Omethoate pesticide specific aptamer

Abstract

The invention belongs to the field of biological biology, and discloses an omethoate specific aptamer, omethoate is taken as a target, the specific aptamer APT-8 is obtained by screening through a GO-SELEX technology, a key recognition area of specific pi-pi stacking action can be defined by the aptamer and the target through molecular docking simulation, and the specific aptamer APT-8 can be used for identifying the specific pi-pi stacking action of omethoate. The aptamer APT-8-1 is obtained after truncation treatment is conducted on APT-8, the sequence of the aptamer APT-8-1 is CGCAGGCGTATCTAGACCGCAGGTCGACGCATGCG, the dissociation constant Kd value measured through a fluorescence method is 28.79 nM, experiments prove that the APT-8-1 has excellent selection specificity, the target does not need to be fixed, forward and reverse screening is combined, rational truncation is conducted through molecular dynamics simulation guidance, the screening efficiency of the aptamer is improved, and the screening efficiency of the aptamer is improved. The omethoate aptamer is obtained, and a nucleic acid recognition element with high affinity and specificity is provided for organophosphorus pesticide residue detection.

Description

Technical Field

[0001] The invention relates to an omethoate pesticide-specific aptamer and belongs to the field of molecular biology. Background Art

[0002] Omethoate (OMT) is a highly effective systemic organophosphorus insecticide and acaricide widely used to control a variety of crop pests and mites. However, its high water solubility and toxicity make it easy for it to migrate and spread in the environment. It accumulates in the human body through the food chain, inhibits cholinesterase activity, causes neurotoxicity, and even leads to acute poisoning, posing a serious threat to human health. Therefore, a detection method with rapid response, high sensitivity, and accurate identification capabilities is needed.

[0003] At present, the detection of organophosphorus pesticides mainly relies on instrumental analysis methods such as gas chromatography and liquid chromatography-mass spectrometry. Although these methods are accurate and reliable, they require professional operators and complex pre-treatment steps, making it difficult to achieve rapid on-site detection. Although the immunoassay method is relatively simple, the antibody preparation cycle is long and has limitations. The detection technology based on the principle of specific recognition provides a new sensitive, specific and efficient detection method for the analysis of omethoate residues.

[0004] Aptamers, as a new type of recognition molecule, have the advantages of simple synthesis and good stability, providing new ideas for pesticide residue detection. Aptamers are single-stranded DNA or RNA molecules obtained through SELEX technology screening. Since small molecules lack suitable immobilization sites, screening aptamers for small molecule pesticides is difficult. GO-SELEX technology utilizes the properties of graphene oxide to complete screening without target fixation, effectively improving screening efficiency. This technology has been successfully applied to the screening of aptamers for various pesticides, providing a reliable tool for small molecule detection. By optimizing screening conditions and methods, high-affinity specific aptamers can be obtained, laying the foundation for the development of pesticide residue detection platforms. Summary of the Invention

[0005] The purpose of the present invention is to screen and obtain an omethoate organophosphorus pesticide-specific aptamer, and to provide a high-quality recognition element for a rapid detection method of omethoate.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is: an omethoate pesticide-specific aptamer is prepared by a method comprising the following steps:

[0007] (1) Using omethoate as the target, the GO-SELEX screening method was used to obtain aptamers;

[0008] (2) Monitoring the screening process of omethoate aptamers;

[0009] (3) Molecular docking simulation was used to determine the key binding regions and binding sites between the aptamer and omethoate, and the aptamer sequence was truncated and optimized;

[0010] (4) Verification of affinity and specificity of oxydemeton-methyl aptamer.

[0011] Preferably, the initial random ssDNA library for omethoate aptamer screening in step (1) contains a 79 nt single-stranded oligonucleotide, including upstream and downstream primers and 35 random nucleotide sequences in the middle.

[0012] Preferably, in step (1), the omethoate aptamer screening is combined with positive screening and reverse screening, with omethoate as the positive screening target, chlorpyrifos, ethoprophos, phoxim and phorate as the reverse screening targets, the library and the target are mixed and incubated, purified, amplified by PCR, verified by gel electrophoresis, and then streptavidin magnetic beads are added to prepare single chains.

[0013] Preferably, in step (2), the nucleic acid concentration of each round of PCR products is measured, and the recovery rate of each round of screening is calculated by the molar ratio of recovered ssDNA to input ssDNA to evaluate the screening progress. As the number of screening rounds increases, ssDNA is continuously enriched and the recovery rate gradually stabilizes.

[0014] Preferably, in step (3), the secondary structure and homology of the aptamer are analyzed by DNAMAN software and M-fold program to determine the representative sequence, and the sequence affinity is determined by fluorescence method, and the fluorescence value is nonlinearly fitted by software to determine the dissociation constant of the representative sequence.

[0015] Preferably, the representative sequence selected in step (3) is subjected to molecular docking simulation to determine the key binding sites and binding regions, and the aptamer forms a stable complex with the target molecule under the synergy of hydrophobic interaction, π-π stacking and ionic interaction.

[0016] Preferably, the molecular docking simulation results of step (3) are combined with the secondary structure to perform shear optimization on the aptamer sequence to obtain a truncated aptamer sequence APT-8-1 with higher affinity: CGCAGGCGTATCTAGACCGCAGGTCGACGCATGCG.

[0017] Preferably, in step (4), the performance of the optimized aptamer APT-8-1 obtained by truncating omethoate 3 is analyzed, and the affinity and specificity of the obtained aptamer are determined by fluorescence method.

[0018] The present invention has the following beneficial effects.

[0019] The present invention screens and obtains an aptamer that can specifically recognize the pesticide omethoate. This aptamer has good affinity and specificity. Using the screened aptamer as a recognition element can achieve efficient and rapid detection of the organophosphorus pesticide omethoate, providing a new method for on-site rapid monitoring by regulatory authorities. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a screening flow chart of the omethoate aptamer of the present invention.

[0021] Figure 2 It is the screening process monitoring of the omethoate aptamer of the present invention.

[0022] Figure 3 This is an affinity analysis of the enriched sequence of the omethoate aptamer of the present invention.

[0023] Figure 4 It is the molecular docking simulation result of the enriched sequence of the omethoate aptamer of the present invention and omethoate.

[0024] Figure 5 Schematic diagram of the shearing treatment of the omethoate aptamer of the present invention. DETAILED DESCRIPTION

[0025] The present invention will be further described in detail below with reference to the accompanying drawings and examples, but the examples do not limit the present invention in any form.

[0026] Example 1: Positive screening of aptamers

[0027] Process as Figure 1 As shown, 1 μL of the initial library was first mixed with 199 μL of binding buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, 0.02% Tween 20, pH 7.6). The mixture was denatured at 95°C for 10 min, ice-bathed for 10 min, and allowed to stand at room temperature for 10 min. Subsequently, 2 μL of target solution was added to the denatured library, and the mixture was incubated at room temperature in the dark for 1 h. 400 μL of graphene oxide (GO) solution, which adsorbs unbound ssDNA through π-π stacking and hydrogen bonding, was added, and the mixture was incubated at room temperature in the dark for 2 h. The mixture was centrifuged at 12,000 rpm for 15 min, and the supernatant containing the aptamer-target complex was collected. The unbound and weakly bound ssDNA were discarded, and the supernatant was purified using a DNA product purification / gel recovery kit to prepare DNA for PCR amplification.

[0028] Example 2: Counter-screening of aptamers

[0029] Process as Figure 1As shown in the figure, in order to improve the specificity of ssDNA, a counter-screening process was added, and chlorpyrifos, ethoprophos, phoxim, and phorate were selected as counter-screening targets. After incubation with the ssDNA library, GO solution was added, and the supernatant containing ssDNA that could bind to the counter-screening target was removed by centrifugation. The precipitate of ssDNA adsorbed on GO was collected and redissolved with binding buffer, and then incubated with the positive screening target to desorb ssDNA from GO for the next screening step. All subsequent screening steps were the same as those for the positive screening.

[0030] Example 3: PCR amplification reaction system

[0031] The reaction mixture contained 1 μL of 20 μM upstream primer, 1 μL of 20 μM biotin-labeled downstream primer, 1 μL of DNA template, 12.5 μL of 2× Taq PCR premix, and 9.5 μL of ultrapure water. The final volume was adjusted to 25 μL, and the amplification parameters were as follows: initial heating at 95°C for 5 min for pre-denaturation; subsequent cycling settings included 95°C for 30 s to denature DNA, 55°C for 30 s to complete primer annealing, and 72°C for 15 s to achieve chain extension. The above steps were repeated 25 times; finally, extension was performed at 72°C for 10 min, and then the reaction was cooled to 4°C for storage.

[0032] Example 4: Preparation of secondary library

[0033] After the PCR products were prepared and eluted by separating biotinylated double-stranded deoxyribonucleic acid (dsDNA) with sodium hydroxide elution buffer using streptavidin-modified magnetic beads, ssDNA was collected and used as the initial library for the next round of SELEX.

[0034] Example 5: Sequence Analysis

[0035] When the ssDNA recovery rate gradually stabilized, the PCR amplification products obtained in the final round of screening were sent to Shanghai Bioengineering Technology Co., Ltd. for high-throughput sequencing to obtain ssDNA-enriched sequences. The top 40 sequences with the highest enrichment were selected, and the homology and secondary structure of the selected sequences were analyzed using DNAMAN 8 software and the Mfold program (http: / / www.unafold.org). They were then classified into different families, and one representative sequence was selected for each family.

[0036] Example 6: Affinity Verification

[0037] like Figure 3As shown in the figure, different concentrations of FAM-labeled aptamers were added to a target with a concentration of 10 μmol and incubated with shaking for 1 h. Subsequently, GO solution was added and incubated with shaking for 2 h. The mixture was centrifuged at 12,000 rpm for 10 min, and the supernatant was collected and the fluorescence value was measured. At the same time, ultrapure water was used instead of the target as a blank control group, and the fluorescence value was measured by a fluorescence spectrophotometer with an excitation wavelength of 497 nm and an emission wavelength of 519 nm. The corresponding affinity curve was fitted by the relative fluorescence intensity difference (△F, F-F0) between the experimental group (F) and the control group (F0) to determine the affinity between the candidate aptamer and the target molecule.

[0038] Example 7: Molecular docking simulation

[0039] like Figure 4 As shown, AlphaFold3 ( https: / / pubchem.ncbi.nlm.nih.gov ) The three-dimensional structural model of the aptamer was predicted based on the nucleic acid sequence. The simulation results were imported into AutoDock4.2 to calculate the binding free energy. The model with the lowest binding free energy was selected as the optimal model. The structure of omethoate was obtained from the Pubchem database. The Lamarckian genetic algorithm was used for molecular docking calculations, and the final docked structure was evaluated based on the binding free energy. The docking results were visualized using Pymol 2.1 software.

[0040] Example 8: Sequence shearing optimization

[0041] like Figure 5 As shown, the key binding sites were determined by analyzing the secondary structure of the aptamer and combining molecular docking simulation, then the non-essential base fragments were truncated, the secondary structure of the truncated aptamer was re-simulated, and the affinity of the aptamer was measured by fluorescence method to obtain the truncated aptamer APT-8-1 with higher affinity: CGCAGGCGTATCTAGACCGCAGGTCGACGCATGCG.

Claims

1. An omethoate aptamer, characterized in that: The steps include: (1) Using omethoate as the target, the GO-SELEX screening method was used to obtain the aptamer APT-8-1: CGCAGGCGTATCTAGACCGCAGGTCGACGCATGCG; (2) Monitoring the screening process of omethoate aptamers; (3) Molecular docking simulation was used to determine the key binding regions and binding sites between the aptamer and omethoate, and the aptamer sequence was truncated and optimized; (4) Verification of affinity and specificity of oxydemeton-methyl aptamer.

2. The omethoate aptamer according to claim 1, wherein Step (1) The initial random ssDNA library for omethoate aptamer screening contains 79 nt single-stranded oligonucleotides, including upstream and downstream primers and 35 random nucleotide sequences in the middle.

3. The omethoate aptamer according to claim 1, characterized in that Step (1) Omethoate aptamer screening was performed by combining positive screening and reverse screening, with Omethoate as the positive screening target, and chlorpyrifos, chlorpyrifos, phoxim and phorate as the reverse screening targets. The library and the target were mixed and incubated, purified, amplified by PCR, and verified by gel electrophoresis, and then streptavidin magnetic beads were added to prepare single chains.

4. The omethoate aptamer according to claim 1, characterized in that Step (2) measures the nucleic acid concentration of each round of PCR products and calculates the recovery rate of each round of screening by the molar ratio of recovered ssDNA to input ssDNA to evaluate the screening process. As the number of screening rounds increases, ssDNA is continuously enriched and the recovery rate gradually stabilizes.

5. An omethoate aptamer according to claims 3 and 4, characterized in that, The final screening product obtained in step (2) is subjected to high-throughput sequencing to identify candidate aptamers, and the affinity is determined by fluorescence method.

6. The omethoate aptamer according to claim 5, characterized in that Step (3) molecular docking simulation is performed on the selected candidate sequence to determine the key binding sites and binding regions. The aptamer forms a stable complex with the target molecule under the synergy of hydrophobic interaction, π-π stacking and ionic interaction.

7. The omethoate aptamer according to claim 5, wherein Step (4) Based on the molecular docking simulation results and the secondary structure, the aptamer sequence was optimized by shearing to obtain a truncated aptamer sequence APT-8-1 with higher affinity and specificity: CGCAGGCGTATCTAGACCGCAGGTCGACGCATGCG.

Images