Glycosidase-producing saccharomycetes and application thereof in blueberry fruit wine
By screening and applying the Portuguese yeast SAU-XA strain and utilizing its endogenous glycosidase to ferment blueberry wine, the problem of low aroma substance release efficiency in the existing technology was solved, and the aroma quality and regional flavor of the wine were improved.
Patent Information
- Application Number
- CN202510751593.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to efficiently release bound aroma substances in winemaking, which affects the aroma quality, and exogenous glycosidases may change the regional flavor characteristics of blueberry wine.
The Portuguese yeast SAU-XA strain with strong glycosidase production ability was screened and applied, and mixed with Saccharomyces cerevisiae to ferment blueberry wine. The endogenous glycosidase of the strain was used to naturally release aroma substances during the fermentation process.
It improves the aroma complexity and sensory quality of blueberry wine, retains the typical flavor of blueberry, and enhances the regional characteristics of the wine.
Smart Images

Figure CN120682953A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microbial technology, and specifically relates to the screening of a glycosidase-producing strain of Corynespora portugalensis, the fermentation characteristics of the strain, and the application research of the strain in the fermentation of blueberry wine. Background Art
[0002] During the winemaking process, aroma compounds synthesized by the fruit itself, such as terpenes, methoxypyrazines, C13-norisoprenoids, and volatile thiols, primarily exist in free or glycosidically bonded forms. The bound precursors are significantly more abundant than their free forms, but their aroma potential cannot be directly released. They require acid hydrolysis or glycosidase catalysis during the fermentation stage to be converted into perceptible volatile aroma compounds. However, acid hydrolysis is inefficient and may cause structural rearrangements of some aglycones, affecting aroma quality. In contrast, enzymatic hydrolysis (particularly glycosidase catalysis) efficiently and specifically releases aglycones, preserving the structural stability of the original aroma components to the greatest extent possible. Compared to traditional methods of adding exogenous enzymes or using glycosidases, glycosidase-producing yeasts can naturally produce enzymes during the fermentation process, saving costs. The endogenous enzymes they produce are more adaptable to the fermentation environment and more effective at the pH and temperature of fermentation. Therefore, glycosidase-producing yeast has unique advantages in fruit wine brewing. It can directly release glycosidase through its own metabolism, so that aroma substances are gradually released as alcohol is produced, forming a more coordinated and layered flavor, thereby enhancing the aroma complexity and sensory quality of fruit wine.
[0003] Blueberry wine mash is rich in glycosides, which are precursor compounds of volatile aromas and need to be hydrolyzed by glycosidases to release perceptible aromatic components. However, the glycosidases currently used in industry are mainly derived from Aspergillus or bacteria. Although they can enhance the aroma richness of the wine, they may affect the regional flavor characteristics of blueberry wine due to insufficient enzymatic specificity. In contrast, screening glycosidase-producing yeasts from fresh blueberries themselves and applying them to the fermentation process can not only efficiently release bound aroma substances, but also better retain the typical flavor of blueberries, thereby improving the sensory quality and regional characteristics of the product. The Portuguese Corynespora yeast SAU-XA provided by the present invention has good monoglycosidase and disaccharide sidase production capabilities, and the use of this yeast and brewer's yeast to ferment blueberry wine can improve the overall aroma substance content and types of blueberry wine. Summary of the Invention
[0004] The present invention aims to screen and provide a Portuguese corynespora yeast SAU-XA with the ability to produce glycosidase, and use the yeast to ferment blueberry wine, thereby providing a microbial resource for enhancing the flavor of the wine during the brewing process.
[0005] The strain provided by the present invention is the Portuguese yeast SAU-XA, which is deposited in the General Microbiology Center (CGMCC) of the China Culture Collection Administration, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC No. 34302 and a deposit date of April 22, 2025.
[0006] The aforementioned Corynespora portuguesa SAU-XA was isolated from fresh blueberries and, after purification, primary screening, and secondary screening, identified as having good glycosidase production capacity. Its storage conditions are as follows: a single colony was picked from a well-growing plate and transferred to YPD medium. Cultured at 30°C for 48 hours, 600 μL of the culture was transferred to a storage tube containing 600 μL of 60% glycerol and stored in a -20°C freezer.
[0007] The YPD medium formula is 1 g yeast extract, 2 g peptone, 2 g glucose, 100 mL distilled water, natural pH, and if a solid medium is required, 2% agar is added.
[0008] The aesculin culture medium formula is: 0.3 g aesculin, 0.05 g ferric citrate, 0.2 g sodium chloride, 0.05 g magnesium sulfate heptahydrate, 0.1 g potassium dihydrogen phosphate, 100 mL distilled water, and natural pH.
[0009] The glycosidase fermentation medium formula is 2 g glucose, 2 g peptone, 1 g yeast extract, 0.3 g ammonium nitrate, 0.4 g potassium dihydrogen phosphate, 100 mL distilled water, natural pH, sterilized at 121°C for 20 min, and 0.1% p-nitrophenyl α-D-pyranoglucoside is added when the temperature drops to about 60-70°C.
[0010] The culture characteristics of the Portuguese yeast SAU-XA are as follows: Cultivated on YPD solid medium at 30°C for 48 hours, the colonies are round with regular edges, a smooth and moist surface, a creamy texture that is easy to pick up, opaque and shiny, with a raised center, and a milky white color. The Portuguese yeast SAU-XA requires facultative anaerobiosis and appears round under an oil immersion lens (100×10). It reproduces by unilateral budding. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 A is the morphology of a single SAU-XA colony, and B is the cell morphology of SAU-XA under a 100×10 microscope.
[0012] Figure 2 This is a graph showing the growth of SAU-XA strains under different SO2 concentrations.
[0013] Figure 3This is a graph showing the growth of SAU-XA strains at different pH levels.
[0014] Figure 4 This is a graph showing the growth of SAU-XA strains under different alcohol concentrations.
[0015] Figure 5 This is a graph showing the growth of SAU-XA strains at different sugar concentrations. DETAILED DESCRIPTION
[0016] Unless otherwise specified, the experimental methods described in the following examples are all conventional methods; the reagents and biological materials described are all commercially available unless otherwise specified.
[0017] In the following examples, the percentages are by mass unless otherwise specified.
[0018] The following examples further illustrate the specific implementation of the present invention, but are not limited to these examples.
[0019] Case Study 1: Screening and Identification of Glycosidase-Producing Yeast
[0020] (1) Yeast enrichment, separation and purification: 15 g of fruit was weighed in a clean bench, crushed and placed in a 250 mL conical flask containing 100 mL of sterilized YPD medium, cultured at 30 °C for 24 h, and then diluted and plated. The dilution gradient was 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Spread 100 μL of the dilution onto a WL solid plate, with triplicate dilutions for each dilution gradient. Culture the plate in a 30°C incubator for 2-3 days. Once colonies have grown on the WL solid medium, select individual colonies with distinct colors and typical yeast characteristics. Purify the colonies by streaking three to five times onto YPD plates. Once confirmed as pure strains by microscopy, inoculate onto YPD slants and store in a refrigerator at 4°C until further use. Streak the purified strain onto WL solid medium and culture in a 30°C incubator for 2-4 days. Identify the colonies by morphology, color, and microscopic observation. Exclude any duplicated colonies, and proceed to the next step of screening.
[0021] (2) Initial screening of glycosidase-producing yeasts: Add 200 μL of sterilized esculin culture medium to a sterile 96-well culture plate, add 20 μL of the activated test bacterial solution, and culture at 30°C for 48 h. The glycosidase activity of the test strains was determined according to the color development level. Dark black was marked as "++++" for the highest enzyme activity, black was marked as "+++" for medium enzyme activity, and dark gray was marked as "++" for low enzyme activity. The dark-colored strains were selected for the next step of the test. Among them, the SAU-XA color development result was dark black and was marked as "++++".
[0022] (3) Determination of yeast glycosidase activity: The yeast obtained in the initial screening was inoculated into glycosidase fermentation medium and cultured at 30°C for 3 days. The enzyme activity was determined by colorimetry. Among them, SAU-XA had the highest enzyme activity, with β-glucosidase activity of 0.334 U / mL, β-xylosidase activity of 0.115 U / mL, α-rhamnosidase activity of 0.169 U / mL, and α-arabinosidase activity of 0.123 U / mL.
[0023] (4) Identification of strain SAU-XA
[0024] Morphological identification: After activating the culture in YPD liquid medium for 24 hours, a loopful of bacterial liquid was streaked onto a YPD plate using a sterile inoculation loop. After incubation at 30°C for 48 hours, the characteristics of the colonies were recorded based on size, color, texture, and edge shape. The colonies were washed with sterile saline and the single cell morphology was observed under a microscope at 100x magnification. Figure 1 shown.
[0025] Molecular Identification: To extract the SAU-XA genome, strain SAU-XA was inoculated into YPD liquid medium and cultured on a shaker at 30°C, 200 rpm for 48 hours. The SAU-XA genome was extracted according to the genome sequencing kit instructions. 5 μL of PCR product was separated by electrophoresis on a 1.2% (1× TAE) agarose gel and imaged using a UV gel imaging system. The PCR amplification product was then sent to Sangon Biotech Co., Ltd. for sequencing.
[0026] The strain SAU-XA was sequenced and the following ITS sequence was obtained: TTCCGTAGGTGAACCTGCGGAAGGATCATTAAAATAATACTTACACTTTGCATTTGCGAACAAAAAAAAGAACATTACACTTCTAATATATTTTTATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAA TCTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCTCTAACCCCCGGTTAGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCGGAGGAA
[0027] The sequences were imported into NCBI for BLAST homology comparison. Combined with the morphological characteristics, the strain SAU-XA was identified as Corynespora portuguesa ( Clavispora lusitaniae ). It was deposited in the General Microbiology Center of China Culture Collection of Microorganisms (CGMCC), address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 34302 and the deposit date on April 22, 2025.
[0028] Case study 2: Fermentation performance determination of strain SAU-XA
[0029] (1) SO2 tolerance test: The activated SAU-XA strain seed liquid was inoculated at a 2% inoculum (v / v) into YPD liquid medium at SO2 concentrations of 50, 100, 150, 200, 250, and 300 mg / L, and the OD was measured after culturing at 30°C for 24 h. 600nm , draw the SO2 growth tolerance curve of yeast. Figure 2 As shown, the strain OD under the condition without adding SO2 600 >3.0, the growth is the largest; when the SO2 concentration is 50 mg / L, OD 600 <2.0, the yeast growth rate dropped sharply, and as the SO2 concentration increased, the OD value decreased, indicating that the strain was sensitive to SO2 and had poor tolerance.
[0030] (2) pH tolerance test: The activated SAU-XA strain seed liquid was inoculated at a 2% inoculum (v / v) into YPD liquid culture medium with pH values of 2.5, 3.0, 3.5, 4.0, 4.5, and 5.0, respectively. The OD values were measured after culturing at 30°C for 24 h. 600nm , draw the pH growth tolerance curve of yeast. Figure 3 As shown, when pH decreases, OD 600 The yeast growth decreased, indicating that the strain was sensitive to the acid environment.
[0031] (3) Alcohol tolerance test: The activated SAU-XA strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with alcohol content (v / v) of 0%, 2%, 4%, 6%, 8%, 10%, and 12%, respectively. The OD values were measured after culturing at 30°C for 24 h. 600nm , draw the alcohol tolerance curve of yeast. Figure 4 As shown in the figure, as the alcohol concentration increases, OD 600 The strain's growth rate decreased, and when the alcohol content reached 8%, the strain hardly grew, indicating that the strain's maximum alcohol tolerance range was 6-8%.
[0032] (4) Sugar tolerance test: The activated SAU-XA strain seed liquid was inoculated with 2% inoculum (v / v) into YPD liquid medium with glucose content of 50, 100, 150, 200, 250, and 300 g / L, respectively. The OD values were measured after culturing at 30 °C for 24 h. 600nm , draw the sugar tolerance curve of yeast. Figure 5 As shown in the figure, as the sugar concentration increases, the yeast growth decreases, indicating that high sugar content will inhibit the growth of the strain.
[0033] Case Study 3: Volatile Compound Analysis and Sensory Analysis of Blueberry Wine Fermented with Strain SAU-XA
[0034] Fully ripe blueberries without rot or deterioration were selected for inoculation. The soluble solids content of the fermentation broth was adjusted to 22% with white sugar. Potassium metabisulfite was added at a concentration of 60 mg / kg. The group inoculated with Saccharomyces cerevisiae served as the control group, and the groups inoculated with Saccharomyces cerevisiae and SAU-XA strains served as the experimental groups. The broth was fermented at 25 ℃. When the sugar content was lower than 4 g / L, the fermentation was stopped and the volatile substances were measured. The broth was then aged in a refrigerator for 30 days before sensory evaluation.
[0035] (1) Volatile matter determination method:
[0036] Headspace solid phase microextraction (SPME) conditions were as follows: 4 mL of sample, 1.0 g of sodium chloride, and 10 μL of 2-octanol (0.4 mg / mL) were added to the headspace vial, equilibrated at 45°C for 20 min, and subjected to headspace adsorption for 30 min.
[0037] Gas chromatography conditions: Agilent VF-Waxms column (60 m×0.25 mm, 0.5 μm), helium (He) flow rate 1 mL / min; heating program: splitless injection; initial temperature 40℃, hold for 3 min, increase the temperature to 60℃ at 2℃ / min, hold for 1 min, then increase the temperature to 120℃ at 4℃ / min, hold for 1 min, then increase the temperature to 240℃ at 6℃ / min, hold for 3 min; injection port temperature 260℃, detector temperature 260℃.
[0038] Mass spectrometry conditions were as follows: electron ionization (EI) source, interface temperature 250°C, ion source temperature 200°C, electron energy 70 eV, and mass spectrometry scan range 40.00–800.00 m / z.
[0039] Volatile compound analysis results: As shown in Table 1, a total of 34 aroma compounds were detected in the two blueberry wines, including 17 esters, 10 alcohols, 2 acids, 4 terpenes, and 1 phenol. Among the ester compounds, the control group had a 1435.47 μg / L ester content, while the experimental group had a 1568.59 μg / L ester content. Ethyl octanoate, ethyl caprylate, ethyl hexanoate, and ethyl acetate were found at higher levels, imparting a rich fruity and floral aroma to the wines. The experimental group also had unique esters, such as ethyl butyrate and 3-phenylpropyl isobutyrate, which contribute to sweet and fruity notes. Among the alcohol compounds, the experimental group had significantly higher levels than the control group, with higher levels of isopentanol and phenylethyl alcohol, contributing to violet and rose notes. Trace acids, which can modify the wine's aroma, were detected in both groups, but the specific acids were different: octanoic acid in the experimental group and phenylsuccinic acid in the control group. Terpenes can impart aromas such as berry, nutty, and floral. Four terpenes were detected in the experiment: styrene, linalool, alpha-terpineol, and beta-citronellol. The total terpene content in the experimental group was 156.25 μg / L, significantly higher than that in the control group. 2,4-Di-tert-butylphenol contributes a phenolic or woody aroma, rather than a typical fruity or floral aroma. 2,4-Di-tert-butylphenol was detected in both groups, and the content was similar. In summary, blueberry wine fermented with SAU-XA yeast had higher levels of esters, alcohols, and terpenes, and this affected the types of acidic substances.
[0040] Table 1 Relative content of volatile substances
[0041] (2) Sensory evaluation
[0042] Quantitative descriptive analysis was used to evaluate the aroma components of blueberry wine. Twenty trained sensory tasters, aged between 20 and 30 years, specialized in winemaking engineering, conducted sensory evaluations of the blueberry wines using a predefined protocol and descriptive terminology. Each sample was randomly assigned to a different area. Each sensory taster tasted the same sample twice and assigned scores based on the descriptions in the evaluation form, evaluating the blueberry wines' color, aroma, flavor, and typicality. The evaluations were conducted in a well-lit, quiet, and free-from room at a temperature of approximately 20°C to minimize external interference. Data were then recorded and consolidated to determine the sensory scores for each group. The sensory scores are shown in Table 2.
[0043] Table 2 Sensory scoring table for blueberry wine
Claims
1. A strain of Portuguese yeast ( Clavispora lusitaniae ) SAU-XA, deposited at the General Microbiology Center of the China General Microbiology Culture Collection (CGMCC), No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 34302 and the deposit date April 22, 2025. Portuguese coryneformis SAU-XA is characterized by a round colony shape with regular edges, a smooth and moist, creamy surface that is easy to pick up, an opaque, shiny, milky white color, and a central bulge. The inoculant is characterized by containing Portuguese coryneformis SAU-XA or being prepared from Portuguese coryneformis SAU-XA.
2. The bacterial agent is a freeze-dried bacterial agent; the preparation method of the freeze-dried bacterial agent comprises: The Portuguese yeast SAU-XA according to claim 1 is cultured to obtain bacterial cells, and the bacterial cells are freeze-dried.
3. A method for brewing blueberry wine, comprising inoculating and fermenting blueberry pulp using the Portuguese yeast SAU-XA as claimed in claim 1 to obtain a blueberry wine with a rich aroma and a harmonious taste.