Ribozyme, combination containing ribozyme and application of ribozyme in detection of mRNA capping efficiency
By using ribozymes for specific cutting of mRNA samples and magnetic bead separation, the problems of poor specificity and slow reaction speed in existing detection methods are solved, and efficient and accurate mRNA capping rate detection is achieved.
Patent Information
- Application Number
- CN202510872049.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2025-09-23
AI Technical Summary
Existing mRNA capping efficiency detection methods have problems such as poor specificity and slow reaction speed, which affects the accuracy and efficiency of the detection results.
Ribozymes are used to cut mRNA samples, utilizing the cleavage activity of the ribozyme itself to specifically recognize a single site for cutting. Combined with magnetic bead separation technology, the operation process is simplified and the reaction time is shortened.
The accuracy and efficiency of the test results are improved, the test cycle is significantly shortened, the operation is simple, and it is suitable for batch sample processing.
Smart Images

Figure CN120683108A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and in particular to a ribozyme, a combination comprising the ribozyme, and an application thereof in detecting mRNA capping efficiency. Background Art
[0002] The vaccine industry is currently experiencing rapid growth, particularly in the area of mRNA vaccines. As a novel vaccine, mRNA vaccines offer advantages such as a short development cycle and significant immune efficacy, rapidly catapulting research into this area. mRNA vaccines are synthesized in vitro by mimicking endogenous mRNA molecules and contain five key components: a 5' cap structure, a 5' untranslated region (UTR), an antigen sequence, a 3' untranslated region (UTR), and a 3' poly(A) tail.
[0003] The 5' cap structure is similar to that of endogenous eukaryotic mRNA, containing a 7-methylguanosine bridged to the 5' end of the mRNA via a triphosphate linkage. In mammals, the first or second nucleotide at the 5' end of the mRNA is methylated on the 2' hydroxyl group of the ribose sugar. This structure distinguishes it from viral RNA, preventing recognition by organelles in the cytoplasm and thus avoiding the occurrence of a corresponding immune response.
[0004] The cap structure is also crucial for mRNA stabilization and translation, protecting the 5' end of the mRNA from exonuclease hydrolysis. It also serves as a recognition signal during protein synthesis, being recognized and bound by the cap-binding protein (eIF-4E), prompting the mRNA to bind to the small ribosomal subunit and initiate translation. Therefore, adding a cap structure to mRNA is essential during in vitro mRNA synthesis, making capping efficiency an essential indicator of mRNA quality.
[0005] Currently, the main methods for accurately and quantitatively measuring capping efficiency are liquid chromatography-mass spectrometry (LC-MS) and capillary electrophoresis (CE). However, due to the limited precision of CE, which cannot separate the byproducts GCap, Cap0, and Cap1 generated during the capping process, the test results deviate significantly from the true value, thus limiting its application. Currently, LC-MS is the most accurate method for measuring capping efficiency.
[0006] The existing method for detecting the mRNA capping rate is through nuclease cleavage. When detecting the mRNA capping efficiency, because the full length of the mRNA is too long, the sample must first be enzymatically cleaved into small fragments of nucleotides with cap structures (targets) and long RNA molecules, which are then purified and recovered for detection using HPLC-MS. In this process, a special cleavage probe must be designed to guide the nuclease endonuclease RNase H. The probe contains 4-6 deoxyribonucleic acids at the 5' end, i.e., the enzyme cleavage site, and is connected to biotin at the 3' end. The probe is then combined with the 5' end of the mRNA through an annealing reaction to form a probe-mRNA double-stranded structure. Subsequently, the RNase H endonuclease is added and the cleavage reaction is carried out at 37°C for 5 hours. After the reaction is complete, the reaction solution is mixed with magnetic beads. The binding between the streptavidin on the beads and the biotin on the probe end attracts the 5' end of the probe-mRNA duplex to the magnet. Multiple washes are performed to remove impurities. Then, a trace amount of water is added and the probe is separated from the 5' end of the mRNA at 80°C. However, the probe remains bound to the magnetic beads, and the 5' end of the mRNA is dissolved in the water. At this point, the liquid is removed to obtain a mixture of mRNA 5' ends containing the cap structure. The resulting sample is analyzed by liquid chromatography-mass spectrometry, and the difference in molecular weight distinguishes the 5' ends of mRNA with and without the cap structure, and the capping rate is calculated.
[0007] The above technologies have at least the following drawbacks: 1) Poor specificity: The reaction is carried out using the RNase H endonuclease, which recognizes the double-stranded structure of complementary DNA and RNA and cleaves the RNA single strand using the DNA as a guide. However, it lacks site-specific recognition and can cleave at any position in the mixed double-stranded structure, resulting in complex cleavage products and affecting the accuracy of the test results. 2) Slow reaction speed: Due to the low activity of the RNase H endonuclease, the reaction time of existing detection protocols generally takes 3-5 hours, which seriously affects the detection efficiency.
[0008] Therefore, there is an urgent need in this field to develop new methods for detecting mRNA capping efficiency. Summary of the Invention
[0009] Based on this, it is necessary to provide at least one ribozyme, a combination comprising the ribozyme, and an application thereof in detecting mRNA capping efficiency.
[0010] In a first aspect of the present application, a ribozyme is provided, the nucleic acid sequence of which comprises the sequence shown in SEQ ID NO: 1.
[0011] In a second aspect of the present application, a nucleic acid combination is provided, comprising the ribozyme described in the first aspect.
[0012] In the third aspect of the present application, a combination product for detecting mRNA capping rate is provided, which comprises the nucleic acid combination described in the second aspect, a buffer, Mg 2+ and magnetic beads.
[0013] In the fourth aspect of the present application, a kit is provided, which comprises the kit described in the third aspect.
[0014] In a fifth aspect of the present application, a method for detecting mRNA capping rate is provided, comprising the following steps:
[0015] First annealing reaction: a ribozyme, a solution containing the mRNA to be detected, and a buffer are mixed to obtain a reaction system 1, and an annealing reaction is performed to obtain a reactant 1; the acid sequence of the ribozyme comprises the sequence shown in SEQ ID NO: 1; optionally, the solution containing the mRNA to be detected is an mRNA stock solution;
[0016] Cleavage reaction: reactant 1 and Mg 2+ The solutions are mixed to obtain reaction system 2, and a cleavage reaction is performed to obtain reactant 2;
[0017] Second annealing reaction: reactant 2 and the probe are mixed to obtain reaction system 3, and annealing reaction is performed to obtain reactant 3;
[0018] Isolating the 5' end of the mRNA: Isolating the 5' end of the mRNA from reaction 3 using a label on the probe and magnetic beads; the magnetic beads are modified with a substance capable of binding to the label;
[0019] Calculate the capping rate: Detect the 5' end of the mRNA and calculate the capping rate.
[0020] Using the ribozyme or nucleic acid combination of the present application to detect mRNA capping efficiency has at least the following advantages:
[0021] This method uses the cleavage activity of the ribozyme itself and does not require the synthesis of additional probe sequences. After mixing the mRNA sample with the ribozyme, only Mg is required. 2+ Catalysis activates the ribozyme's cleavage function, making it easy to operate. No protease is required, and the reactants can contain only nucleic acids, without proteins, facilitating purification. The purified product obtained from testing mRNA capping rates contains fewer components, resulting in a significantly lower number of matched substances compared to existing methods, significantly improving test accuracy.
[0022] In summary, compared with existing detection methods, this method is faster and more convenient, can process batches of samples simultaneously, significantly shortens the detection cycle, improves detection efficiency, and can reduce the reaction time to 1.5 hours. It is simple to operate and produces accurate test results. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the technical solutions in the implementation methods and examples of this application and to more completely understand the application and its beneficial effects, the following briefly introduces the drawings required for the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.
[0024] Figure 1 Shows the comparison results of ribozyme reaction at different times in one embodiment of the present application.
[0025] Figure 2A to Figure 2D Shows a comparison between different batches of the ribozyme method, where Figure 2A and Figure 2B As a group, Figure 2C and 2D As a group.
[0026] Figure 2A The deconvoluted molecular weight spectrum of the target component in one embodiment of the present application is shown.
[0027] Figure 2B The target component deconvolution result of one embodiment of the present application is shown.
[0028] Figure 2C The deconvoluted molecular weight spectrum of the target component in one embodiment of the present application is shown.
[0029] Figure 2D The target component deconvolution result of one embodiment of the present application is shown.
[0030] Figure 3A to Figure 3D Shows the comparison results between different detection methods, where Figure 3A and Figure 3B As a group, the detection data by ribozyme method are shown. Figure 3C and Figure 3D One group shows the detection data using the RNaseH method.
[0031] Figure 3A The deconvoluted molecular weight spectrum of the target component in one embodiment of the present application is shown.
[0032] Figure 3B The target component deconvolution result of one embodiment of the present application is shown.
[0033] Figure 3C The deconvoluted molecular weight spectrum of the target component in one embodiment of the present application is shown.
[0034] Figure 3DThe target component deconvolution result of one embodiment of the present application is shown. DETAILED DESCRIPTION
[0035] To facilitate understanding of the present application, a more comprehensive description of the present application will be provided below with reference to the accompanying drawings. The accompanying drawings illustrate preferred embodiments of the present application. However, the present application may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present application.
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0037] In this application, unless otherwise specified, "one or more" refers to any one of the listed items or any combination of the listed items. Similarly, "one or more" and other similar expressions that refer to "one or more" are also understood in the same way unless otherwise specified.
[0038] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.
[0039] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.
[0040] In this application, the terms "further," "further," "particularly," "for example," "such as," "example," and "for example" are used for descriptive purposes to indicate that the preceding and following technical solutions are related in terms of the content covered, but should not be construed as limiting the preceding technical solution or the scope of protection of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it is understood that A is not limited to B.
[0041] In this application, the terms "optionally," "optional," and "optional" mean optional, that is, they refer to either option selected from the two parallel options of "yes" or "no." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "optional" is independent. Unless otherwise specified, the descriptions "optionally include," "optionally include," etc. in this application, taking "optionally include" as an example, mean "may include or not include."
[0042] As used herein, the terms "comprising," "including," and "include" are synonymous and are inclusive or open-ended, not excluding additional, unrecited members or features. Examples of members or features include materials or components, structures, elements, and instruments. Non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, and states.
[0043] In this application, the technical features or technical solutions described in open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.
[0044] In this application, exemplary descriptions such as "in some embodiments (or examples)" and "in one embodiment (or example)" may include but are not limited to the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.
[0045] In this application, in "first aspect", "second aspect", "third aspect", "fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only used for descriptive purposes and cannot be understood as indicating or suggesting relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve as non-exhaustive enumeration description purposes, and it should be understood that they do not constitute closed-form limitations on quantity. Similarly, the numbers after the same terms in this application, such as the numbers "1" and "2" after "reactant 1" and "reactant 2", have no substantive meaning and are only used to distinguish the same terms.
[0046] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values in the numerical interval is considered to be continuous and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval only refers to an integer in the numerical interval, including the two endpoint integers of the numerical range and each integer between the two endpoints, is equivalent to directly enumerating each integer. When multiple numerical ranges are provided to describe a feature or characteristic, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.
[0047] In this application, if a method flow involves multiple steps, unless otherwise specified herein, there is no strict order restriction on the execution of these steps, and they can be executed in an order other than the order described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages do not necessarily need to be completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating, or simultaneously with other steps or parts of sub-steps or stages of other steps.
[0048] During the mRNA capping efficiency test, due to the excessive length of the full-length mRNA, it is usually necessary to cut it with an endonuclease to produce small fragments with cap structures for detection. During the test, a special probe must be designed to guide RNase H to enzymatically cut the sample into small fragments of nucleotides with cap structures (targets) and long RNA molecules. After purification and recovery, liquid chromatography-mass spectrometry (LC-MS) is used for detection. In short, during the detection process of the existing method, a series of components such as endonucleases and corresponding buffers need to be added, which makes the operation complicated. At the same time, the enzyme cleavage reaction takes a long time, which increases the detection cycle. Therefore, it is necessary to develop a method that can quickly and conveniently detect the capping rate.
[0049] This application utilizes the endonuclease activity of a cleaving ribozyme to cleave mRNA samples, eliminating the need for the addition of proteases and corresponding buffers, resulting in a simple operation. The ribozyme can bind to the mRNA sample without the need for a probe guide, significantly accelerating the reaction rate and shortening the detection cycle.
[0050] In a first aspect of the present application, a ribozyme is provided, wherein the nucleic acid sequence comprises the sequence shown in SEQ ID NO: 1.
[0051] A ribozyme is essentially an RNA fragment with endonuclease activity, which can bind to the target RNA through the design of homology arms. After binding to the mRNA, the endonuclease active region of the ribozyme takes effect, specifically recognizing a single site for cleavage, breaking the mRNA and obtaining a single cleavage product, thereby enhancing the specificity of the detection.
[0052] The sequence design of this ribozyme includes a central sequence and two flanking homology arms. Based on research on ribozymes, the inventors creatively optimized the ribozyme sequence design. This complex optimization adds RNA and uses modified RNA, ultimately enabling recognition of different cleavage sites and improving cleavage efficiency, significantly differentiating it from existing ribozyme sequences.
[0053] Without wishing to be bound by any theory, it is believed that this ribozyme cleaves the mRNA sequence more efficiently in the Xenopus globin 5'UTR region.
[0054] In a second aspect of the present application, a nucleic acid combination is provided, which comprises the ribozyme of the first aspect of the present application.
[0055] In some embodiments, the nucleic acid combination further comprises a probe; the nucleic acid sequence of the probe comprises the sequence shown in SEQ ID NO: 2.
[0056] The sequence of the probe is completely complementary to the 5'-UTR sequence in the mRNA sequence. The UTR sequence is obtained through extensive screening and is different from existing UTR sequences.
[0057] The inventors selected the cleavage site according to the mRNA sequence and creatively designed the sequences of the ribozyme and probe according to the cleavage site.
[0058] Using this nucleic acid combination to detect mRNA capping efficiency is faster, simpler and more efficient than existing methods.
[0059] In some embodiments, a tag is attached to the 5' end and / or the 3' end of the probe.
[0060] The function of the probe label is, at least in part, to achieve efficient mRNA separation and purification through specific binding to magnetic beads. The surface of the magnetic beads must be pre-modified with a capture ligand that matches the probe label. In a magnetic bead-based separation system, the probe label can stably bind to the functionalized magnetic beads through strong non-covalent interactions (e.g., affinity binding) without affecting the structure of the ribozyme. Without limitation, the label can be biotin, a nucleic acid, a peptide, a fluorescent small molecule, or a nanoparticle. In some embodiments, the magnetic beads are modified with a substance capable of binding to the probe label, such as biotin or digoxigenin, for example.
[0061] In the third aspect of the present application, a combination product for detecting mRNA capping rate is provided, which comprises the nucleic acid combination of the second aspect, and a buffer, Mg 2+ (e.g. containing Mg 2+ solution) and magnetic beads.
[0062] In some embodiments, Mg 2+ Derived from one or more of magnesium chloride, magnesium sulfate, magnesium citrate, magnesium glycinate and magnesium malate. Exemplarily, the combination product comprises one or more of magnesium chloride solution, magnesium sulfate solution, magnesium citrate solution, magnesium glycinate solution and magnesium malate solution.
[0063] Without wishing to be bound by any theory, it is believed that the buffer functions at least to adjust the pH of the reaction system formed by the combination product when used to detect mRNA capping efficiency. In some embodiments, the pH of the buffer is 5 to 9. Exemplarily, the pH of the buffer is 5, 6, 7, 8, 9, or a range or value between any two values.
[0064] In some embodiments, the buffer comprises one or more of Tris buffer, TAE buffer, and TBE buffer.
[0065] In a fourth aspect of the present application, a kit is provided, comprising the combination product of the third aspect.
[0066] In the present application, the kit may contain different units. Each unit may be contained in an independent small package or in a separate compartment. For example, a buffer solution may be present as one of the units, Mg may be present as one of the units, 2+ (e.g. containing Mg 2+ The solution) and magnetic beads are each present as additional units in the kit.
[0067] In a fourth aspect of the present application, a method for detecting mRNA capping rate is provided, comprising the following steps:
[0068] S100 (first annealing reaction): mixing a ribozyme, a solution containing the mRNA to be detected, and a buffer to obtain a reaction system 1, and performing an annealing reaction to obtain a reactant 1; the ribozyme has an acid sequence comprising the sequence shown in SEQ ID NO: 1; optionally, the solution containing the mRNA to be detected is an mRNA stock solution;
[0069] S200 (cleavage reaction): reactant 1 and Mg 2+ The solutions are mixed to obtain reaction system 2, and a cleavage reaction is performed to obtain reactant 2;
[0070] S300 (second annealing reaction): reactant 2 and the probe are mixed to obtain reaction system 3, and annealing reaction is performed to obtain reactant 3; the probe is as defined above;
[0071] S400 (isolation of the 5' end of mRNA): isolation of the 5' end of mRNA from reaction 3 using a probe label and magnetic beads modified with a substance capable of binding to the label;
[0072] S500 (capping rate calculation): Detect the 5' end of mRNA and calculate the capping rate.
[0073] The mRNA detected by this method preferably contains the Xenopus globin 5' UTR region.
[0074] In some embodiments, in step S100, the molar ratio of the ribozyme to the mRNA to be detected is 2:1 to 5:1.
[0075] In some embodiments, in step S100, the concentration of the ribozyme in the reaction system 1 is 20 mM to 100 mM.
[0076] In some embodiments, in step S100, the buffer comprises one or more of Tris buffer, TAE buffer, and TBE buffer.
[0077] In some embodiments, the pH of the buffer is 5.0-9.0. Exemplarily, the pH of the buffer is 5.0, 6.0, 7.0, 8.0, 9.0, or a range or value between any two values.
[0078] In some embodiments, in step S100, the annealing reaction procedure includes:
[0079] a. 95°C, 10 s~20 s, heating rate 4°C / s~9°C / s;
[0080] b. 65°C~75°C, 0 s~5 s, heating rate 0.1°C / s~0.5°C / s;
[0081] c. 30℃~40℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s;
[0082] d. 4℃~10℃, maintain, temperature change rate 4℃ / s~9℃ / s.
[0083] In step a., the time may be 10 s, 11 s, 12 s, 13 s, 14 s, 15 s, 16 s, 17 s, 18 s, 19 s, or 20 s, or a range or value between any two values. The temperature ramp rate may be, for example, 4°C / s, 5°C / s, 6°C / s, 7°C / s, 8°C / s, or 9°C / s, or a range or value between any two values.
[0084] In step b., the temperature may be, for example, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C, or a range or value between any two values. The time may be, for example, 0 s, 1 s, 2 s, 3 s, 4 s, or 5 s, or a range or value between any two values. The temperature ramp rate may be, for example, 0.1°C / s, 0.2°C / s, 0.3°C / s, 0.4°C / s, or 0.5°C / s, or a range or value between any two values.
[0085] In step c., the temperature may be, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C, or a range or value between any two values. The time may be, for example, 0 s, 1 s, 2 s, 3 s, 4 s, or 5 s, or a range or value between any two values. The temperature ramp rate may be, for example, 0.1°C / s, 0.2°C / s, 0.3°C / s, 0.4°C / s, or 0.5°C / s, or a range or value between any two values.
[0086] In step d., the temperature may be, for example, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, or 10°C, or any range or value between any two values. The temperature ramp rate may be, for example, 4°C / s, 5°C / s, 6°C / s, 7°C / s, 8°C / s, or 9°C / s, or any range or value between any two values.
[0087] In some embodiments, in step S100, the annealing reaction procedure includes:
[0088] 95°C, 10 s~20 s (e.g. 10 s), temperature ramp rate 6°C / s;
[0089] 70℃, 0 s, heating rate 0.2℃ / s;
[0090] 40℃, 0 s, heating rate 0.1℃ / s;
[0091] 4℃, hold, temperature change rate 6℃ / s.
[0092] In some embodiments, in step S200, Mg in the reaction system 2 2+The concentration is 10 mM~50 mM.
[0093] For example, in some embodiments, Mg 2+ The concentration of Mg is 10 mM, 12 mM, 14 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, 50 mM, or a range or value between any two values. 2+ Derived from one or more of magnesium chloride, magnesium sulfate, magnesium citrate, magnesium glycinate and magnesium malate.
[0094] In step S200, the cleavage reaction may be carried out at a temperature of 20°C to 37°C for at least 0.5 h. For example, the cleavage reaction temperature may be 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, or any range or value between any two values. The reaction time may be, for example, 0.5 h, 1 h, 1.5 h, 2 h, 2.5 h, 3 h, 3.5 h, etc.
[0095] In step S300, the molar ratio of the probe to the mRNA in reactant 2 is 2:1 to 5:1. For example, the molar ratio can be 2:1, 3:1, 4:1, 5:1, or any range or value between any two values.
[0096] In step S300, the annealing reaction process may be:
[0097] 1) 95°C, 10 s~20 s, heating rate 4°C / s~9°C / s;
[0098] 2) 65℃~75℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s;
[0099] 3) 30℃~40℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s;
[0100] 4) 4℃~10℃, maintain, temperature change rate 4℃ / s~9℃ / s.
[0101] In step 1), the time may be 10 s, 11 s, 12 s, 13 s, 14 s, 15 s, 16 s, 17 s, 18 s, 19 s, or 20 s, or any range or value between any two values. The temperature ramp rate may be, for example, 4°C / s, 5°C / s, 6°C / s, 7°C / s, 8°C / s, or 9°C / s, or any range or value between any two values.
[0102] In step 2), the temperature may be, for example, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C, or any range or value between any two values. The time may be, for example, 0 s, 1 s, 2 s, 3 s, 4 s, or 5 s, or any range or value between any two values. The temperature ramp rate may be, for example, 0.1°C / s, 0.2°C / s, 0.3°C / s, 0.4°C / s, or 0.5°C / s, or any range or value between any two values.
[0103] In step 3), the temperature may be, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C, or any range or value between any two values. The time may be, for example, 0 s, 1 s, 2 s, 3 s, 4 s, or 5 s, or any range or value between any two values. The temperature ramp rate may be, for example, 0.1°C / s, 0.2°C / s, 0.3°C / s, 0.4°C / s, or 0.5°C / s, or any range or value between any two values.
[0104] In step 4), the temperature may be, for example, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, or 10°C, or any range or value between any two values. The temperature ramp rate may be, for example, 4°C / s, 5°C / s, 6°C / s, 7°C / s, 8°C / s, or 9°C / s, or any range or value between any two values.
[0105] In some embodiments, in step S400, the label on the probe is selected from the group consisting of biotin, nucleic acids, peptides, fluorescent small molecules, and nanoparticles. Accordingly, the substance modified on the magnetic beads that can bind to the label on the probe can be biotin, digoxigenin, etc.
[0106] In some embodiments, the label on the probe is biotin; and the 5' end of the mRNA is isolated using streptavidin magnetic beads.
[0107] In some embodiments, in step S500, the 5' end of the mRNA is detected by liquid chromatography-mass spectrometry.
[0108] Some examples are provided below.
[0109] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and may also be based on the experimental manuals or conventional conditions in this area, or on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.
[0110] The samples used in the following specific examples were all co-transcriptional capping products, and on-machine testing was performed using liquid chromatography coupled to mass spectrometry (LC-MS). The test results presented in the examples include: a TIC total ion current (TIC) chromatogram (the horizontal axis represents the run time, and the vertical axis represents the summed intensity of all responding ions during that time, which is used to determine the peak position of recovered fragmented mRNA and the deconvolution range during the test) and a deconvoluted mass spectrum (the horizontal axis represents the measured molecular weight, and the vertical axis represents the summed intensity of all responding ions at that molecular weight, with the peak area showing a linear relationship with the amount of material at that molecular weight). The final result of the capping efficiency test is the relative peak area percentage of 5'-Cap1 mRNA in the sample.
[0111] Example 1 Design of nucleic acids and probes and detection of mRNA capping rate
[0112] 1. Designing the Ribozyme Sequence: The core sequence structure was derived based on relevant ribozyme sequences reported in the literature. The core sequence was then modified in conjunction with other scientific research to enhance sequence stability and endonuclease activity. An appropriate restriction site was then selected based on the mRNA sequence, and ribozyme homology arm sequences were designed based on the sequences flanking the restriction site. Synthesis was performed based on the designed sequence. The designed ribozyme sequence was: 5'-CGUUAUUCUCUGAUGAGGCCGUGAGGCCGAAAGCUUCUGC-3' (SEQ ID NO: 1).
[0113] 2. Design the probe sequence: Design a probe sequence complementary to the mRNA cap based on the restriction site. Attach biotin to the 3' end of the probe and purify using streptavidin magnetic beads. The designed probe sequence is: 5'-CTGAGCTTCTGCAAAAAGAACAAGC-3' (SEQ ID NO: 2), with a biotin tag attached to the 3' end.
[0114] 3. Annealing: Mix the synthesized ribozyme and mRNA (5'UTR: cttgttctttttgcagaagctcagaataaacgctcaactttgg, SEQ ID NO: 3) stock solutions at a 5:1 molar ratio (to form a double-stranded structure). Add Tris buffer (pH 7.5) to a final concentration of 50 mM. Add enzyme-free water to a total volume of 100 μL. After thorough mixing, place the mixture in a thermal cycler and perform the reaction according to the protocol listed in Table 1.
[0115] Table 1
[0116]
[0117] 4. After the reaction is complete, add MgCl2 solution to a final concentration of 20 mM. Mix thoroughly and place in a gene thermal cycler at 37°C for reaction.
[0118] 5. After the reaction is completed, add 5 times the molar amount of probe to the mRNA, mix well and perform annealing reaction again to allow the probe to bind to the enzyme cleavage product.
[0119] 6. The final reactant is purified by streptavidin magnetic beads, and the target product is separated by utilizing the properties of biotin-streptavidin binding to obtain a relatively pure product.
[0120] 7. Detect the target product by liquid chromatography-mass spectrometry and calculate the capping rate of the mRNA stock solution.
[0121] Capping efficiency (%) = A / (A+B)×100%
[0122] Where A is the 5'-cleavage product with m+1 nucleotides produced after cleavage of the target mRNA by ribozyme, and its abundance value after LC-MS analysis; B is the 5'-cleavage product with m nucleotides produced after cleavage of the target mRNA by ribozyme, and its abundance value after LC-MS analysis.
[0123] Effect:
[0124] 1) Reaction time of ribozyme detection of mRNA capping rate
[0125] For step 4 above, the reaction was terminated at 1.5h, 2h, 2.5h, 3h, and 3.5h, respectively. The target fragments were purified by magnetic beads and subjected to LC-MS detection to calculate the capping rate of the mRNA sample. Figure 1 , indicating that the reaction was complete after 1.5 h.
[0126] 2) Ribozyme detection of the stability of mRNA capping rate
[0127] The results of different batches of samples tested with ribozymes were highly consistent. Figure 2A to Figure 2D (“ppp_uncap” is an uncapped form, and cap1 refers to the capped mRNA substance, which will combine with cations in the mobile phase when detected by LC-MS to form different adducts, such as Na + , K + 、Fe + The algorithm confirmed that these detected adducts were still capped mRNA species, and therefore should be within the calculation range. mRNA synthesized via co-transcriptional capping has only one structure, cap1, and there is no need to distinguish between different cap1s. This demonstrates that the ribozyme detection method can produce consistent results across different experimental batches, with no significant difference between the two test results, demonstrating the method's robustness.
[0128] 3) Comparison of the results between the ribozyme method and the reference method
[0129] Currently, the conventional method for detecting capping efficiency is the RNase H enzymatic cleavage method. The specific experimental method is as follows: During the mRNA capping efficiency detection process, since the full length of mRNA is too long, a special cleavage probe must be designed to cooperate with RNase H to enzymatically cut the sample into small fragments of nucleotides with cap structures (targets) and long fragments of RNA molecules. After purification and recovery, they are detected using LC-MS.
[0130] The deconvolution results of the target components of this method were compared with those of the reference method. Figure 3A to Figure 3D , showing that: Based on the size of the matched substances, the reference method matched multiple substances, all of which were capped products. However, the ribozyme method matched fewer substances than the reference method, indicating that this detection method can produce fewer capped products, which can improve the accuracy and quality of the detection results.
[0131] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0132] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the patent in this application shall be determined by the appended claims, and the specification and drawings shall serve to interpret the claims.
Claims
1. A ribozyme, characterized in that The nucleic acid sequence thereof comprises the sequence shown in SEQ ID NO:
1.
2. A nucleic acid combination, characterized in that It comprises the ribozyme according to claim 1.
3. The nucleic acid combination according to claim 2, wherein It also includes a probe; The nucleic acid sequence of the probe comprises the sequence shown in SEQ ID NO: 2; Optionally, the 5' end and / or 3' end of the probe is connected to a label, and the label is selected from the group consisting of biotin, nucleic acid, peptide, fluorescent small molecule and nanoparticle.
4. A combination product for detecting mRNA capping rate, characterized in that: It comprises the nucleic acid combination as claimed in claim 2 or 3, a buffer, Mg 2+ and magnetic beads; Optionally, the magnetic beads are modified with a substance capable of binding to a label on the probe; Optionally, Mg 2+ Derived from one or more of magnesium chloride, magnesium sulfate, magnesium citrate, magnesium glycinate and magnesium malate; Optionally, the buffer comprises one or more of Tris buffer, TAE buffer and TBE buffer; Optionally, the pH of the buffer solution is 5-9.
5. A kit, characterized in that It comprises the combination product as claimed in claim 4.
6. A method for detecting mRNA capping rate, characterized in that It includes the following steps: First annealing reaction: a ribozyme, a solution containing the mRNA to be detected, and a buffer are mixed to obtain a reaction system 1, and an annealing reaction is performed to obtain a reactant 1; the acid sequence of the ribozyme comprises the sequence shown in SEQ ID NO: 1; optionally, the solution containing the mRNA to be detected is an mRNA stock solution; Cleavage reaction: reactant 1 and Mg 2+ The solutions are mixed to obtain reaction system 2, and a cleavage reaction is performed to obtain reactant 2; Second annealing reaction: reactant 2 and the probe are mixed to obtain reaction system 3, and annealing reaction is performed to obtain reactant 3; the probe is as defined in claim 3; Isolating the 5' end of the mRNA: Isolating the 5' end of the mRNA from reaction 3 using a label on the probe and magnetic beads; the magnetic beads are modified with a substance capable of binding to the label; Calculate the capping rate: Detect the 5' end of the mRNA and calculate the capping rate.
7. The method according to claim 6, wherein The first annealing reaction in step A1) to A4) meets one or more of the following conditions: A1) the molar ratio of the ribozyme to the mRNA to be detected is 2:1 to 5:1; A2) The concentration of the ribozyme in the reaction system 1 is 20 mM to 100 mM; A3) the buffer comprises one or more of Tris buffer, TAE buffer and TBE buffer, and optionally, the pH of the buffer is 5.0-9.0; A4) The annealing reaction procedure is: 95℃, 10 s~20 s, heating rate 4℃ / s~9℃ / s; 65℃~75℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s; 30℃~40℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s; 4℃~10℃, maintain, heating rate 4℃ / s~9℃ / s.
8. The method according to claim 6, wherein The step cleavage reaction meets one or more of the following conditions B1) to B3): B1) Mg in the reaction system 2 2+ The concentration is 10 mM~50 mM; B2) Mg 2+ Derived from one or more of magnesium chloride, magnesium sulfate, magnesium citrate, magnesium glycinate and magnesium malate; B3) The cleavage reaction is carried out at 20°C to 37°C for at least 0.5 h.
9. The method according to any one of claims 6 to 8, wherein The second annealing reaction in step 1 meets one or more of the following conditions C1) to C2): C1) the molar ratio of the probe to the mRNA in the reaction 2 is 2:1 to 5:1; C2) The annealing reaction procedure includes: 95℃, 10 s~20 s, heating rate 4℃ / s~9℃ / s; 65℃~75℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s; 30℃~40℃, 0 s~5 s, heating rate 0.1℃ / s~0.5℃ / s; 4℃~10℃, maintain, heating rate 4℃ / s~9℃ / s.
10. The method according to any one of claims 6 to 8, wherein In the step of isolating the 5' end of the mRNA, the label on the probe is selected from the group consisting of biotin, nucleic acid, peptide, fluorescent small molecule and nanoparticle; optionally, the label on the probe is biotin; and the 5' end of the mRNA is isolated using streptavidin magnetic beads; And / or, in the step of calculating the capping rate, the 5' end of the mRNA is detected by liquid chromatography-mass spectrometry.