Pediococcus acidilactici and application thereof

Abstract

The invention discloses pediococcus acidilactici and application thereof, and belongs to the technical field of food microorganisms. The pediococcus acidilactici CCTCC NO: M 20242011 disclosed by the invention not only has excellent acid resistance and ethanol resistance, but also has good high temperature resistance; in addition, the pediococcus acidilactici CCTCC NO: M 20242011 can also produce various flavor substances at high yield in the fermentation process of the sorghum juice culture medium. When the strain or the microbial inoculum thereof is applied to a white spirit brewing production process, the quality and flavor of white spirit can be remarkably improved. The strain disclosed by the invention is good in practical application effect and has a good application prospect in Baijiu brewing production.

Description

Technical Field

[0001] The invention relates to a Pediococcus acidilactici strain and application thereof, belonging to the technical field of food microorganisms. Background Art

[0002] The brewing process of baijiu (white liquor) is a long and complex one. Microorganisms play a crucial role in the fermentation process, not only influencing the fermentation efficiency but also directly determining the flavor and quality of the liquor. However, the extreme fermentation environment of baijiu, including high acidity, high ethanol concentration, and high temperature, poses a severe challenge to the microorganisms involved in fermentation. While the microbial strains commonly used in traditional baijiu fermentation can adapt to the fermentation environment to a certain extent, they often suffer from insufficient tolerance and limited ability to produce flavor. Especially under extreme fermentation conditions, the growth and metabolism of these strains are easily inhibited, resulting in low fermentation efficiency and poor flavor of the liquor.

[0003] CN105925499A discloses a strain of Pediococcus acidilactici JQQ2, which retains an antibacterial activity of up to 81.09% after being treated at 121° C. for 30 minutes. At the same time, this strain has a good tolerance to extreme pH. At pH = 2, the antibacterial activity retention rate is as high as 81.3%, and at pH = 10, the antibacterial activity is only lost by 39.86%. However, the ability of this strain to produce flavor compounds is not mentioned. CN110343635A discloses a strain of Pediococcus acidilactici Pi Niang R036 screened from fermented sauce. It can grow well at 4-50°C, and high temperature is more conducive to its growth. The growth rate is fastest at 37-45°C. It can tolerate salt with a salinity of 12% and can grow normally under conditions with a salt concentration of 0%-8%. It can grow under acidic conditions of pH 3.5-6. It is prepared into a special bacterial agent for high-salt brewing and applied to the brewing process of traditional fermented foods. It can significantly improve the quality of traditional fermented foods. However, since the brewing environment of white wine is different from the high-salt stress environment of fermented sauce, whether this strain can adapt to the brewing environment of white wine remains to be discussed. CN116536185A discloses a strain screened The lactic acid bacteria WT1 in the fermented soy sauce can grow well at higher temperatures and a certain salinity, and can also produce a variety of volatile flavor substances, which is of great significance for improving the quality and flavor of low-salt solid soy sauce. However, the soy sauce brewing environment is different from the liquor brewing environment, and the adaptability of the strain is unknown; CN116904364A discloses a 2-acetylpyrrole-producing lactic acid bacteria isolated from koji, which can adapt to the high-temperature fermentation environment in the preparation of medium- and high-temperature koji and the fermentation process of sauce liquor and can function therein, but does not mention the ability of this strain to produce a variety of flavor compounds; CN114540231B discloses a lactic acid bacteria obtained from the fermented soy sauce mash of liquor, which has the properties of acid resistance, ethanol resistance, high temperature resistance and salt resistance, and can grow in an environment with a pH value as low as 2.1, or an ethanol concentration as high as 12% (v / v), or a temperature as high as 50°C, or a salinity as high as 130 g / L, and can adapt to the fermentation environment of different foods. This strain has a good ability to produce alcohol, acid and ester flavor substances, and the total flavor substance production can reach 1.19 mg / kg, but the types of flavor substances it produces are limited.

[0004] It is well known that screening microorganisms in natural environments is uncertain. This means it is difficult to find identical microbial strains within the same screening target, resulting in irreproducibility. Furthermore, screening for multifunctional strains is even rarer in practice. Therefore, obtaining a strain that can grow stably and metabolize efficiently in extreme environments, while also producing a variety of flavor precursors and aroma components, will not only ensure a smooth fermentation process but also significantly enrich the taste and aroma of baijiu, satisfying consumers' diverse demands for high-quality liquor. The screening and application of this strain will bring new technological breakthroughs and quality improvements to the baijiu brewing and food fermentation industries. Summary of the Invention

[0005] To address the above technical issues, the present invention has isolated a multifunctional strain, Pediococcus acidilactici, from the baijiu brewing system. This strain not only exhibits excellent acid and ethanol resistance, but also good high-temperature tolerance. Furthermore, this strain can produce a variety of flavor compounds during fermentation in sorghum juice medium. This strain, formulated into a microbial inoculant and applied to the baijiu brewing process, significantly improves the quality and flavor of the liquor. The strain has demonstrated excellent practical application and holds great promise for future applications in baijiu brewing.

[0006] The first object of the present invention is to provide a strain of Pediococcus acidilactici W2024090801, which has been deposited in the China Center for Type Culture Collection on September 20, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCC NO: M 20242011.

[0007] The Pediococcus acidilactici CCTCC NO: M 20242011 has the following characteristics:

[0008] (1) Growth characteristics: The strain reached the stable phase after 12 hours of growth in sorghum juice medium; the optimal growth temperature in sorghum juice medium was 37°C; the strain had the best activity in sorghum juice medium with a pH of 5.55;

[0009] (2) Ethanol resistance: After culturing in sorghum juice medium with 12% (v / v) ethanol for 36 h, the strain was still able to grow, and its activity was 50.5% of that in the absence of ethanol;

[0010] (3) High temperature resistance: The optimal growth temperature in sorghum juice medium is 37°C; it can withstand high temperatures of 50°C. After growing in sorghum juice medium at 50°C for 36 hours, it can still grow well, and its vitality is 77.2% of that at 37°C.

[0011] (4) Acid resistance: The optimal growth pH is 5. After 36 h of growth at an extremely acidic pH of 3, the strain still maintains good activity, which is 34.8% of that at pH 5. After 36 h of growth at a pH of 2, the activity is only 27.3% of that at pH 5.

[0012] (5) Flavor production ability: During the fermentation process of sorghum juice culture medium, Pediococcus acidilactici can produce a variety of flavor substances: including alcohols such as cis-3-nonen-1-ol, 2-ethylhexanol, 4-methyl-2-pentanol, 3-methyl-1-butanol, 2-hexadecanol, heptanediol, isopropyl alcohol, and 1-decanol; esters such as ethyl butyrate, ethyl heptanoate, ethyl hexanoate, ethyl tetradecanoate, ethyl hexadecanoate, octyl formate, ethyl nonanoate, and ethyl 8-nonenoate; acids such as heptanoic acid, nonanoic acid, octanoic acid, hexanoic acid, dodecanoic acid, n-decanoic acid, 3-methylbutanoic acid, tetradecanoic acid, 2-ethylhexanoic acid, and ethyl 1-decanoate. , 4-dimethylpentanoic acid, tridecanoic acid, acetic acid, benzoic acid, 2,4-dimethyl-2-pentenoic acid, phenylacetic acid, 7-octenoic acid, aldehydes such as heptanal, decanal, dodecanal, octanal, nonanal, 2,5-dimethylbenzaldehyde, 3,4-dimethylbenzaldehyde, 2-undecenal, hexanal, ketones such as 5-hepten-2-one 6-methyl, 1-(1H-pyrrol-2-yl)ethanone, acetone, furfural, 2,3-dihydrobenzofuran, 2-pentylfuran and phenols such as phenol, vanillin, 4-vinylphenol, 2-methoxy-4-vinylphenol.

[0013] (6) It comes from the liquor brewing system and can be used in liquor brewing to enhance the flavor of liquor.

[0014] The second object of the present invention is to provide a microbial agent containing the Pediococcus acidilactici CCTCCNO: M20242011 of the present invention.

[0015] In one embodiment of the present invention, the microbial agent uses Pediococcus acidilactici CCTCC NO: M20242011 as the main microorganism.

[0016] In one embodiment of the present invention, the viable count of Pediococcus acidilactici CCTCC NO: M20242011 in the microbial agent is 10 5 ~10 8 CFU / mL.

[0017] In one embodiment of the present invention, the bacterial concentration range of Pediococcus acidilactici CCTCC NO: M20242011 in the microbial agent is 10 5 ~10 8 CFU / mL.

[0018] In one embodiment of the present invention, the microbial agent is obtained by preparing a seed solution of Pediococcus acidilactici CCTCC NO: M20242011 and then expanding the culture.

[0019] In one embodiment of the present invention, the microbial agent is a liquid agent or a solid agent containing the Pediococcus acidilactici CCTCC NO: M20242011 strain.

[0020] In one embodiment of the present invention, the microbial agent comprises live cells of Pediococcus acidilactici CCTCC NO: M20242011, dry cells of Pediococcus acidilactici CCTCC NO: M 20242011 obtained by freeze-drying, immobilized cells of Pediococcus acidilactici CCTCC NO: M 20242011 of the present invention, or Pediococcus acidilactici CCTCC NO: M 20242011 of the present invention in any other form.

[0021] In one embodiment of the present invention, the microbial agent further contains any strain of any species that can be used in fermented foods or fermented food preparation, such as Saccharomyces cerevisiae, Bacillus subtilis, Bacillus licheniformis, and the like.

[0022] In one embodiment of the present invention, the microbial agent further contains any carrier that can be used for fermenting food.

[0023] The third object of the present invention is to provide the use of the Pediococcus acidilactici CCTCC NO: M 20242011 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 in flavor metabolism.

[0024] In one embodiment of the present invention, the flavor metabolism includes producing one or more of the following flavor substances: alcohols including cis-3-nonen-1-ol, 2-ethylhexanol, 4-methyl-2-pentanol, 3-methyl-1-butanol, 2-hexadecanol, heptanediol, isopropyl alcohol, 1-decanol; esters including ethyl butyrate, ethyl heptanoate, ethyl hexanoate, ethyl tetradecanoate, ethyl hexadecanoate, octyl formate, ethyl nonanoate, ethyl 8-nonenoate; acids including heptanoic acid, nonanoic acid, octanoic acid, hexanoic acid, dodecanoic acid, n-decanoic acid, 3-methylbutanoic acid, tetradecanoic acid, 2, 4-dimethylpentanoic acid, tridecanoic acid, acetic acid, benzoic acid, 2,4-dimethyl-2-pentenoic acid, phenylacetic acid, 7-octenoic acid; aldehydes such as heptanal, decanal, dodecanal, octanal, nonanal, 2,5-dimethylbenzaldehyde, 3,4-dimethylbenzaldehyde, 2-undecenal, hexanal; ketones such as 6-methyl-5-hepten-2-one, 1-(1H-pyrrol-2-yl)ethanone, acetone; furfural, 2,3-dihydrobenzofuran, 2-pentylfuran; and phenols such as phenol, vanillin, 4-vinylphenol, and 2-methoxy-4-vinylphenol.

[0025] The fourth object of the present invention is to provide the use of the Pediococcus acidilactici CCTCC NO: M 20242011 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 in liquor fermentation.

[0026] In one embodiment of the present invention, the liquor includes Luzhou-flavor liquor, Qing-flavor liquor, Maotai-flavor liquor, and fruit-flavor liquor.

[0027] In one embodiment of the present invention, the application is to inoculate the Pediococcus acidilactici CCTCC NO: M20242011 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 into the mash before liquor brewing to increase the content of volatile flavor substances in the mash.

[0028] A fifth object of the present invention is to provide use of the Pediococcus acidilactici CCTCC NO: M 20242011 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 in fermented foods.

[0029] In one embodiment of the present invention, the fermented food includes but is not limited to alcoholic beverages, soy products, fermented vegetables, fermented grain products, fermented meat products, condiments, and dairy products.

[0030] Beneficial effects

[0031] The present invention's Pediococcus acidilactici W2024090801 was screened from baijiu (white spirit). This strain not only exhibits excellent acid and ethanol resistance, but also high temperature tolerance. Furthermore, it can produce a variety of flavor compounds in high yields during fermentation in sorghum juice medium. Application of this strain or its inoculum inoculum in the baijiu (white spirit) brewing process can significantly improve the quality and flavor of the liquor, and has promising application prospects in baijiu brewing.

[0032] Biomaterial Deposit

[0033] Pediococcus acidilactici, taxonomic name: Pediococcus acidilactici W2024090801, was deposited in the China Center for Type Culture Collection on September 20, 2024, with the deposit address being Wuhan University, Wuhan, China, and the deposit number being CCTCCNO: M20242011. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a growth curve of Pediococcus acidilactici W2024090801 (n=3).

[0035] Figure 2 This is the result of the high temperature resistance of Pediococcus acidilactici W2024090801 (n=3).

[0036] Figure 3 This is the ethanol resistance result of Pediococcus acidilactici W2024090801 (n=3).

[0037] Figure 4 This is the acid resistance result of Pediococcus acidilactici W2024090801 (n=3).

[0038] Figure 5 This is a graph showing the production of volatile compounds from the fermentation of Pediococcus acidilactici W2024090801 in sorghum juice medium (n=3). DETAILED DESCRIPTION

[0039] (1) The culture medium involved in the following examples:

[0040] MRS broth medium (g / L): 10.0 g of peptone, 8.0 g of beef extract powder, 4.0 g of yeast extract powder, 20.0 g of glucose, 2.0 g of dipotassium hydrogen phosphate, 2.0 g of diammonium hydrogen citrate, 5.0 g of sodium acetate, 0.2 g of magnesium sulfate, 0.04 g of manganese sulfate, and 1.0 g of Tween 80. Dissolve in 1 L of water, adjust the pH to 5.7, and sterilize at 118°C for 18 min.

[0041] MRS solid medium: 10.0 g of peptone, 8.0 g of beef extract powder, 4.0 g of yeast extract powder, 20.0 g of glucose, 2.0 g of dipotassium hydrogen phosphate, 2.0 g of diammonium hydrogen citrate, 5.0 g of sodium acetate, 0.2 g of magnesium sulfate, 0.04 g of manganese sulfate, 1.0 g of Tween 80, and 20 g of agar, dissolved in 1 L of water, adjusted to pH 5.7, and sterilized at 118°C for 18 min.

[0042] Sorghum juice medium: Use japonica sorghum to prepare sorghum juice medium. The specific steps are as follows:

[0043] (1) Crush the raw sorghum into granules for about 10 seconds. After crushing, add water twice the amount of raw sorghum added and soak in a refrigerator at 4°C for 12 hours to obtain the raw sorghum soaking liquid.

[0044] (2) Add 30u / g of α-high-temperature amylase (purchased from Jiangsu Ruiyang Biotechnology Co., Ltd., enzyme activity: 40000U / g) to the raw sorghum soaking liquid obtained in step (1), place it in a high-temperature sterilizer at 105°C for 45min to obtain enzymatic hydrolyzate 1.

[0045] (3) Add the same amount of water as that in step (1) to the enzymatic hydrolysate 1 obtained in step (2), add 30u / g of α-high-temperature amylase, and cook on an induction cooker at 100°C until the sugar content reaches 8°Bx.

[0046] (4) When the temperature is cooled to 60°C, 259u / g of saccharifying enzyme (purchased from Jiangsu Ruiyang Biotechnology Co., Ltd., enzyme activity: 40000U / g) is added and placed in a 60°C oven for 4h to obtain enzymatic hydrolyzate 2.

[0047] (5) Filter the enzymatic hydrolysate 2 using absorbent cotton gauze to obtain the filtrate, which is then dispensed into centrifuge bottles, with each bottle being filled with 1 / 2 (250 mL).

[0048] (2) Strain growth curve determination method

[0049] (1) Pediococcus acidilactici W2024090801 was inoculated into MRS broth and cultured at 30°C for 28 h to obtain seed solution with a concentration of 9.68×10 8 CFU / mL.

[0050] (2) 5 mL of sorghum juice medium was inoculated with 5.17 μL of the seed solution obtained in step (1) to make the final bacterial concentration of the medium 1×10 6 CFU / mL. Place it at 30℃ and culture for 60h.

[0051] (3) Samples were collected every 6 h, and 200 μL was added to a 96-well plate. The absorbance at 600 nm was measured using a microplate reader to record the growth of the strain. Three replicates were set up for each strain at each time point.

[0052] (3) High temperature resistance test of strains

[0053] (1) Pediococcus acidilactici W2024090801 was inoculated into MRS broth and cultured at 30°C for 28 h to obtain seed solution with a concentration of 4.04×10 8 CFU / mL.

[0054] (2) 5 mL of sorghum juice medium was used to inoculate 1.24 × 10 -2 mL of the seed solution obtained in step (1) was added to make the final bacterial concentration of the culture medium 1×10 6 CFU / mL. Equal volumes of culture were placed at 25, 30, 37, 45, and 50°C for 36 h, with three replicates at each temperature.

[0055] (3) After incubation, 200 μL was taken into a 96-well plate and its absorbance at 600 nm was measured using an enzyme-labeled instrument.

[0056] (IV) Ethanol resistance test of strains

[0057] (1) Pediococcus acidilactici W2024090801 was inoculated into MRS broth and cultured at 30°C for 28 h to obtain seed solution with a concentration of 3.44×10 8 CFU / mL.

[0058] (2) Before inoculation, ethanol was added to the sorghum juice medium to adjust the ethanol concentrations of the sorghum juice medium to 3, 6, 9, and 12 (%, v / v), with three replicates set for each ethanol concentration.

[0059] (3) 1.45×10 -2 mL of the seed solution obtained in step (1) was added to make the final bacterial concentration of the culture medium 1×10 6 CFU / mL. Incubate at 30°C for 36 h, take 200 μL into a 96-well plate, and measure the absorbance at 600 nm using a microplate reader.

[0060] (V) Strain acid resistance test

[0061] (1) Pediococcus acidilactici W2024090801 was inoculated into MRS broth and cultured at 30°C for 28 h to obtain seed solution with a concentration of 8.90×10 8 CFU / mL.

[0062] (2) Use lactic acid or hydrochloric acid to adjust the pH of sorghum juice medium to 5.0, 4.0, 3.0, and 2.0, respectively, and set up three parallel groups for each pH.

[0063] (3) 5.62 μL of the seed solution from step (1) was added to 5 mL of sorghum juice culture medium with different pH values, so that the final bacterial concentration of the culture medium was 1×10 6 After 36 h of static culture at 30°C, 200 μL was transferred to a 96-well plate and the absorbance at 600 nm was measured using a microplate reader.

[0064] (VI) Determination of volatile compounds produced by bacterial fermentation

[0065] (1) Pediococcus acidilactici W2024090801 was inoculated into MRS broth and cultured at 30°C for 28 h to obtain seed solution with a concentration of 6.58×10 8 CFU / mL.

[0066] (2) 20 mL of sorghum juice medium was used to inoculate 3.04 × 10 -2 mL of seed solution from step (1) to make the final bacterial concentration of the culture medium 1×10 6 CFU / mL. Place it at 30℃ and culture for 36h, with three replicates.

[0067] (3) Determination of volatile compounds by GC-MS. The specific steps are as follows:

[0068] 5 mL of fermentation broth at the end of the fermentation was centrifuged and 5 mL of the supernatant was placed in a brown headspace vial. 1.5 g of NaCl and 10 μL of menthol (22 mg / L) as an internal standard were added. Headspace solid-phase microextraction coupled with gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to determine the types and levels of volatile compounds in the fermentation broth at the end of the fermentation.

[0069] GC conditions: inlet temperature 250°C, carrier gas high-purity He, flow rate 1 mL / min. Splitless injection mode. Chromatographic column: DB-FFAP (60 m × 0.25 mm id × 0.25 μm, Agilent, CA, USA) capillary column. Temperature program: start at 55°C, hold for 2 min, increase at 5°C / min to 230°C, hold for 15 min.

[0070] MS conditions: electron impact (EI) ion source, electron energy 70 eV, ion source temperature 230°C, mass scan range m / z 35-500 amu.

[0071] Example 1: Screening of strains

[0072] A strain of Pediococcus acidilactici that is resistant to high temperatures, acid, and ethanol and produces multiple flavor substances was screened from the liquor fermentation process. The screening process is as follows:

[0073] Weigh 2.0 g of liquor mash sample, add 40 mL of 0.9% sterile saline and 10 glass beads, and culture on a shaker at 30°C and 200 rpm for 1 h. After the culture is completed, take the supernatant of the sample and dilute it to 10 1 times, 10 2 times, 10 3 times, 10 4 times, 10 5 Times, take the last three dilution gradients, evenly spread them on the MRS solid culture medium plate used for primary screening, and place them in a constant temperature and humidity incubator at 30℃ for 24 hours. Observe the morphology of the colonies on the plate, select colonies that may be lactic acid bacteria, and use the three-zone streak method to spread them on the solid culture medium plate for rescreening, and place them in a constant temperature and humidity incubator at 30℃ for 24 hours. Select colonies with obvious lactic acid bacteria characteristics with obvious calcium dissolution rings around them, good growth, milky white and moist colony surfaces, and neat edges. Use the three-zone streak method to spread them on MRS solid culture medium, place them in a constant temperature and humidity incubator at 30℃ for 24 hours, and repeat the streak until a single bacterium is isolated. Pick a single colony into MRS broth culture medium, place it in a constant temperature and humidity incubator at 30℃ for 24 hours, use 50% glycerol for strain preservation, and name it W2024090801.

[0074] Example 2: Identification of bacterial species

[0075] A single colony of the strain was inoculated into MRS broth and cultured for 28 hours. Total DNA was then extracted and the 16S rDNA fragment of the strain was amplified using primers for bacterial classification and identification, followed by gel electrophoresis. The amplified product was sequenced and aligned, and identified as Pediococcus acidilactici. The 16S rDNA sequence is shown in SEQ ID NO. 1.

[0076] Pediococcus acidilactici W2024090801 was deposited in the China Center for Type Culture Collection on September 20, 2024. The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 20242011.

[0077] SEQ ID NO.1:

[0078] GGGGGGGGTGCTATACATGCAGTCGAACGAACTTCCGTTAATTGATTATGACGGTGCT

[0079] TGCACTGAATGAGATTTTAACACGAAGTGAGTGGCGGACGGGTGAGTAACACGTGGGT

[0080] AACCTGCCCAGAAGCAGGGGATAACACCTGGAAACAGATGCTAATACCGTATAACAG

[0081] AGAAAACCGCCTGGTTTTCTTTTAAAAGATGGCTCTGCTATCACTTCTGGATGGACCCG

[0082] CGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGATGCGTAGCCGAC

[0083] CTGAGAGGGTAATCGGCCACATTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGC

[0084] AGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTG

[0085] AAGAAGGGTTTCGGCTCGTAAAGCTCTGTTGTTAAAGAAGAACGTGGGTGAGAGTAAC

[0086] TGTTCACCCAGTGACGGTATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCC

[0087] GCGGTAATACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAG

[0088] GCGGTCTTTTAAGTCTAATGTGAAAGCCTTCGGCTCAACCGAAGAAGTGCATTGGAAA

[0089] CTGGGAGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATGTGTAGCGGTGAAATGC

[0090] GTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTGTCTGGTCTGTAACTGACGCT

[0091] GAGGCTCGAAAGCATGGGTAGCGAACAGGATTAGATACCCTGGTAGTCCATGCCGTAA

[0092] ACGATGATTACTAAGTGTTGGAGGGTTTCCGCCCTTCAGTGCTGCAGCTAACGCATTAA

[0093] GTAATCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAAGAATTGACGGGGGC

[0094] CCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCTACGCGAAGAACCTTACCAGG

[0095] TCTTGACATCTTCTGCCAACCTAGAGATTAGCGTTCCCTTCGGGGACAGAATGACAGTG

[0096] TGCATGGTGTCGTCAGCTCGTGTCGTGAGATGTGGGTAGTCCCGCACGAGCGCACCCT

[0097] ATACTAGTGCAGCATCAGTGGGCACTCTAGTGAGACTGCGTGACAACGGAGAGTGGGA

[0098] CGACGTCAATCATCATGCCCTTATGACCTGGGCTAACACACGGTGCT

[0099] Example 3: Growth of Pediococcus acidilactici W2024090801 in sorghum juice medium

[0100] The growth curve determination method is shown in the specific implementation method (II). Figure 1 It can be seen that when the lactic acid bacteria W2024090801 was inoculated into the sorghum juice medium for 12 hours, the strain entered the stable phase. 600 was 0.532, and the strain concentration reached the highest after 60 h of culture. 600 is 0.615 (Table 1).

[0101] Table 1 Growth curve OD of Pediococcus acidilactici W2024090801 600 Value (n=3)

[0102]

[0103]

[0104] Example 4: High temperature resistance of Pediococcus acidilactici W2024090801

[0105] See the specific implementation method (III) for the experimental method of strains' high temperature resistance. Figure 2 It can be seen that the optimal growth temperature of Pediococcus acidilactici W2024090801 is 37℃, at which time OD 600 It is 0.640, and it still grows well after being cultured at 50℃ for 36h. 600 was 0.494, indicating that Pediococcus acidilactici W2024090801 has the potential to be applied in high-temperature fermentation (Table 2).

[0106] Table 2 Growth of Pediococcus acidilactici W2024090801 at different temperatures (n=3)

[0107]

[0108] Example 5: Ethanol tolerance of Pediococcus acidilactici W2024090801

[0109] For the experimental method of strain ethanol resistance, see the specific implementation method (IV). Figure 3It can be seen that the lactic acid bacteria W2024090801 grows best without adding ethanol, and the OD 600 was 0.555. After culturing in sorghum juice medium with an ethanol concentration of 12% (v / v) for 36 h, the lactic acid bacteria W2024090801 still maintained its activity, and the OD 600 was 0.280, indicating that Pediococcus acidilactici W2024090801 had good tolerance to high concentration of ethanol (Table 3).

[0110] Table 3 Growth of Pediococcus acidilactici W2024090801 at different ethanol concentrations (n=3)

[0111]

[0112] Example 6: Acid resistance of Pediococcus acidilactici W2024090801

[0113] For the acid resistance test method of the strain, see the specific implementation method (V). Figure 4 It can be seen that the optimal growth pH of Pediococcus acidilactici W2024090801 is 5.00. Pediococcus acidilactici grows better under extreme acidic conditions. After culturing in sorghum juice medium with pH = 2.00 for 36 hours, OD 600 was 0.172. After culturing in sorghum juice medium with pH = 3 for 36 h, OD 600 was 0.219, indicating that Pediococcus acidilactici W2024090801 has the potential to be used in acidic food fermentation (Table 4).

[0114] Table 4 Growth of Pediococcus acidilactici W2024090801 at different pH values ​​(n=3)

[0115]

[0116] Example 7: Ability of Pediococcus acidilactici W2024090801 to produce volatile compounds in sorghum juice medium fermentation

[0117] The determination method of volatile compounds produced by fermentation of strains is shown in the specific implementation method (VI). Figure 5As shown, after culturing Pediococcus acidilactici W2024090801 in sorghum juice medium for 36 h, a total of 50 volatile compounds were detected, including 8 alcohols, 8 esters, 15 acids, 9 aldehydes, 3 ketones, 4 phenols, and 3 furans; the production of alcohols reached 540.76 mg / L, the production of esters reached 141.31 mg / L, the production of acids reached 248.94 mg / L, the production of aldehydes reached 63.54 mg / L, the production of ketones reached 108.01 mg / L, the production of phenols reached 14.22 mg / L, and the production of furans reached 163.82 mg / L (Table 5).

[0118] Table 5 Substances and contents of volatile compounds produced in the fermentation of Pediococcus acidilactici W2024090801 (n=3)

[0119]

[0120]

[0121]

[0122] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Pediococcus acidilactici, characterized in that: The lactic acid bacteria were deposited in the China Center for Type Culture Collection on September 20, 2024, with the deposit number being CCTCC NO: M 20242011.

2. A microbial agent, characterized in that: The bacterial agent contains the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1; preferably, the bacterial agent uses Pediococcus acidilactici CCTCC NO: M 20242011 as the main microorganism.

3. The microbial agent according to claim 2, characterized in that The number of viable bacteria of Pediococcus acidilactici CCTCC NO: M20242011 in the bacterial agent is 10 5 ~10 8 CFU / mL; the bacterial concentration range of Pediococcus acidilactici CCTCC NO:M 20242011 in the bacterial agent is 10 5 ~10 8 CFU / mL.

4. The microbial agent according to claim 2, characterized in that The bacterial agent is obtained by preparing a seed solution of Pediococcus acidilactici CCTCCNO:M 20242011 and then expanding the culture; Preferably, the bacterial agent is a liquid bacterial agent or a solid bacterial agent containing the strain Pediococcus acidilactici CCTCC NO: M 20242011; Preferably, the bacterial agent contains live cells of Pediococcus acidilactici CCTCC NO: M 20242011, dry cells of Pediococcus acidilactici CCTCC NO: M 20242011 obtained by freeze-drying, immobilized cells of Pediococcus acidilactici CCTCC NO: M 20242011 of the present invention, or Pediococcus acidilactici CCTCC NO: M 20242011 of the present invention in any other form.

5. The microbial agent according to claim 2, characterized in that The bacterial agent may also contain any strain of any species that can be used for fermenting food, such as Saccharomyces cerevisiae, Bacillus subtilis, Bacillus licheniformis, etc.

6. The microbial agent according to claim 2, characterized in that The bacterial agent also contains any carrier that can be used for fermenting food.

7. Use of the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1 in flavor metabolism.

8. The use according to claim 7, characterized in that The flavor metabolism includes producing one or more of the following flavor substances: alcohols such as cis-3-nonen-1-ol, 2-ethylhexanol, 4-methyl-2-pentanol, 3-methyl-1-butanol, 2-hexadecanol, heptanediol, isopropyl alcohol, and 1-decanol; esters such as ethyl butyrate, ethyl heptanoate, ethyl hexanoate, ethyl tetradecanoate, ethyl hexadecanoate, octyl formate, ethyl nonanoate, and ethyl 8-nonenoate; acids such as heptanoic acid, nonanoic acid, octanoic acid, hexanoic acid, dodecanoic acid, n-decanoic acid, 3-methylbutanoic acid, tetradecanoic acid, and 2,4-dimethylpentane. Acid, tridecanoic acid, acetic acid, benzoic acid, 2,4-dimethyl-2-pentenoic acid, phenylacetic acid, 7-octenoic acid; aldehydes such as heptanal, decanal, dodecanal, octanal, nonanal, 2,5-dimethylbenzaldehyde, 3,4-dimethylbenzaldehyde, 2-undecenal, hexanal; ketones such as 5-hepten-2-one 6-methyl, 1-(1H-pyrrol-2-yl)ethanone, acetone; furfural, 2,3-dihydrobenzofuran, 2-pentylfuran; and phenols such as phenol, vanillin, 4-vinylphenol, 2-methoxy-4-vinylphenol.

9. Use of the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1 in liquor fermentation; optionally, the liquor includes Luzhou-flavor liquor, Qing-flavor liquor, Maotai-flavor liquor, and fruit-flavor liquor.

10. Use of the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1 or a bacterial agent containing the Pediococcus acidilactici CCTCC NO: M 20242011 according to claim 1 in fermented foods; optionally, the fermented foods are alcoholic beverages, soy products, fermented vegetables, fermented cereal products, fermented meat products, condiments, or dairy products.

Images