligating the linear template oligonucleotides provided herein to form circular template oligonucleotides as described herein. In an embodiment, the ligase is T4 DNA ligase, T7 DNA ligase, Taq DNA ligase, ligase or a combination thereof.
[0267] In an embodiment, the kit comprises a reagent for conjugating a nucleic acid primer to a detection reagent. Exemplary reagents are further described in, for example, WO 2021 / 092004 and Wong, SS and Jameson, DM, Chemistry of Protein and Nucleic Acid Cross-Linking and Conjugation, 2nd ed., CRC Press (2011).
[0268] In an embodiment, the test kit further comprises assay consumables, such as assay modules, vials, tubes, liquid handling and transfer devices, such as pipette tips, lids and seals, supports, labels, etc. In an embodiment, the test kit further comprises electrodes, such as for performing ECL measurements. In an embodiment, the electrodes are applied to a surface provided herein. In an embodiment, the test kit further comprises an assay instrument and / or instructions for implementing the methods described herein.
[0269] It will be understood by those of ordinary skill in the art that the components of the test kits described herein (which may be provided in one or more vials, containers, or compartments) are not necessarily included in the same container, e.g., the same box and / or at the same time. In an embodiment, the components of the test kits described herein are provided simultaneously or sequentially in one or more separate containers or compartments. It will be further understood by those of ordinary skill in the art that a user can, for example, obtain (e.g., purchase or possess) the components of the test kit (e.g., signal amplification reagents described herein) separately in one or more separate containers or compartments, but when used in combination, e.g., as described in the embodiments herein, the components are considered to be part of a "test kit." In some embodiments, the test kit is included in a plurality of containers, vials, or compartments supplied together in a single package or container. In an embodiment, the components of the test kits described herein are provided separately, e.g., according to the optimal transport or storage temperature of the components.
[0270] Composition
[0271] In an embodiment, the present invention provides a composition for labeling a surface, the composition comprising: a labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to an extended oligonucleotide, the extended oligonucleotide being bound to the surface, wherein the extended oligonucleotide is formed by extending a nucleic acid primer based on a template oligonucleotide by a polymerase, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extended oligonucleotide is bound to the surface via an anchoring agent; (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or any combination of (vi) (i), (ii), and (v). In an embodiment, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a nuclease capable of cleaving the template oligonucleotide. In an embodiment, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition comprises a nuclease capable of cleaving a template oligonucleotide; and an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the extension of the nucleic acid primer is performed by rolling circle amplification (RCA).
[0272] In an embodiment, the present invention provides a composition for labeling a surface, the composition comprising: (a) a nucleic acid primer directly or indirectly immobilized on a surface; (b) a template oligonucleotide comprising (1) a first region complementary to the nucleic acid primer; and (2) a second region comprising the same sequence as a detection oligonucleotide; (c) a polymerase; and (d) a labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to an extended oligonucleotide, the extended oligonucleotide being bound to the surface, wherein the extended oligonucleotide is detected by the polymerase based on the template. The composition is formed by extending the nucleic acid primer with an oligonucleotide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extended oligonucleotide is bound to the surface via an anchoring reagent; (v) the surface comprises an anchoring reagent, the anchoring reagent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or any combination of (vi) (i), (ii), and (v). In an embodiment, the composition comprises the detection oligonucleotide, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and the nuclease capable of cleaving the template oligonucleotide. In an embodiment, the composition comprises the detection oligonucleotide, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and an anchoring reagent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition comprises a nuclease capable of cleaving a template oligonucleotide; and an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid. In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the extension of the nucleic acid primer is performed by rolling circle amplification (RCA).
[0273] In an embodiment, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof. In an embodiment, the detection oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition is suitable for detecting an analyte, such as present on a surface. In an embodiment, the composition is suitable for generating a detectable signal from a detectable label. In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NO: 7-10.
[0274] This paper further describes labeled probes, and the labeled probes include detectable labels and detection oligonucleotides. In an embodiment, detectable labels are ECL labels. In an embodiment, the detection oligonucleotides include modified nucleic acids. In an embodiment, the modified nucleic acids include PNA, LNA, BNA, nucleosides comprising 2' modifications or a combination thereof. In an embodiment, the nucleosides comprising 2' modifications include 2'-OMe, 2'-MOE, 2'-F, 2'-OH or a combination thereof. In an embodiment, the modified nucleic acids include backbone modifications, for example, as described herein, phosphorothioate, borane phosphate, methylphosphonate, phosphoramidate (for example, morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or a combination thereof. This paper further describes modified nucleic acids.
[0275] In an embodiment, the detection oligonucleotide has a length of about 3 to about 30 nucleotides, or a length of about 4 to about 25 nucleotides, or a length of about 4 to about 20 nucleotides, or a length of about 5 to about 18 nucleotides, or a length of about 6 to about 15 nucleotides or a length of about 8 to about 12 nucleotides. In an embodiment, the detection oligonucleotide has a length of about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20 nucleotides. In an embodiment, the detection oligonucleotide comprises or consists of a sequence as shown in Table 4 herein.
[0276] In embodiments, the composition further comprises one or more of a polymerase, a primer, a template oligonucleotide, or a combination thereof.
[0277] In embodiments, the composition comprises a polymerase, wherein the polymerase is an SD polymerase described herein. In embodiments, the SD polymerase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a DNA polymerase from a bacteriophage. In embodiments, the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence having at least 80% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence having at least 90% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In an embodiment, the SD polymerase is a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.
[0278] In embodiments, the composition comprises a nucleic acid primer, wherein the nucleic acid primer is linked to a detection reagent as described herein. In embodiments, the detection reagent comprises a protein or polypeptide. In embodiments, the detection reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, the extended oligonucleotide is formed by extending the nucleic acid primer, for example, with a polymerase as described herein.
[0279] In an embodiment, the composition comprises a template oligonucleotide, for example, for nucleic acid amplification as described herein. Template oligonucleotides are further described herein. In an embodiment, the composition comprises a polymerase, a nucleic acid primer, and a template oligonucleotide as described herein. In an embodiment, the template oligonucleotide can be combined with a nucleic acid primer, and the polymerase can extend the nucleic acid primer from the template oligonucleotide by PCR, NEAR and / or isothermal amplification methods such as SDA, HDA, RCA or a combination thereof to form an extended oligonucleotide as described herein. In an embodiment, the template oligonucleotide comprises or consists of a sequence as shown in Table 3 herein. In an embodiment, the template oligonucleotide is a circular template oligonucleotide formed by connecting the 5' end and the 3' end of the sequence as shown in Table 3 herein.
[0280] In an embodiment, the composition comprises a nuclease capable of cleaving the template oligonucleotide. Nucleases are further described herein. In an embodiment, the nuclease comprises one or more restriction enzymes, as shown in Table 1. In some embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof.
[0281] In an embodiment, the composition comprises an extended oligonucleotide on the surface, wherein the extended oligonucleotide is formed by polymerase extension carried out by a nucleic acid primer from a template oligonucleotide. Extended oligonucleotides are further described herein. In an embodiment, the length of the extended oligonucleotide is about 100 to about 100,000 bases, or about 200 to about 75,000 bases, or about 500 to about 50,000 bases, or about 700 to about 20,000 bases, or about 1,000 to about 15,000 bases, or about 2,000 to about 10,000 bases, or about 3,000 to about 8,000 bases, or about 4,000 to about 7,000 bases, or about 5,000 to about 6,000 bases. In embodiments, the length of the extended oligonucleotide is from about 100 to about 80,000 bases, or from about 200 to about 60,000 bases, or from about 500 to about 50,000 bases, or from about 4,000 to about 100,000 bases, or from about 7,500 to about 75,000 bases, or from about 9,000 to about 40,000 bases, or from about 1,000 to about 50,000 bases, or from about 2,000 to about 25,000 bases, or from about 3,000 to about 13,000 bases. In embodiments, the length of the extended oligonucleotide is from about 100 to about 8,000 bases, or from about 500 to about 6,000 bases, or from about 1,000 to about 4,500 bases.
[0282] In an embodiment, the extended oligonucleotide is combined with the surface by an anchoring agent. Anchoring agents are further described herein. In an embodiment, the anchoring agent comprises an anchoring oligonucleotide. In an embodiment, the anchoring oligonucleotide comprises a modified nucleic acid as described herein. In an embodiment, the modified nucleic acid comprises PNA, LNA, BNA, comprises 2' modified nucleosides or a combination thereof. In an embodiment, the nucleosides comprising 2' modifications comprise 2'-OMe, 2'-MOE, 2'-F, 2'-OH or a combination thereof. In an embodiment, the modified nucleic acid comprises a backbone modification, for example, as described herein, phosphorothioate, borane phosphate, methylphosphonate, phosphoramidate (for example, morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or a combination thereof. Modified nucleic acid is further described herein.
[0283] In an embodiment, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising a nucleic acid primer, a template oligonucleotide, a polymerase, and a nuclease. The components of the composition, namely the capture reagent, the analyte, the detection reagent, the nucleic acid primer, the template oligonucleotide, the polymerase, and the nuclease are further described herein. In an embodiment, each of the capture reagent and the detection reagent comprises an antibody or an antigen-binding fragment thereof. In an embodiment, the nucleic acid primer comprises the sequence of any one of SEQ ID NO: 1-4. In an embodiment, the template oligonucleotide comprises the sequence of any one of SEQ ID NO: 5, 6, or 16. In an embodiment, the polymerase comprises an amino acid sequence having at least 90% sequence identity with a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In an embodiment, the nuclease comprises one or more restriction enzymes as shown in Table 1. In some embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof.
[0284] In some embodiments, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide, and an anchoring reagent comprising an anchoring oligonucleotide. The components of the composition, namely the capture reagent, the analyte, the detection reagent, the extended oligonucleotide, the anchoring reagent, and the anchoring oligonucleotide are further described herein. In embodiments, each of the capture reagent and the detection reagent comprises an antibody or an antigen-binding fragment thereof. In embodiments, the extended oligonucleotide is extended from a template oligonucleotide of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchoring reagent comprises an anchoring oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.
[0285] In some embodiments, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide, and a labeled probe comprising a detection oligonucleotide. The components of the composition, namely the capture reagent, the analyte, the detection reagent, the extended oligonucleotide, the labeled probe, and the detection oligonucleotide are further described herein. In an embodiment, each of the capture reagent and the detection reagent comprises an antibody or an antigen-binding fragment thereof. In an embodiment, the extended oligonucleotide is extended from a template oligonucleotide of any one of SEQ ID NO: 5, 6, or 16. In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NO: 7-10.
[0286] In embodiments, the capture reagent is immobilized on a surface as described herein. In embodiments, the capture reagent and the detection reagent bind to the analyte to form a complex on the surface. In embodiments, the detection reagent is an antibody or an antigen-binding fragment thereof. In embodiments, each of the capture reagent and the detection reagent is an antibody or an antigen-binding fragment thereof.
[0287] In an embodiment, the composition comprises a detection reagent, wherein the detection reagent comprises a nucleic acid primer. In an embodiment, the nucleic acid primer comprises a sequence as shown in Table 2. In an embodiment, the composition comprises a template oligonucleotide, such as a circular template oligonucleotide, and the nucleic acid primer hybridizes to the template oligonucleotide. In an embodiment, the template oligonucleotide comprises a sequence as shown in Table 3. In an embodiment, the composition comprises a polymerase, wherein the polymerase is capable of extending the nucleic acid primer in a nucleic acid amplification reaction such as PCR, NEAR and / or isothermal amplification methods such as SDA, HDA, RCA or a combination thereof. In an embodiment, the polymerase is an SD polymerase as described herein, for example, an SD polymerase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with a DNA polymerase from a bacteriophage. In an embodiment, the phage is Phi29, Nf, Karezi or BeachBum. In an embodiment, the composition comprises a nuclease, wherein the nuclease is capable of cleaving a template oligonucleotide, such as a double-stranded portion of a template oligonucleotide that hybridizes to a nucleic acid primer. In an embodiment, the nuclease comprises one or more restriction enzymes, as shown in Table 1. In an embodiment, the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI or a combination thereof. In an embodiment, the nuclease is RNase H2. In an embodiment, the nuclease is UNG, endonuclease V or Fpg. In an embodiment, the composition further comprises an abasic site endonuclease, such as UDG, APE1 and / or endonuclease IV, as described herein.
[0288] In an embodiment, the composition comprises a detection reagent, wherein the detection reagent comprises an extended oligonucleotide. In an embodiment, the extended oligonucleotide is formed by nucleic acid amplification of a nucleic acid primer on a detection reagent as described herein. In an embodiment, the length of the extended oligonucleotide is about 100 to about 100,000 bases, or about 200 to about 75,000 bases, or about 500 to about 50,000 bases, or about 700 to about 20,000 bases, or about 1,000 to about 15,000 bases, or about 2,000 to about 10,000 bases, or about 3,000 to about 8,000 bases, or about 4,000 to about 7,000 bases, or about 5,000 to about 6,000 bases. In embodiments, the length of the extended oligonucleotide is from about 100 to about 80,000 bases, or from about 200 to about 60,000 bases, or from about 500 to about 50,000 bases, or from about 4,000 to about 100,000 bases, or from about 7,500 to about 75,000 bases, or from about 9,000 to about 40,000 bases, or from about 1,000 to about 50,000 bases, or from about 2,000 to about 25,000 bases, or from about 3,000 to about 13,000 bases. In embodiments, the length of the extended oligonucleotide is from about 100 to about 8,000 bases, or from about 500 to about 6,000 bases, or from about 1,000 to about 4,500 bases.
[0289] In an embodiment, the composition includes an anchoring agent, wherein the anchoring agent includes an anchoring oligonucleotide. In an embodiment, the anchoring oligonucleotide includes the sequence of any one of SEQ ID NO:11, 17 or 20-37 or is composed of it. In an embodiment, the anchoring oligonucleotide includes a modified nucleic acid as described herein. In an embodiment, the modified nucleic acid includes PNA, LNA, BNA, includes 2' modified nucleosides or its combination. In an embodiment, the nucleosides including 2' modifications include 2'-OMe, 2'-MOE, 2'-F, 2'-OH or its combination. In an embodiment, the modified nucleic acid includes backbone modifications, for example, as described herein, phosphorothioate, borane phosphate, methylphosphonate, phosphoramidate (for example, morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or its combination. Modified nucleic acid is further described herein. In an embodiment, the extended oligonucleotide includes an anchoring oligonucleotide complement complementary to the anchoring oligonucleotide. In embodiments, the extended oligonucleotide is bound to the anchoring agent by hybridization of the complement of the anchoring oligonucleotide to the anchoring oligonucleotide.
[0290] In an embodiment, the composition comprises a labeled probe, wherein the labeled probe comprises a detection oligonucleotide. In an embodiment, the labeled probe further comprises a detectable label as described herein. In an embodiment, the detection oligonucleotide comprises a sequence as shown in Table 4 or consists of it. In an embodiment, the detection oligonucleotide comprises a modified nucleic acid as described herein. In an embodiment, the modified nucleic acid comprises PNA, LNA, BNA, comprises a nucleoside or a combination thereof comprising 2' modifications. In an embodiment, the nucleoside comprising 2' modifications comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH or a combination thereof. In an embodiment, the modified nucleic acid comprises a backbone modification, for example, as described herein, phosphorothioate, borane phosphate, methylphosphonate, phosphoramidate (for example, morpholino phosphoramidate and methylsulfonyl phosphoramidate), phosphoramidite, 3'-O-phosphopropylamino or a combination thereof. Modified nucleic acid is further described herein. In an embodiment, the extended oligonucleotide comprises a detection oligonucleotide complement complementary to the detection oligonucleotide. In embodiments, the extended oligonucleotide is bound to the detection oligonucleotide by hybridization of the complement of the detection oligonucleotide to the detection oligonucleotide.
[0291] In some embodiments, the present invention provides a composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide, an anchoring reagent comprising an anchoring oligonucleotide, and a labeled probe comprising a detection oligonucleotide. The components of the composition, i.e., the capture reagent, the analyte, the detection reagent, the extended oligonucleotide, the anchoring reagent, the anchoring oligonucleotide, the labeled probe, and the detection oligonucleotide are further described herein. In an embodiment, the extended oligonucleotide comprises (i) an anchoring oligonucleotide complement complementary to the anchoring oligonucleotide; and (ii) a detection oligonucleotide complement complementary to the detection oligonucleotide. In an embodiment, the extended oligonucleotide is bound to the anchoring reagent on the (I) surface via the anchoring oligonucleotide and is bound to the (II) labeled probe via the detection oligonucleotide. In an embodiment, the extended oligonucleotide bound to the surface via the anchoring reagent and bound to the labeled probe can be detected with higher sensitivity than the extended oligonucleotide bound to the labeled probe rather than the surface. In an embodiment, each of the capture reagent and the detection reagent comprises an antibody or an antigen-binding fragment thereof. In embodiments, the extended oligonucleotide is extended from a template oligonucleotide of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchoring reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 20-37. In embodiments, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10.
[0292] Additional embodiments
[0293] The invention described herein, eg, methods, kits, and / or compositions, may further comprise one or more aspects of the following additional embodiments.
[0294] Another embodiment (1)
[0295] Another embodiment (1) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase to form an extended oligonucleotide; (c) contacting the extended oligonucleotide with a single-stranded oligonucleotide (SSO) stabilizer; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.
[0296] In embodiments, the detecting comprises: binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.
[0297] In an embodiment, SSO stabilizers prevent aggregation and / or self-hybridization of the extended oligonucleotide, thereby increasing the availability of the extended oligonucleotide for detection. In an embodiment, the extension is carried out for at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 6 hours, at least 8 hours, at least 10 hours, at least 12 hours, at least 14 hours, at least 16 hours, at least 18 hours, at least 20 hours, at least 22 hours or at least 24 hours. In an embodiment, the SSO stabilizer is contacted with the extended oligonucleotide at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 30 minutes, at least 45 minutes or at least 1 hour after the extension begins. In an embodiment, the extension is carried out for at least 60 minutes, and the SSO stabilizer is added about 5 to about 15 minutes after the extension begins. In an embodiment, the extension begins when the second complex contacts the polymerase.
[0298] In an embodiment, the SSO stabilizer comprises a DNA binding protein. In an embodiment, the DNA binding protein specifically binds to single-stranded DNA. In an embodiment, the SSO stabilizer is an ultra-thermostable single-stranded DNA binding protein (ET SSB). In an embodiment, the concentration of ETSSB is from about 50 ng / mL to about 500 ng / mL, or from about 60 ng / mL to about 450 ng / mL, or from about 70 ng / mL to about 400 ng / mL, or from about 80 ng / mL to about 350 ng / mL, or from about 90 ng / mL to about 300 ng / mL, or from about 100 ng / mL to about 250 ng / mL, or from about 125 ng / mL to about 200 ng / mL, or from about 150 ng / mL to about 175 ng / mL.
[0299] In embodiments, the SSO stabilizer is ET SSB, and the concentration of ET SSB is about 50 ng / mL to about 100 ng / mL immediately after the start of the extension. In embodiments, the SSO stabilizer is ET SSB, and the concentration of ET SSB is about 100 ng / mL to about 150 ng / mL about 5 minutes after the start of the extension. In embodiments, the SSO stabilizer is ET SSB, and the concentration of ET SSB is about 200 ng / mL to about 300 ng / mL about 15 minutes after the start of the extension.
[0300] In embodiments, a method comprising contacting an extended oligonucleotide with an SSO stabilizer comprises an assay signal at a given time point that is at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, or at least 10 times greater than the assay signal at a given time point for an otherwise identical method that does not comprise contact with an SSO stabilizer.
[0301] Another embodiment (2)
[0302] Another embodiment (2) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising (i) the analyte; (ii) a capture reagent that binds to the analyte, wherein the capture reagent is linked to an anchor reagent comprising an anchor oligonucleotide to form a capture reagent-anchor reagent hybrid, wherein the capture reagent-anchor reagent hybrid is immobilized or capable of being immobilized to a surface; and a detection reagent for the analyte, and the detection reagent comprises a nucleic acid primer, (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase to form an extended oligonucleotide, wherein the extended oligonucleotide comprises an anchor complement capable of binding to the anchor oligonucleotide; (c) binding the extended oligonucleotide to the anchor reagent; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.
[0303] In an embodiment, the detecting comprises: combining the extended oligonucleotide with one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label.
[0304] In an embodiment, the anchoring agent is covalently or non-covalently linked to the capture agent. In an embodiment, the linking comprises utilizing a cross-linking agent. In an embodiment, the cross-linking agent is sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC). In an embodiment, the anchoring agent is linked to the capture agent via a disulfide bond. In an embodiment, the anchoring agent is linked to the capture agent via a coupling reaction, such as a click reaction.
[0305] In embodiments, the capture reagent-anchoring reagent hybrid is directly immobilized to the surface, for example, via a covalent bond. In embodiments, the capture-anchoring reagent is directly immobilized to the surface via a covalent bond between the capture reagent portion of the capture reagent-anchoring reagent hybrid and the surface. In embodiments, the capture reagent-anchoring reagent hybrid comprises a first binding partner that binds to a second binding partner on the surface. In embodiments, the first binding partner is located on the capture reagent portion of the capture reagent-anchoring reagent hybrid. In embodiments, the first binding partner is located on the anchoring reagent portion of the capture reagent-anchoring reagent hybrid. In embodiments, the first binding partner and the second binding partner comprise biotin and streptavidin. In embodiments, the first binding partner and the second binding partner comprise a hapten and a protein capable of binding to the hapten. In embodiments, the first binding partner is biotin and the second binding partner is streptavidin. In embodiments, the anchoring oligonucleotide comprises biotin, the surface comprises streptavidin, and the capture-anchoring reagent hybrid is immobilized to the surface via the biotin on the anchoring oligonucleotide and the streptavidin on the surface.
[0306] In embodiments, the attachment of an anchoring reagent to a capture reagent: (a) provides improved uniformity and control in the preparation of the assay surface; (b) simplifies the assay preparation process by reducing the number of separate components that need to be immobilized on the surface; and / or (c) provides a consistent ratio of the amounts of anchoring reagent and capture reagent present on the surface.
[0307] Figure 17 An exemplary illustration of a further embodiment (2) is shown.
[0308] Another embodiment (3)
[0309] Another embodiment (3) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising: (i) an analyte; (ii) a first detection reagent, the first detection reagent binds to the analyte and comprises a first nucleic acid probe; (iii) a second detection reagent, the second detection reagent binds to the analyte and comprises a second nucleic acid probe; and (iv) a bridging oligonucleotide, wherein the first portion of the bridging oligonucleotide is capable of binding to the first nucleic acid probe and the second portion of the bridging oligonucleotide is capable of binding to the second nucleic acid probe, and wherein the bridging oligonucleotide further comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase to thereby form an extended oligonucleotide; and (c) detecting the extended oligonucleotide, thereby detecting the analyte.
[0310] In embodiments, the detecting comprises: binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.
[0311] In embodiments, each of the first and second detection reagents is a detection reagent as described herein, e.g., a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer.
[0312] In an embodiment, the nucleic acid primer of the bridging oligonucleotide is a nucleic acid primer as described herein, e.g., capable of hybridizing to a template oligonucleotide and being extended to form an extended oligonucleotide as described herein. In an embodiment, the nucleic acid primer of the bridging oligonucleotide comprises any one of SEQ ID NOs: 1-4.
[0313] Figure 18 An exemplary illustration of a further embodiment (3) is shown.
[0314] Another embodiment (4)
[0315] Another embodiment (4) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising (i) an analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises a binding sequence capable of binding to an anchoring agent, wherein the anchoring agent is immobilized on a surface, or wherein the first complex further comprises a capture agent that binds to the analyte, wherein the capture agent is immobilized or capable of being immobilized to a surface, and wherein the anchoring agent is linked to the capture agent, and wherein the binding sequence is capable of forming an aptamer or a tertiary oligonucleotide structure, and the anchoring agent comprises a protein, antibody, hapten or affinity tag capable of binding to the aptamer or the tertiary oligonucleotide structure; (c) binding the binding sequence to the anchoring agent; and (d) detecting the extended oligonucleotide bound to the surface, thereby detecting the analyte.
[0316] In embodiments, the detecting comprises: binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.
[0317] In an embodiment, the binding sequence forms a G-quadruplex, and the anchoring agent comprises a DNA binding protein capable of binding to the G-quadruplex. In an embodiment, the binding sequence forming the G-quadruplex comprises the formula d(G 3+ N 1- 7G 3+ N 1-7 G 3+ N 1-7 G 3+ (SEQ ID NO: 45)), wherein G is guanine and N is any nucleotide. In an embodiment, the template oligonucleotide comprises a nucleotide having the formula d(C 3+ N 1-7 C 3+ N 1-7 C 3+ N 1-7 C 3+ (SEQ ID NO: 46)), wherein C is cytosine, and N is any nucleotide. In an embodiment, the template oligonucleotide comprises the sequence CCCTCCCTCCCTCCC (SEQ ID NO: 38).
[0318] In an embodiment, the binding sequence forms an aptamer, and the anchoring agent comprises an antibody, a hapten, or an affinity tag capable of binding to the aptamer. In an embodiment, the aptamer-forming binding sequence and its corresponding anchoring agent are shown in Table 6.
[0319] Table 6. Aptamer formation binding sequences and anchoring reagents
[0320]
[0321] Figure 19A and 19B An exemplary illustration of a further embodiment (4) is shown.
[0322] Another embodiment (5)
[0323] Another embodiment (5) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising (i) an analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises a binding sequence capable of binding to an anchoring agent, wherein the anchoring agent is immobilized on a surface, or wherein the first complex further comprises a capture agent that binds to the analyte, wherein the capture agent is immobilized or capable of being immobilized to a surface, and wherein the anchoring agent is linked to the capture agent, and wherein the binding sequence comprises a binding portion, and the anchoring agent comprises a protein or antibody capable of binding to the binding portion; (c) binding the binding sequence to the anchoring agent; and (d) detecting the extended oligonucleotide bound to the surface, thereby detecting the analyte.
[0324] In embodiments, the detecting comprises: binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.
[0325] In an embodiment, the binding moiety is linked to the nucleotides of the binding sequence. In an embodiment, the extension comprises incorporating one or more nucleotides linked to the binding moiety into the extended oligonucleotide. In an embodiment, the binding sequence comprises at least two binding moieties, and wherein the anchoring agent is capable of multivalently binding to the at least two binding moieties. In an embodiment, the binding moiety comprises a hapten. Non-limiting examples of haptens include digoxigenin, biotin, or dinitrophenol (DNP). In an embodiment, the binding sequence comprises at least two haptens, such as at least two digoxigenins, biotin, and / or DNP. In an embodiment, the binding moiety comprises digoxigenin, and the anchoring agent comprises an anti-digoxigenin antibody. In an embodiment, the binding moiety comprises biotin, and the anchoring agent comprises avidin, streptavidin, or an anti-biotin antibody. In an embodiment, the binding moiety comprises DNP, and the anchoring agent comprises an anti-DNP antibody.
[0326] Figure 20 An exemplary illustration of a further embodiment (5) is shown.
[0327] Another embodiment (6)
[0328] Another embodiment (6) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising (i) an analyte; (ii) a first detection reagent, the first detection reagent binds to the analyte and comprises a first nucleic acid primer; and (iii) a second detection reagent, the second detection reagent binds to the analyte and comprises a second nucleic acid primer, wherein the template oligonucleotide comprises a first region that can hybridize to the first nucleic acid primer and a second region that can hybridize to the second nucleic acid primer; (b) hybridizing the first nucleic acid primer and the second nucleic acid primer to the template oligonucleotide to form a second complex; (c) extending the first nucleic acid primer to form a first extended oligonucleotide, and extending the second nucleic acid primer to form a second extended oligonucleotide; and (d) detecting the first extended oligonucleotide and the second extended oligonucleotide, thereby detecting the analyte.
[0329] In embodiments, the detecting comprises: combining the first extended oligonucleotide and / or the second extended oligonucleotide with one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the first extended oligonucleotide and / or the second extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.
[0330] In embodiments, each of the first and second detection reagents is a detection reagent as described herein, e.g., a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In embodiments, the first and second nucleic acid primers comprise different sequences. In embodiments, the first and second nucleic acid primers each independently comprise any one of SEQ ID NOs: 1-4, provided that the first and second nucleic acid primers are not identical.
[0331] In an embodiment, the template oligonucleotide comprises one or more adapter oligonucleotides that can be connected to form a circular template, wherein the first region is located on a first adapter oligonucleotide and the second region is located on a second adapter oligonucleotide. In an embodiment, the method comprises connecting the first adapter oligonucleotide and the second adapter oligonucleotide before, during or after hybridization of the first nucleic acid primer and / or the second nucleic acid primer to the adapter oligonucleotide, thereby forming a circular template. In an embodiment, the circular template is a template for RCA. In an embodiment, the extension comprises RCA.
[0332] In embodiments, the method comprising extending both the first nucleic acid primer and the second nucleic acid primer to form a first extended oligonucleotide and a second extended oligonucleotide, respectively, increases the signal by at least 25%, at least 50%, at least 75%, at least 100%, at least 150%, at least 200%, or at least 300%, compared to the otherwise identical method except that only one of the first nucleic acid primer and the second nucleic acid primer is extended.
[0333] Figure 21 An exemplary illustration of a further embodiment (6) is shown.
[0334] Another embodiment (7)
[0335] Another embodiment (7) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising (i) an analyte; (ii) a first detection reagent, the first detection reagent binding to the analyte and comprising a first nucleic acid primer; and (iii) a second detection reagent, the second detection reagent binding to the analyte and comprising a second nucleic acid primer, wherein the analyte is present on a surface; (b) hybridizing the first nucleic acid primer and the second nucleic acid primer to the template oligonucleotide to form a second complex; and extending the first nucleic acid primer and / or the second nucleic acid primer with a polymerase to form an extended oligonucleotide; and (c) detecting the extended oligonucleotide, thereby detecting the analyte.
[0336] In an embodiment, the template oligonucleotide comprises one or more adapter oligonucleotides that can be connected to form a circular template, wherein the first region is located on a first adapter oligonucleotide and the second region is located on a second adapter oligonucleotide. In an embodiment, the method comprises connecting the first adapter oligonucleotide and the second adapter oligonucleotide before, during or after hybridization of the first nucleic acid primer and / or the second nucleic acid primer to the adapter oligonucleotide, thereby forming a circular template. In an embodiment, the circular template is a template for RCA. In an embodiment, the extension comprises RCA.
[0337] In an embodiment, the detecting comprises: combining the extended oligonucleotide with one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label.
[0338] In an embodiment, the surface comprises a membrane. In an embodiment, the surface comprises a protein blotting membrane. In an embodiment, the membrane comprises nitrocellulose or a polyvinylidene fluoride (PVDF) membrane. In an embodiment, the method further comprises transferring the analyte from a protein gel to the surface before the contacting of (a). The method of transferring the analyte (e.g., protein) from a protein gel to a membrane (e.g., a protein blotting membrane) is known to those of ordinary skill in the art. See, for example, Mahmood et al., N Am J Med Sci 4 (9): 429-434 (2012).
[0339] In embodiments, the surface further comprises an anchoring agent capable of binding to the extended oligonucleotide, and wherein the method further comprises binding the extended oligonucleotide to the anchoring agent prior to the detecting of (c). In embodiments, the method further comprises immobilizing the anchoring agent to the surface before, during, or after the contacting of (a). In embodiments, the anchoring agent comprises a protein component, and the immobilization comprises binding the protein component to the surface.
[0340] The anchoring reagent of another embodiment (7) can be provided as a component of a kit described herein. In an embodiment, the anchoring reagent is provided pre-immobilized on a surface (e.g., a protein blot membrane described herein). In an embodiment, the anchoring reagent is provided in a protein blot transfer buffer and the anchoring reagent is transferred from the transfer buffer to the surface (e.g., a protein blot membrane) before the analyte is transferred to the surface (e.g., a protein blot membrane).
[0341] In an embodiment, the analyte comprises a protein, and the method comprises contacting the protein with (i) a first detection reagent and (ii) a second detection reagent, wherein the first detection reagent binds to a post-translational modification on the protein and comprises a first nucleic acid primer, and the second detection reagent contacts and specifically binds to the protein and comprises a second nucleic acid primer, thereby forming a first complex comprising the analyte, the first detection reagent, and the second detection reagent. Analyte complexes comprising a first detection reagent and a second detection reagent are further described herein. In an embodiment, the post-translational modification on the protein comprises phosphorylation, methylation, acetylation, hydroxylation, deamidation, isoprenylation, glycosylation, ubiquitination, monophosphate adenylation, ADP-ribosylation, or a combination thereof. In an embodiment, two detection reagents are used in the methods described herein, one specifically binding to the protein and the other binding to the post-translational modification, enabling highly sensitive and specific detection of post-translationally modified proteins.
[0342] In an embodiment, the surface comprises at least two different analytes, and the method is capable of detecting each different analyte. In an embodiment, each different analyte is located at different positions on the surface. In an embodiment, each different analyte is associated with different template oligonucleotides so that the extended oligonucleotide formed by the first complex is combined with different anchoring agents. In an embodiment, each different template oligonucleotide, and therefore each different analyte, is associated with a unique detectable label (e.g., fluorescent label, quantum dot or enzymatic activity), thereby allowing independent detection of at least two different analytes.
[0343] Figure 23 An exemplary illustration of a further embodiment (7) is shown.
[0344] Another embodiment (8)
[0345] Another embodiment (8) includes a method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase to form an extended oligonucleotide, wherein the extended oligonucleotide is capable of forming a secondary structure comprising a detectable enzymatic activity; and (c) detecting the detectable enzymatic activity, thereby detecting the analyte.
[0346] In embodiments, the second complex is bound to a surface.
[0347] In an embodiment, the secondary structure comprises an aptamer. In an embodiment, the aptamer comprises enzymatic activity. In an embodiment, the aptamer comprises enzymatic activity in the presence of an activator compound. In an embodiment, the enzymatic activity is peroxidase activity, and the activator compound is heme. Aptamers having peroxidase activity in the presence of heme are described, for example, in Liu et al., Bull. Chem. Soc. Jpn. 82(1):99-104 (2009). In some embodiments, the aptamer comprises the sequence ATTGGGAGGGATTGGGTGGG (SEQ ID NO: 43).
[0348] Figure 22 An exemplary illustration of a further embodiment (8) is shown.
[0349] sequence
[0350] In embodiments, the present invention provides an oligonucleotide having any one of SEQ ID NOs: 1-37. In embodiments, the present invention provides an oligonucleotide having any one of SEQ ID NOs: 1-18. In embodiments, the present invention provides an oligonucleotide comprising any one of SEQ ID NOs: 11, SEQ ID NOs: 17, or SEQ ID NOs: 20-37. In embodiments, the present invention provides an oligonucleotide comprising any one of SEQ ID NOs: 7-10 or SEQ ID NOs: 12-15, or SEQ ID NO: 19. In embodiments, the present invention provides an oligonucleotide consisting of any one of SEQ ID NOs: 11, SEQ ID NOs: 17, or SEQ ID NOs: 20-37. In embodiments, the present invention provides an oligonucleotide consisting of any one of SEQ ID NOs: 7-10 or SEQ ID NOs: 12-15, or SEQ ID NO: 19.
[0351]
[0352]
[0353] All references cited herein, including patents, patent applications, articles, textbooks, and the like, and references cited herein, to the extent not already cited, are hereby incorporated by reference in their entirety.
[0354] Examples
[0355] Example 1. General protocol for sandwich immunoassay
[0356] An ECL-based detection assay according to the examples herein was performed as follows:
[0357] The detection antibody is modified by adding nucleic acid primers using oligonucleotide-polypeptide conjugation technology known to those of ordinary skill in the art, for example, as described in WO 2020 / 180645. The streptavidin-coated plate wells of the multi-well plate are coated with biotinylated anchor oligonucleotides and biotinylated capture antibodies and then washed. The blocking solution and the sample containing the target analyte are then added to the wells. After incubation at room temperature, the wells are washed. A solution containing the detection antibody conjugated to the nucleic acid primer is added to each well (25 μL per well) and incubated for 1-2 hours with shaking. A ligation mixture is then added to each well, which includes (i) template oligonucleotide (4 nM), ligation buffer, ATP (1 mM) and T4 DNA ligase (0.15 U / pL). The plate was incubated with the ligation mixture at room temperature for 30 minutes, washed to remove excess template oligonucleotides, and incubated with an RCA mixture containing rolling circle amplification buffer, dNTPs (250 pM each) and Phi29 DNA polymerase (0.125 U / ml) at 37 ° C for 1.5 hours. After incubation with the RCA mixture, the plate was washed and then incubated at 37 ° C for 30 minutes with a detection mixture containing 20 mM Tris, 1 mM EDTA, 250 mM NaCl, 0.01% TRITON, BSA (200 μg / mL), TWEEN20 (0.05%) and a mixture of labeled probes containing detection oligonucleotides (6.25 nM). After incubation with the detection mixture, the plate was washed and 150 μL MSD read buffer was added. After adding read buffer on a BIOMEDIA® 6000 reader, the plate was immediately read (plates and reader provided by Meso Scale Discovery, Rockville, MD, USA).
[0358] Example 2. Improved detection oligonucleotides
[0359] Conventional detection oligonucleotides (i.e., without any modified nucleotides) of the labeled probes used in ECL-based detection assays inhibit the activity of Phi29 DNA polymerase during RCA, resulting in lower assay sensitivity and longer assay run times. To alleviate the polymerase inhibition problem, the assay is typically performed without the labeled probe in the extension step, and the labeled probe is added in a separate step after extension, as described in the protocol of Example 1. See also, for example, WO 2014 / 165061; WO 2014 / 160192; and WO 2015 / 175856. This two-part extension and detection improves assay performance, but also increases assay run time.
[0360] Compared with conventional detection oligonucleotides (length greater than 20 nucleotides), improved detection oligonucleotides are developed into shorter (length less than 20 nucleotides) and are incorporated with locked nucleic acid (LNA) residues. It is found that such detection oligonucleotides do not inhibit DNA polymerase, thereby producing higher ECL assay signals. Compared with conventional detection oligonucleotides, shorter detection oligonucleotides can reduce assay development complexity and can be used to produce higher assay signals even when provided at lower concentrations compared with conventional detection oligonucleotides. Further, when using shorter detection oligonucleotides, more copies of detection oligonucleotides can be combined with extended oligonucleotides compared with conventional detection oligonucleotides, thereby increasing assay signals.
[0361] Improved detection oligonucleotides were synthesized and purified by FPLC prior to use in the assays described herein. For FPLC, a HiTrap Q HP 1 mL anion exchange column was used with an AKTA TM The PURE 25 system was used. Two gradients were tested: Method 1, a 0-800 mM NaCl gradient; Method 2, a 400-700 mM NaCl gradient. Elution fractions were analyzed on a 15% urea-TBE gel using an IDT 20 / 100 DNA ladder and visualized with SYBR Gold stain.
[0362] The improved detection oligonucleotides were used in a comparative assay with conventional detection oligonucleotides according to a simplified version of the protocol described in Example 1. In this simplified protocol, rather than using a biotinylated capture antibody that is attached to a streptavidin-coated plate surface to form a sandwich complex comprising the capture antibody, the target analyte, and the detection antibody conjugated to a nucleic acid primer, a biotinylated nucleic acid primer oligonucleotide was attached directly to the streptavidin-coated surface, for example at a concentration of 33 fM, with 10 DNase I antibodies per well. 6 primer oligonucleotide molecules. Figure 2A The results of the present invention are shown using a nucleic acid of 23 nucleotides in length without any modification ( Figure 2A The conventional detection oligonucleotide (labeled as "DNA-23" in FIG) and the oligonucleotide according to the present invention having a length of 10 nucleotides and comprising 6 LNAs (labeled as "DNA-23" in FIG) are shown in FIG. Figure 2A Representative results of a comparative assay using an improved detection oligonucleotide (labeled "LNA-10 / 6" in Figure 2 ). Each of the two detection oligonucleotides was added at a concentration of 6.25 nM during the extension step ("combination" format) or in a separate step after extension ("alone" format). The results show that the improved detection oligonucleotide provided a higher assay signal in both the individual and combined formats.
[0363] Figure 2B A conventional 23 nucleotide detection oligonucleotide is shown ( Figure 2B Representative results of a further comparison of a detection oligonucleotide comprising 10 nucleotides in length and including 5 LNAs (labeled as "Detect23" in FIG) with an improved detection oligonucleotide according to the present invention. Figure 2B The signal to non-specific background (NSB) ratios were significantly better in both the "combined" and "alone" formats of the improved detection oligonucleotides compared to conventional detection oligonucleotides.
[0364] The sequences of the detection oligonucleotides (shown with a modifier conjugated to a detectable label) are provided below. Each oligonucleotide is conjugated to three SULFO- -NHS conjugation.
[0365] Sequences of the detection oligonucleotides used in this example:
[0366] 23-nucleotide conventional detection oligonucleotide (DNA-23 or Detect23): CAGTGAATGCGAGTCCGTCTAAG / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / (SEQ ID NO:19)
[0367] 10-nucleotide detection oligonucleotide with 6 LNAs (LNA-10 / 6): G+A+G+T+C+C+GTCT / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / (SEQ ID NO:14)
[0368] 10-nucleotide detection oligonucleotide with 5 LNAs (Detect10+5L(A)): G+A+G+T+C+CGTCT / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / (SEQ ID NO:15)
[0369] Benchmark assays comparing various combinations of detection oligonucleotides with LNA and / or 2'-OMe nucleotides demonstrated that including 2'-OMe nucleotides helped reduce interference between the polymerase and the detection oligonucleotide in the reaction mixture. Figure 12 Shown in. Figure 12 The detection oligonucleotides and template oligonucleotides shown in are as follows:
[0370] D10A+5L: 10-nucleotide (nt) detection oligonucleotide with 5 LNAs; used with 61-nt template
[0371] D10A+5L5OM: 10-nt detection oligonucleotide with 5 LNA and 5 2'-OMe nucleotides; for use with 61-nt template
[0372] D10A+5L-58A: 10-nt detection oligonucleotide with 5 LNAs; for use with 58-nt template
[0373] D10A+5L5OM-58A: 10-nt detection oligonucleotide with 5 LNA and 5 2'-OMe nucleotides; for use with a 58-nt template
[0374] D10A+5L / D10B+6L: mixture of D10A+5L and D10B+6L; used with 61-nt template
[0375] D10A+5L5OM / D10B+6L: mixture of D10A+5L5OM and D10B+6L; used with 61-nt template
[0376] Assays performed with the D10A+5L-58A and D10A+5L5OM-58A detection oligonucleotides utilized a 58-nt template oligonucleotide containing three copies of the "D10A" sequence, whereas assays performed with the D10A+5L, D10A+5L5OM, D10A+5L / D10B+6L, and D10A+5L5OM / D10B+6L detection oligonucleotides utilized a 61-nt template oligonucleotide containing only one copy of the D10A sequence and one copy of the "D10B" sequence. Figure 12As shown in , for all tested detection oligonucleotide concentrations, D10A+5L5OM (containing 2'-OMe nucleotides) had a higher signal / non-specific binding (NSB) ratio than D10A+5L (no 2'-OMe nucleotides), and D10A+5L5OM / D10B+6L (containing 2'-OMe nucleotides) had a higher signal / NSB ratio than D10A+5L / D10B+6L (no 2'-OMe nucleotides). When D10A+5L was tested with a 58-nt template ("D10A+5L-58A"), the dependence of the signal / NSB ratio on detection oligonucleotide concentration was similar to that observed with the 61-nt template, with a gradual decrease in the ratio as the detection concentration increased, likely due to increased interference with the polymerase. When D10A+5L5OM5L was tested on a 58-nt template ("D10A+5L5OM-58A"), both the signal and the signal / NSB ratio increased with increasing detection oligonucleotide concentration, demonstrating reduced polymerase interference compared to D10A+5L. However, compared to the same concentration of D10A+5L, using the 58-nt template oligonucleotide, the signal and signal / NSB ratio of D10A+5L5OM were lower at detection oligonucleotide concentrations of 6.2 nM and 19 nM, and were only higher at a detection oligonucleotide concentration of 56 nM. Sequence differences between the 58-nt template and the 61-nt template and the presence of triplet repeats in the 58-nt template may account for the observed differences in signal and signal / NSB ratio between the two templates tested with similar detection oligonucleotide pairs.
[0377] Example 3. Cleavage of template oligonucleotides
[0378] Extension reactions in the assays described herein were terminated by cleavage of the template oligonucleotide to test assay endpoint stability and robustness to time and temperature variations.
[0379] The following restriction enzymes of different types and with recognition sites of different lengths were evaluated: AvaII, BstMutI, DdeI, HinfI, Hpy188I, NciI, Sau96I, ScrFI, TspRI (5 nt); AluI, BfaI, CviAII, CviKI01, CviQI, DpnII, FatI, HpaII, HpyCH4IV, MboI, MluCI, MseI, MspI, NlaIII, RsaI, Sau3AI, TaqI-v2 (4 nt); and StuI, Apo I, AseI, AvaI, BsaAI, BsmI, BsrI, PmlI, PvuI, SmaI, XmaI (6 nt).
[0380] Restriction enzymes DdeI, AluI, HpaII and StuI were tested in a simplified assay protocol as described in Example 2. The assay further employed a 58-nucleotide template oligonucleotide with a DdeI, HpaII or AluI restriction site, and a 59-nucleotide template oligonucleotide with a StuI restriction site. Amplification was performed at 27°C using Phi29 polymerase (0.5 μg / mL) for 1 hour. 6.25 nM Detect10+5L (A) detection oligonucleotide and DdeI, HpaII, AluI or StuI were added simultaneously with the polymerase. Amplification was terminated by adding PBS containing 10 mM EDTA at each time point. Read Buffer A was used to generate the ECL assay signal. Figures 3A-3D Results are shown for DdeI, HpaII, AluI and StuI, respectively. With the exception of StuI, all restriction enzymes showed a clear ability to terminate the assay.
[0381] Further experiments were performed with DdeI cleavage of the template oligonucleotide to evaluate the calibration curve and measure termination kinetics. For the calibration curve, the same assay was performed with a 61-nucleotide template oligonucleotide and 0 to 0.3 U / well DdeI at 27°C for 0.5 h. The calibration curve was obtained at Figure 4 The results are shown in Figure 3 and indicate that the termination rate does not affect the Hill slope, which remains stable as the DdeI concentration changes.
[0382] To measure termination kinetics, the same assay as above was performed with a 58-nucleotide template oligonucleotide containing 0 U, 0.005 U, or 0.05 U / well of DdeI at 20°C, 23.5°C, and 27°C for time points up to 180 min. Figure 5 The termination kinetic data in show that in the presence of restriction enzyme, there is a time point at which the signal intensity is similar for all three temperatures tested, compared to the "no enzyme" condition. The time at which the signals are equal at different temperatures depends on the DdeI concentration. For a DdeI concentration of 0.005 U / well, similar signals are obtained at a time point of approximately 120 minutes for all three conditions: 20°C, 23.5°C, and 27°C, while for a DdeI concentration of 0.05 U / well, equal signals are reached at a time point of approximately 60 minutes. This observation suggests that at different enzyme concentrations, there is a time window within which signal generation is independent of temperature.
[0383] During the amplification step, specific enzyme concentrations can be used to achieve temperature-independent signal generation. Figure 6AA significant dependence of the signal on temperature was shown in the absence of enzyme, with the signal varying from approximately 60,000 ECL at 20°C to 150,000 ECL at 23.5°C and 300,000 ECL at 27°C, while in the presence of 0.5 U / well ApoI, the signal remained within 45,000-50,000 ECL at all three temperatures. Figure 6B The same results are shown with the signal normalized to 1 hour at 27° C. In the absence of termination, the signal varied between 20% and 100%, whereas with ApoI in the reaction mixture, the overall signal difference between temperatures remained within the 80-120% interval.
[0384] In addition, termination of the amplification reaction by template cleavage also helps to achieve time-independent signal generation. Amplification reactions were tested at three different temperatures, 20°C, 23.5°C, and 27°C, in the presence and absence of enzyme (exemplary results for TspRI are in Figures 7A-7C Figure 3 shows amplification results in Figure 3 and amplification results in Figure 3 . The signal generation was measured at several time points: 45 minutes, 60 minutes, 75 minutes, and 90 minutes. The results showed that, at all temperatures tested, the signal dependence on time was smaller when the amplification was terminated than when the amplification was not terminated. Figure 7A and 7B An example of amplification results generated at 23.5°C is shown: no signal difference was observed at 45 minutes compared to the 60 minute time point with TspRI termination, and approximately a 30% difference was observed between the 45 minute and 60 minute time points in the absence of enzyme. Additionally, at the 75 minute and 90 minute time points, a signal change of 13% versus 33% and 43% versus 55% was observed for terminated versus unterminated reactions, respectively. The "full" version of the double antibody sandwich immunoassay according to Example 1 (with IL-5 as analyte) was performed on streptavidin-coated plates ( Figure 7C ). A simplified immunoassay as described in Example 2 ( Figure 7B ) and the full version of the immunoassay ( Figure 7C ) are similar, confirming that the signal's independence from time is improved in the presence of termination compared to without termination.
[0385] Example 4. Improved anchor oligonucleotides
[0386] Shorter anchor oligonucleotides can reduce the complexity of assay development compared to longer anchor oligonucleotides. Therefore, in an assay as described in Example 2, anchor reagents comprising anchor oligonucleotides of 12 nucleotides in length ("12-mers," e.g., Figure 8A and 8B 8-11 ) and 9-mer oligonucleotides having locked nucleic acid (LNA) and / or 2'-O-methylated (2'-OMe or OM) nucleic acid (e.g., designated A9 in FIG. 8-11 ).
[0387] Figure 8A revealed that shorter anchor oligonucleotides were found to reduce background signal when used at the same concentration as longer oligonucleotides. Figure 8B As shown in , shorter anchor oligonucleotides require higher coating concentrations, which increases background. Figure 8A In the graph, the ECL signal is indicated on the y-axis and the various anchor oligonucleotides are indicated on the x-axis. "IL-4 only" indicates an assay without an anchor oligonucleotide, while "A12-300" and "A25-300" indicate 12-mer and 25-mer anchor oligonucleotides, respectively, without any modified nucleotides at a concentration of 300 nM. LNA9-1-300, LNA9-2-300, etc. indicate anchor oligonucleotides that are 9 nucleotides in length and have 1 or 2 locked bases, respectively. It was found that incorporating locked nucleic acids and / or 2'-O-methylated (2'-OMe) nucleic acids into the anchor oligonucleotides reduced the required coating concentration and further reduced the background ( Figure 8A and 8B ).
[0388] The anchor oligonucleotide is immobilized on the surface by binding the biotin moiety on the anchor oligonucleotide to the streptavidin on the surface, or by conjugating the thiol moiety on the anchor oligonucleotide to the surface. The anchor oligonucleotide comprising the thiol moiety further comprises a PEG-spacer between the anchor oligonucleotide and the thiol group. Figure 9A Results for modified short anchors are shown, and Figure 9B Results are shown for longer 25-mer oligonucleotides. Figures 9A-9B The stability of the ECL signal is shown as the percentage of the ECL signal retained as the scrubber speed increases. Figure 9A The shorter A9+3L6OM anchor containing LNA and 2'-OMe bases showed the same Figure 9B Similar stability to the A25 DNA-based anchor.
[0389] When using short modified anchor oligonucleotides, sample matrix interference is reduced compared to longer conventional anchor oligonucleotides. This reduction in sample matrix interference is a reduction in the average nonspecific signal and the range of nonspecific signals between samples ( Figure 10A and 10B ). This lower mean and range of nonspecific signal within the sample group allows for improved real-world sample sensitivity. Figure 10Ashows the human sample background and variability on the surface of conventional longer anchors and short modified anchors immobilized on the surface via binding of a biotin moiety, and Figure 10B Shown are the human sample background of anchors immobilized via thiol moieties and their variability on the surface.
[0390] Example 5. Combination of modified anchor oligonucleotides, modified detection oligonucleotides, and template oligonucleotide cleavage combine
[0391] Improved anchor oligonucleotides comprising LNA and 2'-OMe modified nucleic acids, improved detection oligonucleotides comprising LNA, and template oligonucleotides cleaved with DdeI were tested individually and in combination to determine wash stability as described in Examples 2-4.
[0392] Figure 11A Representative results for elution stability in standard sandwich immunoassays mediated by different anchor oligonucleotides ("anchors") are shown, including a conventional 25-mer anchor (A25), a modified 9-mer anchor with three LNAs and six 2'-OMe nucleotides (A9+3L6OM), and a modified 9-mer anchor with four LNAs (A9+4L), each anchor oligonucleotide immobilized on a surface via the binding of a biotin moiety. Four different immunoassays were tested using different anchors and conventional detection oligonucleotides, and the results of all four assays were averaged. Compared to conventional anchor oligonucleotides, the modified anchor oligonucleotides showed improved wash stability.
[0393] Figure 11B Representative results are shown for a conventional anchored 25-mer oligonucleotide that was not modified with a conventional detection oligonucleotide ("D23") or with a mixture of a modified detection oligonucleotide comprising 5 LNAs and 5 2'-OMe-modified nucleic acids ("D10A") and a modified detection oligonucleotide comprising 6 LNAs and no 2'-OMe-modified nucleic acids as described herein ("D10B") (the mixture is denoted "D10A+10B"), and the concentration of the primer oligonucleotides used in the simplified sandwich assay was varied. The modified detection oligonucleotides exhibited improved wash stability compared to the conventional detection oligonucleotides.
[0394] Figure 11C Representative results are shown for an anchor oligonucleotide comprising nine nucleotides, three of which are LNA and six of which are 2'-OMe nucleotides, with either D23 or D10A+D10B detection oligonucleotides. The modified detection oligonucleotides showed improved wash stability compared to conventional detection oligonucleotides.
[0395] Figure 11DRepresentative results are shown for an assay using two concentrations of DdeI and two concentrations of primer oligonucleotides for template oligonucleotide cleavage and D10A+D10B detection oligonucleotides used in a simplified version of the sandwich assay as described in Example 2. All four conditions showed comparable wash stability, with significantly improved wash stability compared to the condition without termination by template cleavage ( Figure 11C ).
[0396] Figure 11E Figure 3 shows that the presence of a modified anchor oligonucleotide (A9+3L6OM) immobilized to the surface via a thiol moiety, a modified detection oligonucleotide (D10A+D10B), and a template oligonucleotide cleaved with TspRI (AVR 2.0TspRI) were significantly different when using a conventional anchor and detection oligonucleotide (AVR 1.0). Representative results of a double antibody sandwich immunoassay according to the examples herein performed on streptavidin-coated plates. Signals from 12 assays for each reagent combination were normalized and averaged, and the results show that the novel modified oligonucleotides and termination by template cleavage significantly improve wash stability compared to conventional oligonucleotides without termination.
[0397] Example 6. Single-stranded oligonucleotide (SSO) stabilizers during extension
[0398] To test the effect of SSO stabilizers during extension reactions, an ultrathermostable single-stranded DNA binding protein (ET SSB) was added to a benchmark assay based on the simplified assay described in Example 2. A primer concentration equivalent to 500,000 molecules per well was used. Extension reactions were performed with Phi29 in combination with the "D10A+5L" detection oligonucleotide as described in Example 2 for 1 hour, 4 hours, or 24 hours. ET SSB was added to the plate before or after the polymerase.
[0399] When SSB was added before the polymerase, signal recovery was observed from 4 to 24 hours at 31.25 ng / mL ET SSB, but the 24 hour signal did not exceed the 4 hour signal. Figure 13 , top panel. Higher concentrations of ET SSB appear to inhibit polymerase activity. When ET SSB is added after the polymerase, the signal at 24 hours exceeds the signal at 4 hours at 125 ng / mL ET SSB. Figure 13 , below.
[0400] Further benchmark assays were performed using 100,000 primers per well using various concentrations of ET-SSB. Extension reactions were performed using Phi29 in combination with "D10A+5L" for 1, 4, or 24 hours. ET-SSB was added to the assay at 0, 5, 15, or 60 minutes after the polymerase.
[0401] like Figure 14 As shown in , under these assay conditions, the addition of ET SSB 15 minutes after the start of the extension reaction showed the strongest signal recovery. Furthermore, the addition of ET SSB 15 minutes after the start of the extension reaction increased the signal by 2.8-fold at 24 hours ( Figure 15 ), and increased by 47% compared with 4 h amplification ( Figure 16 ).
Claims
1. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex comprising: (1) the analyte; and (2) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) binding the extended oligonucleotide to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; as well as (d) detecting the detectable label, thereby detecting the analyte, wherein the second complex is bound to a surface, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) One or both of (i) and (ii), further wherein the surface comprises an anchoring agent; (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or (vi) Any combination of (i), (ii) and (v). 2 . The method of claim 1 , wherein the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof. 3 . The method of claim 1 , wherein the modified nucleic acid comprises a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a nucleoside comprising a 2′ modification, or a combination thereof.
4. The method of claim 3, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.
5. The method of any one of claims 1 to 4, wherein the detection oligonucleotide is about 4 to about 30 nucleotides in length. The method of claim 5 , wherein the detection oligonucleotide is about 5 to about 25 nucleotides in length. The method of claim 6 , wherein the detection oligonucleotide is about 6 to about 12 nucleotides in length.
8. The method according to any one of claims 1 to 7, wherein the detection oligonucleotide consists of modified nucleic acids, wherein each modified nucleic acid comprises PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof.
9. The method according to any one of claims 1 to 8, wherein the polymerase comprises strand displacement activity (SD polymerase).
10. The method of claim 9, wherein the SD polymerase comprises an amino acid sequence having at least 80% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.
11. The method of claim 10, wherein the SD polymerase comprises an amino acid sequence having at least 90% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.
12. The method according to claim 11, wherein the SD polymerase is a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Zaresi or BeachBum.
13. The method according to any one of claims 1 to 12, wherein the template oligonucleotide is a linear oligonucleotide and the method comprises ligating the 5' end and the 3' end of the linear oligonucleotide before, during or after hybridization of the nucleic acid primer to the template oligonucleotide, thereby forming a circular template.
14. The method according to any one of claims 1 to 13, wherein step (b) comprises hybridizing the nucleic acid primer to the template oligonucleotide and extending the nucleic acid primer by a nicking and extension amplification reaction (NEAR).
15. The method according to any one of claims 1 to 13, wherein step (b) comprises hybridizing the nucleic acid primer to the template oligonucleotide, ligating the template oligonucleotide to form a circular template, and extending the nucleic acid primer by rolling circle amplification (RCA).
16. The method of any one of claims 1 to 15, wherein the method further comprises terminating the extension by cleavage of the template oligonucleotide.
17. The method of any one of claims 1 to 16, wherein the cleavage comprises contacting a nuclease with the template oligonucleotide. The method according to claim 17 , wherein the nuclease specifically cleaves the double-stranded portion of the template oligonucleotide hybridized to the nucleic acid primer.
19. The method according to claim 18, wherein the nuclease specifically cleaves a DNA / RNA hybrid formed by hybridization of the template oligonucleotide and the nucleic acid primer.
20. The method of any one of claims 17 to 19, wherein the nuclease is a restriction endonuclease.
21. The method of claim 20, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.
22. The method of claim 19, wherein the nuclease is an endoribonuclease, optionally RNase H2.
23. The method of claim 17, wherein the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator and cleaves the template oligonucleotide.
24. The method of claim 23, wherein the DNA damage indicator comprises a uracil base and the nuclease comprises uracil-N-glycosylase (UNG).
25. The method of claim 24, wherein the cleavage further comprises providing an abasic site endonuclease.
26. The method of claim 25, wherein the abasic site endonuclease comprises uracil-DNA glycosylase (UDG), APE1, endonuclease IV, or a combination thereof.
27. The method of claim 23, wherein the DNA damage indicator comprises deoxyinosine and the nuclease comprises endonuclease V.
28. The method of claim 23, wherein the DNA damage indicator comprises a damaged purine and the nuclease comprises an enzyme that repairs the damaged purine.
29. The method of claim 28, wherein the damaged purine comprises 8oxoG and the nuclease comprises formamidopyrimidine DNA glycosylase (Fpg).
30. The method of any one of claims 1 to 29, wherein when the extension comprises rolling circle amplification (RCA) and the method comprises the termination, the range of assay signals produced by the method varies by no more than 2-fold over an assay temperature range of about 20°C to about 27°C.
31. The method of claim 30, wherein the assay signal range does not vary by more than a factor of 1.5 within the assay temperature range of about 20°C to about 27°C.
32. The method of any one of claims 1 to 31, wherein when the extension comprises rolling circle amplification (RCA) and the method comprises the termination, the range of the assay signal produced by the method varies by no more than ±50% over an assay temperature range of about 20°C to about 27°C.
33. The method of claim 32, wherein the assay signal range does not vary by more than ±30% over the assay temperature range of about 20°C to about 27°C.
34. The method of any one of claims 1 to 33, wherein when the extension comprises rolling circle amplification (RCA) and the method comprises the termination, the range of assay signals produced by the method varies by no more than 2-fold over an extension time range of about 5 minutes to about 90 minutes.
35. The method of claim 34, wherein the assay signal range does not vary more than 2-fold over an extended time range of about 45 minutes to about 90 minutes.
36. The method of claim 34, wherein the assay signal range does not vary by more than 2-fold over an extended time range of about 30 minutes to about 60 minutes.
37. The method of claim 34, wherein the assay signal range does not vary more than 2-fold over an extended time range of about 15 minutes to about 30 minutes.
38. The method of claim 34, wherein the assay signal range does not vary more than 2-fold over an extended time range of about 10 minutes to about 20 minutes.
39. The method of claim 34, wherein the assay signal range does not vary more than 2-fold over an extended time range of about 5 minutes to about 10 minutes.
40. The method of any one of claims 1 to 39, wherein when said extending comprises rolling circle amplification (RCA) and said method comprises said terminating, said extended oligonucleotide is about 500 to about 50,000 bases in length.
41. The method of claim 40, wherein the extended oligonucleotide is about 9,000 to about 40,000 bases in length.
42. The method of claim 40, wherein the extended oligonucleotide is about 3,000 to about 13,000 bases in length.
43. The method of claim 40, wherein the extended oligonucleotide is about 1,000 to about 4,500 bases in length.
44. The method of any one of claims 1 to 39, wherein when the extending comprises rolling circle amplification (RCA) and the method comprises the terminating, the extended oligonucleotide comprises about 5% to about 35% of the length of an extended oligonucleotide formed by substantially the same method not comprising the terminating.
45. The method of claim 44, wherein the extended oligonucleotide comprises about 6% to about 32% of the length of an extended oligonucleotide formed by substantially the same method that does not comprise the termination.
46. The method of claim 44, wherein the extended oligonucleotide comprises about 1% to about 10% of the length of an extended oligonucleotide formed by substantially the same method that does not comprise the termination.
47. The method of any one of claims 40 to 46, wherein the RCA is performed at about 20°C to about 27°C.
48. The method of any one of claims 30 to 47, wherein the terminating comprises providing a nuclease to the template oligonucleotide, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.
49. The method of any one of claims 1 to 48, wherein the surface does not comprise an anchoring agent.
50. The method of any one of claims 1 to 49, wherein the surface comprises an anchoring agent.
51. The method of claim 50, wherein the anchoring agent comprises an anchoring oligonucleotide.
52. The method of claim 51, wherein the anchor oligonucleotide comprises a modified nucleic acid.
53. The method of claim 52, wherein the modified nucleic acid comprises PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof.
54. The method of claim 53, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.
55. The method of any one of claims 50 to 54, wherein the extended oligonucleotide comprises an anchor complement capable of binding to the anchor oligonucleotide, and wherein the method further comprises binding the extended oligonucleotide to the anchoring agent.
56. The method of claim 55, wherein the extended oligonucleotide is bound to the anchoring agent before or during step (c) of the method.
57. The method of any one of claims 51 to 56, wherein the anchor oligonucleotide is about 4 to about 30 nucleotides in length.
58. The method of claim 57, wherein the anchor oligonucleotide is about 6 to about 25 nucleotides in length.
59. The method of claim 58, wherein the anchor oligonucleotide is about 8 to about 12 nucleotides in length.
60. The method of any one of claims 50 to 59, wherein the anchor oligonucleotide consists of modified nucleic acids, wherein each modified nucleic acid comprises PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof.
61. The method of any one of claims 50 to 60, wherein the surface comprises a carbon composite material and the anchoring agent is covalently immobilized on the surface.
62. The method of any one of claims 50 to 61, wherein the anchoring reagent comprises a first binding partner, the surface comprises a second binding partner, and the anchoring reagent is immobilized on the surface via the interaction of the first binding partner and the second binding partner.
63. The method of claim 62, wherein the first binding partner and the second binding partner comprise a binding pair selected from the group consisting of a cross-reactive group, a complementary oligonucleotide, a receptor-ligand pair, an antigen-antibody pair, a hapten-antibody pair, an epitope-antibody pair, a mimotope-antibody pair, an aptamer-target molecule pair, a hybridization partner, or an intercalator-target molecule pair.
64. The method of claim 63, wherein the first binding partner comprises biotin and the second binding partner comprises streptavidin, avidin, an anti-biotin antibody, or a combination thereof.
65. The method of any one of claims 62 to 64, wherein the first binding partner is linked to a nucleotide of the anchor oligonucleotide.
66. The method of any one of claims 62 to 65, wherein the first binding partner is located at the 5' end or the 3' end of the anchoring reagent.
67. The method of claim 66, wherein the anchoring reagent further comprises a spacer positioned between the first binding partner and the anchoring oligonucleotide.
68. The method of claim 67, wherein the spacer comprises polyethylene glycol (PEG) comprising about 2 to about 10 ethylene glycol units.
69. The method of claim 68, wherein the PEG comprises from about 3 to about 8 ethylene glycol units.
70. The method of any one of claims 62 to 69, wherein the first binding partner is located at the 3' end of the anchoring reagent and the anchoring reagent comprises a PEG spacer comprising about 3 to about 8 ethylene glycol units.
71. A method according to any one of claims 1 to 70, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein before or during step (a), the first complex is formed by contacting a sample comprising the analyte with the following: first, the capture reagent, and second, the detection reagent.
72. A method according to any one of claims 1 to 70, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein before or during step (a), the first complex is formed by contacting a sample comprising the analyte with the following: first, the detection reagent, and second, the capture reagent.
73. A method according to any one of claims 1 to 70, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein before or during step (a), the first complex is formed by contacting a sample comprising the analyte with the capture reagent and the detection reagent simultaneously or substantially simultaneously.
74. The method of any one of claims 1 to 73, wherein the first complex and / or the second complex are contacted with the polymerase and the labeled probe simultaneously or substantially simultaneously.
75. The method of any one of claims 17 to 74, wherein the first complex and / or the second complex are contacted with the polymerase, the labeled probe, and the nuclease simultaneously or substantially simultaneously.
76. The method of any one of claims 1 to 75, wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and (ii) the method comprises terminating the extension by cleavage of the template oligonucleotide, Optionally wherein the surface comprises an anchoring agent.
77. A method according to any one of claims 1 to 48 or any one of claims 50 to 76, wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and (ii) The surface comprises an anchoring agent.
78. A method according to any one of claims 1 to 48 or any one of claims 50 to 76, wherein: (i) the method comprises terminating the extension by cleaving the template oligonucleotide; and (ii) The surface comprises an anchoring agent.
79. The method of any one of claims 76 to 78, wherein the anchoring agent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid.
80. The method of any one of claims 1 to 48 or any one of claims 50 to 79, wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the method comprises terminating the extension by cleaving the template oligonucleotide; and (iii) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid.
81. The method of any one of claims 1 to 80, wherein the anchor oligonucleotide comprises SEQ ID NO:
11.
82. The method of any one of claims 1 to 81, wherein the detection oligonucleotide comprises any one of SEQ ID NOs: 7-10.
83. The method of any one of claims 1 to 82, wherein the nucleic acid primer comprises SEQ ID NO:
1.
84. The method of any one of claims 1 to 83, wherein the template oligonucleotide comprises SEQ ID NO:
5.
85. The method of any one of claims 1 to 84, wherein the first complex further comprises a capture reagent that binds the analyte, and wherein the capture reagent and the detection reagent each independently comprise an antibody or antigen-binding fragment thereof, an oligonucleotide, an antigen, a ligand, a receptor, a hapten, an epitope, a mimotope, or an aptamer.
86. The method of claim 85, wherein the capture reagent and the detection reagent each comprise an antibody or antigen-binding fragment thereof.
87. The method of claim 85, wherein the capture reagent and the detection reagent each comprise an oligonucleotide.
88. The method of any one of claims 1 to 87, wherein the detectable label is capable of being measured by light scattering, light absorption, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, a magnetic field, or a combination thereof.
89. The method of claim 88, wherein the detectable label is an ECL label.
90. The method of any one of claims 1 to 89, wherein the surface comprises particles.
91. The method of any one of claims 1 to 89, wherein the surface comprises the wells of a multiwell plate.
92. The method of any one of claims 1 to 91, wherein the surface comprises an electrode.
93. The method of claim 91, wherein the detecting comprises applying a voltage waveform to the electrode to generate an ECL signal.
94. The method of claim 90, wherein the detecting comprises collecting the particles on an electrode and applying a voltage waveform to the electrode to generate an ECL signal.
95. A kit for detecting an analyte, the kit comprising in one or more vials, containers or compartments: (a) a capture reagent that binds to the analyte; (b) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer or is capable of being linked to a nucleic acid primer; (c) a labeled probe comprising (1) a detection oligonucleotide and (2) a detectable label; as well as (d) a template oligonucleotide capable of hybridizing to the nucleic acid primer and comprising the same sequence as the detection oligonucleotide; wherein the detection reagent comprises a protein or a polypeptide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the kit further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and wherein the kit further comprises an anchoring agent; (v) the kit further comprises an anchoring reagent, the anchoring reagent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or (vi) Any combination of (i), (ii) and (v).
96. The kit of claim 95, wherein the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof.
97. The kit of claim 95 or claim 96, wherein the modified nucleic acid comprises PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof.
98. The kit of claim 97, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.
99. The kit of any one of claims 95 to 98, wherein the detection oligonucleotide is about 4 to about 30 nucleotides in length.
100. The kit of claim 99, wherein the detection oligonucleotide is about 5 to about 25 nucleotides in length.
101. The kit of claim 100, wherein the detection oligonucleotide is about 6 to about 12 nucleotides in length.
102. The kit of any one of claims 95 to 101, wherein the detection oligonucleotides consist of modified nucleic acids, wherein each modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.
103. The kit of any one of claims 95 to 102, further comprising a polymerase.
104. The kit of claim 103, wherein the polymerase comprises strand displacement activity (SD polymerase).
105. The kit of claim 104, wherein the SD polymerase comprises an amino acid sequence having at least 80% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.
106. The kit of claim 105, wherein the SD polymerase comprises an amino acid sequence having at least 90% sequence identity to a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.
107. The kit of claim 106, wherein the SD polymerase is a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Zaresi, or BeachBum.
108. The kit of any one of claims 95 to 107, wherein the template oligonucleotide is a linear oligonucleotide, and wherein the 5' end and the 3' end of the linear oligonucleotide are capable of being ligated.
109. The kit of any one of claims 95 to 108, wherein the kit comprises the nuclease.
110. The kit of claim 109, wherein the nuclease specifically cleaves the double-stranded portion of the template oligonucleotide capable of hybridizing to the nucleic acid primer.
111. The kit of claim 110, wherein the template oligonucleotide is capable of hybridizing to the nucleic acid primer, and wherein the nuclease specifically cleaves a DNA / RNA hybrid formed by hybridization of the template oligonucleotide and the nucleic acid primer.
112. The kit of any one of claims 109 to 111, wherein the nuclease is a restriction endonuclease.
113. The kit of claim 112, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.
114. The kit of claim 111, wherein the nuclease is an endoribonuclease, optionally RNase H2.
115. The kit of claim 109, wherein the template oligonucleotide comprises a DNA damage indicator and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator.
116. The kit of claim 115, wherein the DNA damage indicator comprises a uracil base and the nuclease comprises uracil-N-glycosylase (UNG).
117. The kit of claim 116, further comprising an abasic site endonuclease.
118. The kit of claim 117, wherein the abasic site endonuclease comprises uracil-DNA glycosylase (UDG), APE1, endonuclease IV, or a combination thereof.
119. The kit of claim 115, wherein the DNA damage indicator comprises deoxyinosine and the nuclease comprises endonuclease V.
120. The kit of claim 115, wherein the DNA damage indicator comprises damaged purines and the nuclease comprises an enzyme that repairs the damaged purines.
121. The kit of claim 120, wherein the damaged purine comprises 8oxoG and the template-cleaving enzyme comprises formamidopyrimidine DNA glycosylase (Fpg).
122. The kit of any one of claims 95 to 121, wherein the kit comprises an anchoring reagent.
123. The kit of claim 122, wherein the anchoring reagent comprises an anchoring oligonucleotide.
124. The kit of claim 123, wherein the anchor oligonucleotide comprises a modified nucleic acid.
125. The kit of claim 124, wherein the modified nucleic acid comprises PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof.
126. The kit of claim 125, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.
127. The kit of any one of claims 123 to 126, wherein the anchor oligonucleotide is about 4 to about 30 nucleotides in length.
128. The kit of claim 127, wherein the anchor oligonucleotide is about 6 to about 25 nucleotides in length.
129. The kit of claim 128, wherein the anchor oligonucleotide is about 8 to about 12 nucleotides in length.
130. The kit of any one of claims 124 to 129, wherein the anchor oligonucleotide consists of modified nucleic acids, wherein each modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.
131. The kit of any one of claims 122 to 130, wherein the kit further comprises a surface, and wherein one or both of the capture reagent and the anchoring reagent are provided on the surface.
132. The kit of claim 131, wherein the surface comprises a carbon composite material, and wherein the anchoring agent is covalently immobilized on the surface.
133. The kit of any one of claims 122 to 130, wherein the capture reagent and the anchoring reagent are each capable of being immobilized on a surface.
134. The kit of claim 133, further comprising said surface.
135. The kit of claim 133 or claim 134, wherein the anchoring agent comprises a thiol and the surface comprises a carbon composite material.
136. The kit of any one of claims 133 to 135, wherein the anchoring reagent comprises a first binding partner and the surface comprises a second binding partner capable of interacting with the first binding partner.
137. The kit of claim 136, wherein the first binding partner and the second binding partner comprise a binding pair selected from the group consisting of a cross-reactive group, a complementary oligonucleotide, a receptor-ligand pair, an antigen-antibody pair, a hapten-antibody pair, an epitope-antibody pair, a mimotope-antibody pair, an aptamer-target molecule pair, a hybridization partner, or an intercalator-target molecule pair.
138. The kit of claim 137, wherein the first binding partner comprises biotin and the second binding partner comprises streptavidin, avidin, an anti-biotin antibody, or a combination thereof.
139. The kit of any one of claims 136 to 138, wherein the first binding partner is linked to a nucleotide of the anchor oligonucleotide.
140. The kit of any one of claims 136 to 139, wherein the first binding partner is located at the 5' end or the 3' end of the anchoring reagent.
141. The kit of claim 140, wherein the anchoring reagent further comprises a spacer positioned between the first binding partner and the anchoring oligonucleotide.
142. The kit of claim 141, wherein the spacer comprises polyethylene glycol (PEG) comprising about 2 to about 10 ethylene glycol units.
143. The kit of claim 142, wherein the PEG comprises about 3 to about 8 ethylene glycol units.
144. The kit of any one of claims 136 to 143, wherein the first binding partner is located at the 3' end of the anchoring reagent and the anchoring reagent comprises a PEG spacer comprising about 3 to about 8 ethylene glycol units.
145. The kit of any one of claims 95 to 144, wherein: The detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and The kit further comprises a nuclease capable of cleaving the template oligonucleotide, Optionally wherein the kit further comprises one or both of a surface and an anchoring agent.
146. The kit of any one of claims 95 to 145, wherein: The detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and Wherein the kit further comprises an anchoring agent and optionally a surface.
147. The kit of any one of claims 95 to 145, wherein: The kit further comprises a nuclease capable of cleaving the template oligonucleotide; and Wherein the kit further comprises an anchoring agent and optionally a surface.
148. The kit of any one of claims 145 to 147, wherein the anchoring reagent comprises an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid.
149. The kit of any one of claims 95 to 148, wherein: The detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; The kit comprises a nuclease capable of cleaving the template oligonucleotide; The kit comprises an anchoring reagent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; and Optionally wherein the kit comprises a surface.
150. The kit of any one of claims 95 to 149, wherein the anchor oligonucleotide comprises SEQ ID NO:
11.
151. The kit of claim 150, wherein the anchor oligonucleotide comprises 3' biotin.
152. The kit of claim 151, wherein the anchor oligonucleotide comprises SEQ ID NO:
17.
153. The kit of any one of claims 95 to 152, wherein the detection oligonucleotide comprises any one of SEQ ID NOs: 7-10.
154. The kit of claim 153, wherein the detection oligonucleotide comprises a 3' amino modifier, an internal amino modifier, an internal spacer, or a combination thereof.
155. The kit of claim 154, wherein the detection oligonucleotide comprises any one of SEQ ID NOs: 12-15.
156. The kit of any one of claims 95 to 155, wherein the nucleic acid primer comprises SEQ ID NO:
1.
157. The kit of claim 156, wherein the nucleic acid primer is capable of being linked to the detection reagent and comprises a 5' thiol.
158. The kit of claim 157, wherein the nucleic acid primer comprises SEQ ID NO:
18.
159. The kit of any one of claims 95 to 158, wherein the template oligonucleotide comprises SEQ ID NO:
5.
160. The kit of claim 159, wherein the template oligonucleotide is 5'-phosphorylated.
161. The kit of claim 160, wherein the template oligonucleotide comprises SEQ ID NO:
16.
162. The kit of any one of claims 95 to 161, wherein the capture reagent comprises an antibody or antigen-binding fragment thereof, an oligonucleotide, an antigen, a ligand, a receptor, a hapten, an epitope, a mimotope, an aptamer, or a combination thereof.
163. The kit of any one of claims 95 to 162, wherein the capture reagent and the detection reagent each comprise an antibody or antigen-binding fragment thereof.
164. The kit of any one of claims 95 to 163, wherein the detectable label is capable of being measured by light scattering, light absorption, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, a magnetic field, or a combination thereof.
165. The kit of claim 164, wherein the detectable label is an ECL label.
166. The kit of any one of claims 131 to 165, wherein the surface comprises particles.
167. A kit according to any one of claims 131 to 166, wherein the surface comprises the wells of a multi-well plate.
168. The kit of any one of claims 131 to 167, wherein the surface comprises an electrode.
169. The kit of any one of claims 95 to 168, further comprising a calibration reagent, a blocking reagent, a buffer, a ligase, a reagent for conjugating the nucleic acid primer to the detection reagent, a co-reactant for the detectable label, a detergent, a salt, a preservative, or a combination thereof.
170. A composition for labeling a surface, the composition comprising: a labeled probe, the labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to the extended oligonucleotide, said extended oligonucleotide being bound to said surface, wherein the extended oligonucleotide is formed by extending a nucleic acid primer based on a template oligonucleotide by a polymerase, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extended oligonucleotide is bound to the surface via an anchoring agent; (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or (vi) Any combination of (i), (ii) and (v).
171. A composition for marking a surface, the composition comprising: (a) a nucleic acid primer directly or indirectly immobilized on a surface; (b) a template oligonucleotide comprising (1) a first region complementary to the nucleic acid primer; and (2) a second region comprising the same sequence as the detection oligonucleotide; (c) polymerase; as well as (d) a labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to the extended oligonucleotide, the extended oligonucleotide being bound to the surface, wherein the extended oligonucleotide is formed by extending the nucleic acid primer based on the template oligonucleotide by the polymerase, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extended oligonucleotide is bound to the surface via an anchoring agent; (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or (vi) Any combination of (i), (ii) and (v).
172. The composition of claim 170 or 171, wherein the detectable label is an electrochemiluminescent (ECL) label.
173. The composition of any one of claims 170 to 172, wherein the detection oligonucleotide comprises a modified nucleic acid, wherein the modified nucleic acid comprises PNA, LNA, BNA, comprises a 2' modified nucleoside, or a combination thereof.
174. The composition of claim 173, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.
175. The composition of any one of claims 170 to 174, wherein the detection oligonucleotide is about 4 to about 30 nucleotides in length, preferably about 5 to about 25 nucleotides in length, more preferably about 6 to about 12 nucleotides in length.
176. The composition of any one of claims 170 to 175, further comprising one or more of: the polymerase, the nucleic acid primer, the template oligonucleotide, or a combination thereof.
177. A composition according to claim 176, wherein the composition comprises a polymerase with strand displacement activity (SD polymerase), and wherein the SD polymerase is a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi or BeachBum.
178. The composition of claim 176 or claim 177, wherein the composition comprises the nucleic acid primer, and wherein the nucleic acid primer is linked to a detection reagent, optionally wherein the detection reagent comprises an antibody or antigen-binding fragment thereof.
179. The composition of any one of claims 170 to 179, wherein the composition comprises the nuclease.
180. The composition of claim 179, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.
181. The composition of any one of claims 170 to 180, wherein the extended oligonucleotide is bound to the surface via an anchoring agent comprising an anchoring oligonucleotide.
182. The composition of claim 181, wherein the anchor oligonucleotide comprises a modified nucleic acid, optionally wherein the modified nucleic acid is a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.
183. The composition of claim 182, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-Ome), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.
184. A composition comprising: a capture reagent, an analyte, a detection reagent comprising a nucleic acid primer, a template oligonucleotide, a polymerase, and a nuclease, wherein: The capture reagent is immobilized on a surface; The capture reagent and the detection reagent bind to the analyte; The nucleic acid primer hybridizes to the template oligonucleotide; The polymerase is capable of extending the nucleic acid primer; and The nuclease is capable of cleaving the template oligonucleotide.
185. The composition of claim 184, wherein the composition is at about 20°C to about 27°C.
186. The composition of claim 184 or claim 185, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.
187. The composition of any one of claims 170 to 186, wherein the extended oligonucleotide is about 500 to about 50,000 bases in length.
188. The composition of claim 187, wherein the extended oligonucleotide is about 9,000 to about 40,000 bases in length.
189. The composition of claim 187 or 188, wherein the extended oligonucleotide is about 3,000 to about 13,000 bases in length.
190. The composition of any one of claims 187 to 189, wherein the extended oligonucleotide is about 1,000 to about 4,500 bases in length.
191. A composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide, and an anchoring reagent comprising an anchoring oligonucleotide, wherein: The capture reagent and the anchoring reagent are immobilized on a surface; The capture reagent and the detection reagent bind to the analyte; The anchor oligonucleotide comprises a modified nucleic acid selected from the group consisting of PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof, optionally wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof; and The extended oligonucleotide comprises an anchor complement bound to the anchor oligonucleotide.
192. A composition comprising: a capture reagent, an analyte, a detection reagent comprising an extended oligonucleotide, and a labeled probe comprising a detection oligonucleotide, wherein: The capture reagent and the detection reagent bind to the analyte; The detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof, wherein the modified nucleic acid is selected from PNA, LNA, BNA, a nucleoside comprising a 2' modification, or a combination thereof, optionally wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof; and The extended oligonucleotide binds to the detection oligonucleotide.
193. An oligonucleotide comprising or consisting of SEQ ID NO:
11.
194. An oligonucleotide comprising or consisting of SEQ ID NO:
17.
195. An oligonucleotide comprising or consisting of any one of SEQ ID NOs: 7-10.
196. An oligonucleotide comprising or consisting of any one of SEQ ID NOs: 12-15.
197. The composition of any one of claims 170 to 190, wherein the template oligonucleotide is a circular oligonucleotide.
198. The composition of any one of claims 170 to 183, wherein the extension of the nucleic acid primer is performed by rolling circle amplification (RCA).
199. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) contacting the extended oligonucleotide with a single-stranded oligonucleotide (SSO) stabilizer; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.
200. The method of claim 199, wherein the SSO stabilizer comprises a single-stranded DNA binding protein.
201. The method of claim 200, wherein the single-stranded DNA binding protein is an ultrathermostable single-stranded DNA binding protein (ET SSB).
202. The method of any one of claims 199 to 201, wherein the second complex is bound to a surface.
203. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a capture reagent that binds to the analyte, wherein the capture reagent is linked to an anchor reagent comprising an anchor oligonucleotide to form a capture-anchor reagent, wherein the capture-anchor reagent is immobilized or capable of being immobilized to a surface; and (iii) a detection reagent for the analyte, wherein the detection reagent comprises a nucleic acid primer, (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises an anchor complement capable of binding to the anchor oligonucleotide; (c) binding the extended oligonucleotide to the anchoring agent; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.
204. The method of claim 203, wherein the anchoring agent is linked to the capture agent via a cross-linking agent.
205. The method of claim 203 or 204, wherein the anchor oligonucleotide is further linked to biotin and the surface comprises streptavidin.
206. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising: (i) the analyte; (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid probe; (iii) a second detection reagent that binds to the analyte and comprises a second nucleic acid probe; as well as (iv) a bridging oligonucleotide, wherein a first portion of the bridging oligonucleotide is capable of binding to the first nucleic acid probe and a second portion of the bridging oligonucleotide is capable of binding to the second nucleic acid probe, and wherein the bridging oligonucleotide further comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; as well as (c) detecting the extended oligonucleotide, thereby detecting the analyte.
207. The method of claim 206, wherein the second complex is bound to a surface.
208. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises a binding sequence capable of binding to an anchoring agent, wherein the anchoring agent is immobilized on a surface, or wherein the first complex further comprises a capture agent that binds to the analyte, wherein the capture agent is immobilized or capable of being immobilized on the surface, and wherein the anchoring agent is linked to the capture agent, and wherein the binding sequence is capable of forming an aptamer or a tertiary oligonucleotide structure, and the anchoring agent comprises a protein, an antibody, a hapten, or an affinity tag capable of binding to the aptamer or the tertiary oligonucleotide structure; (c) binding the binding sequence to the anchoring agent; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.
209. The method of claim 208, wherein the binding sequence forms a G-quadruplex and the anchoring agent comprises a DNA binding protein capable of binding to the G-quadruplex.
210. The method of claim 209, wherein the binding sequence forming the G-quadruplex comprises the formula d(G 3+ N 1-7 G 3+ N 1-7 G 3+ N 1-7 G 3+ (SEQ ID NO:45)), wherein G is guanine, and N is any nucleotide.
211. The method of claim 210, wherein the binding sequence forms an aptamer and the anchoring agent comprises an antibody, a hapten, or an affinity tag capable of binding to the aptamer.
212. The method of claim 211, wherein the binding sequence forming the aptamer comprises TCGATTTCCTTAGTTGTCTTCCTTAGTGAG (SEQ ID NO: 39), and the anchoring agent comprises an anti-FLAG M2 antibody.
213. The method of claim 211, wherein the binding sequence forming the aptamer comprises GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC (SEQ ID NO: 40), and the anchoring agent comprises a 6X-histidine tag (SEQ ID NO: 44).
214. The method of claim 211, wherein the binding sequence forming the aptamer comprises CCGGCCAAGGGTGGGAGGGAGGGGGCCGG (SEQ ID NO: 41), and the anchoring agent comprises sulforhodamine B.
215. The method of claim 211, wherein the binding sequence forming the aptamer comprises AGCGAGGGCGGTGTCCAACAGCGGTTTTTTCASCGAGGAGGTTGGCG GTGG (SEQ ID NO: 42), and the anchoring reagent comprises digoxin.
216. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises a binding sequence capable of binding to an anchoring agent, wherein the anchoring agent is immobilized on a surface, or wherein the first complex further comprises a capture agent that binds to the analyte, wherein the capture agent is immobilized or capable of being immobilized on the surface, and wherein the anchoring agent is linked to the capture agent, and wherein the binding sequence comprises a binding moiety, and the anchoring agent comprises a protein or antibody capable of binding to the binding moiety; (c) binding the binding sequence to the anchoring agent; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.
217. The method of claim 216, wherein the binding moiety is linked to the nucleotides of the binding sequence.
218. The method of claim 216 or 217, wherein the extending comprises incorporating one or more nucleotides attached to the binding moiety into the extended oligonucleotide.
219. The method of any one of claims 216 to 218, wherein the binding sequence comprises at least two binding moieties, and wherein the anchoring agent is capable of multivalently binding to the at least two binding moieties.
220. The method of any one of claims 216 to 219, wherein the binding moiety comprises a hapten, biotin, or dinitrophenol (DNP).
221. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex, the first complex comprising: (i) the analyte; (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid primer; as well as (iii) a second detection reagent that binds to the analyte and comprises a second nucleic acid primer, wherein the template oligonucleotide comprises a first region capable of hybridizing to the first nucleic acid primer and a second region capable of hybridizing to the second nucleic acid primer; (b) hybridizing the first nucleic acid primer and the second nucleic acid primer to the template oligonucleotide to form a second complex; (c) extending the first nucleic acid primer to form a first extended oligonucleotide, and extending the second nucleic acid primer to form a second extended oligonucleotide; as well as (d) detecting the first extended oligonucleotide and the second extended oligonucleotide, thereby detecting the analyte.
222. The method of claim 221, wherein the second complex is bound to a surface.
223. The method of claim 221 or 222, wherein the template oligonucleotide comprises one or more linker oligonucleotides that can be ligated to form a circular template, wherein the first region is located on a first linker oligonucleotide and the second region is located on a second linker oligonucleotide.
224. The method of claim 223, wherein the extension comprises rolling circle amplification.
225. A method for detecting an analyte, the method comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid primer; and (iii) a second detection reagent that binds to the analyte and comprises a second nucleic acid primer, wherein the analyte is present on the surface; (b) hybridizing the first nucleic acid primer and the second nucleic acid primer to the template oligonucleotide to form a second complex, and extending the first nucleic acid primer and / or the second nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; as well as (c) detecting the extended oligonucleotide, thereby detecting the analyte.
226. The method of claim 225, wherein the template oligonucleotide comprises one or more linker oligonucleotides that can be ligated to form a circular template, wherein the first region is located on a first linker oligonucleotide and the second region is located on a second linker oligonucleotide.
227. The method of claim 226, wherein the extension comprises rolling circle amplification.
228. The method of any one of claims 225 to 227, wherein the surface comprises a protein blot membrane.
229. The method of claim 228, wherein the membrane comprises nitrocellulose or polyvinylidene fluoride (PVDF) membrane.
230. A method according to any one of claims 225 to 229, wherein the surface further comprises an anchoring agent capable of binding to the extended oligonucleotide, and wherein the method comprises binding the extended oligonucleotide to the anchoring agent prior to the detection of (c).
231. The method of claim 230, wherein the method further comprises fixing the anchoring agent to the surface prior to the contacting of (a).
232. The method of any one of claims 225 to 231, wherein the method further comprises transferring the analyte from a protein gel to the surface prior to the contacting of (a).
233. A method for detecting an analyte, the method comprising: (e) contacting the template oligonucleotide with a first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (f) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide is capable of having enzymatic activity; and (g) detecting the enzymatic activity, thereby detecting the analyte.
234. The method of claim 233, wherein the extended oligonucleotide comprises an aptamer, wherein the aptamer comprises enzymatic activity in the presence of an activator compound.
235. The method of claim 234, wherein the enzymatic activity is peroxidase activity and the activator compound is heme.
236. The method of any one of claims 233 to 235, wherein the second complex is bound to a surface.
237. The method of any one of claims 199 to 220 or any one of claims 225 to 232, wherein the detecting comprises: allowing the extended oligonucleotide to bind to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; as well as The detectable label is detected.
238. The method of any one of claims 221 to 224, wherein the detecting comprises: allowing the first extended oligonucleotide and / or the second extended oligonucleotide to bind to one or more labeled probes, wherein each labeled probe comprises (1) a detection oligonucleotide capable of binding to the first extended oligonucleotide and / or the second extended oligonucleotide; and (2) a detectable label; as well as The detectable label is detected.
239. The method of any one of claims 237 to 238, wherein the second complex is bound to a surface, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) One or both of (i) and (ii), further wherein the surface comprises an anchoring agent; (v) the surface comprises an anchoring agent comprising an anchoring oligonucleotide, wherein the anchoring oligonucleotide comprises a modified nucleic acid; or (vi) Any combination of (i), (ii) and (v).
Citation Information
Patent Citations
Assay cartridges and method of using the same
US10184884B2
Methods for conducting multiplexed assays
US10189023B2
Methods for conducting multiplexed assays
US10201812B2
Assay cartridge valve system
US10272436B2
Assay apparatuses, methods and reagants
US10281678B2