Gene of rice stripe mosaic virus encoding protein and application thereof

Abstract

The invention belongs to the technical field of biology. More specifically, the invention provides a gene of a rice virus coding protein. The invention discloses the existence of extra small protein ORF8 on a rice stripe mosaic virus (RSMV) coding chain for the first time, and researches show that a rice plant overexpressed with the ORF8 gene shows significantly reduced virus accumulation in the middle and later periods of RSMV infection, which indicates that overexpression of the ORF8 gene can effectively inhibit replication and diffusion of the RSMV in rice, so that the rice plant can effectively inhibit the rice from being infected by the RSMV. Therefore, the harm of viruses to plants is obviously reduced. The invention provides a method for constructing an anti-RSMV plant variety by using the ORF8 gene, and the resistance of the plant to the RSMV virus is enhanced, so that the prevention and treatment of the rice stripe mosaic disease are realized, the application prospect and value are very good, and an important technical support is provided for sustainable development of agricultural production.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically relates to a gene encoding a rice stripe mosaic virus protein and its application. Background Art

[0002] Rice stripe mosaic virus (RSMV) is a new species of the genus Cytoplasmic Rhabdovirus in the family Rhabdoviridae, first discovered in 2015. It is a negative-sense, single-stranded RNA virus with a total length of 12 nt. Its complementary strand contains seven open reading frames (ORFs), encoding N, P, P3, M, G, P6, and L, respectively. N is the nucleocapsid protein, with a nuclear localization signal (NLS) at both its N- and C-termini. The P protein contains multiple phosphorylation sites, and the P3 protein has a NLS at its C-terminus. M is the matrix protein, and G is the glycoprotein, with a signal peptide and seven glycosylation sites at its N-terminus and a transmembrane region at its C-terminus. The accessory protein P6 is a basic protein, and the L protein is an RNase polymerase containing the negative-sense RNA viral RdRp protection motif.

[0003] Rice stripe mosaic virus (RSMV) causes rice stripe mosaic disease. Since its initial discovery, the virus has been spreading annually across rice-growing areas in southern my country, with increasing severity and severity, posing a serious threat to rice production. Infected rice plants in the field exhibit leaf stripes and mosaics, delayed growth, and significantly shorter height than healthy plants. Leaves also develop light yellow stripes or mosaic-like lesions, and some leaf tips become twisted, seriously impacting rice production.

[0004] Plant viral diseases, caused by viruses, pose significant risks to agricultural production. Once a virus has invaded a plant, it is often difficult to eliminate it directly with chemical agents. Currently, the best approach to preventing and controlling plant viral diseases is through the development of disease-resistant varieties, leveraging the advantages of antiviral genes. Therefore, further research into genes that harbor resistance to rice stripe mosaic virus (RSMV) and the development of new rice varieties with genetic material harboring high resistance to RSMV are crucial for the prevention and control of RSMV. Summary of the Invention

[0005] The present invention aims to provide a gene encoding a rice virus protein, which can be used to construct plant varieties with enhanced resistance to rice stripe mosaic virus, thereby preventing and controlling diseases caused by rice stripe mosaic virus.

[0006] The first object of the present invention is to provide a gene encoding a rice virus protein and its application.

[0007] A second object of the present invention is to provide an agent for enhancing the resistance of plants to rice stripe mosaic virus.

[0008] The third object of the present invention is to provide a method for cultivating plants with enhanced resistance to rice stripe mosaic virus.

[0009] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0010] This invention reveals for the first time the presence of an additional small protein, ORF8, in the coding strand of the rice stripe mosaic virus (RSMV). By constructing an ORF8 overexpression vector and applying it to rice genetic transformation, rice plants overexpressing the ORF8 gene were constructed. Rice plants overexpressing the ORF8 gene showed significantly reduced viral accumulation in the middle and late stages of RSMV infection, indicating that ORF8 overexpression can effectively inhibit the replication and spread of RSMV in rice. Therefore, this invention claims protection for the following solutions:

[0011] The present invention provides a gene encoding a rice virus protein, the nucleotide sequence of which is selected from one of the following groups of sequences:

[0012] (a) the nucleotide sequence shown in SEQ ID NO. 1,

[0013] (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 2,

[0014] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0015] The present invention provides a rice virus-encoded protein having an amino acid sequence shown in SEQ ID NO.2.

[0016] The present invention provides application of the above gene or protein in enhancing the resistance of plants to rice stripe mosaic virus.

[0017] The present invention provides the use of the above gene or protein in preparing a product for enhancing the resistance of plants to rice stripe mosaic virus.

[0018] The present invention provides the use of the above gene as a target in constructing a plant variety with enhanced resistance to rice stripe mosaic virus.

[0019] The present invention provides application of the reagent for promoting the expression of the above gene in enhancing the resistance of plants to rice stripe mosaic virus.

[0020] The present invention also provides a reagent for enhancing the resistance of plants to rice stripe mosaic virus, wherein the reagent is a reagent for promoting the expression of the above gene.

[0021] As an optional embodiment, the reagent is an overexpression vector of the above-mentioned gene.

[0022] As an optional embodiment, the method for constructing the overexpression vector is to construct the nucleotide sequence of the above gene into a plant expression vector by homologous recombination.

[0023] As an alternative embodiment, the plant expression vector is pRHV.

[0024] As an optional embodiment, the primers for amplifying the above gene include a forward primer and a reverse primer, the forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4.

[0025] The use of the above reagents in constructing plant varieties with enhanced resistance to rice stripe mosaic virus, or in enhancing the resistance of plants to rice stripe mosaic virus, should also be within the scope of protection of the present invention.

[0026] The present invention provides a method for cultivating plants with enhanced resistance to rice stripe mosaic virus, wherein the gene is introduced into the plant for over-expression.

[0027] As an alternative embodiment, the plant is rice.

[0028] The present invention has the following beneficial effects:

[0029] This study reveals for the first time the presence of an additional small protein, ORF8, in the coding chain of rice stripe mosaic virus (RSMV). By constructing an ORF8 overexpression vector and applying it to rice genetic transformation, rice plants overexpressing the ORF8 gene were constructed. Rice plants overexpressing the ORF8 gene showed significantly reduced viral accumulation in the middle and late stages of RSMV infection, indicating that overexpression of the ORF8 gene can effectively inhibit the replication and spread of RSMV in rice, thereby significantly reducing the virus's damage to plants. The discovery of the disease-resistant function of the ORF8 gene provides a new research direction for novel antiviral strategies encoding additional small proteins for RSMV.

[0030] The present invention provides a method for constructing RSMV-resistant plant varieties using the ORF8 gene, thereby enhancing the plant's resistance to the RSMV virus, thereby achieving the prevention and treatment of rice stripe mosaic disease. The method has good application prospects and value, and provides important technical support for the sustainable development of agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is the location and size of ORF8 in the RSMV genome.

[0032] Figure 2 The ORF8 overexpression vector plasmid was sequenced and identified.

[0033] Figure 3Screening of gene expression levels in ORF8 overexpressing rice materials.

[0034] Figure 4 The expression levels of related proteins in ORF8 overexpressing rice materials.

[0035] Figure 5 These are the virus accumulation detection results of ORF8 transgenic rice at 15dpi, 30dpi, and 45dpi after RSMV infection.

[0036] Figure 6 The results show the analysis of RSMV-N protein accumulation in WT and ORF8 transgenic rice infected with RSMV 45 dpi.

[0037] Figure 7 Phenotypic comparison of wild-type and ORF8-overexpressing rice after RSMV inoculation and mock inoculation. DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0039] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0040] The pRHV vector has been disclosed in the document "He, F., Zhang, F., Sun, W. et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes. Rice 11, 27 (2018).".

[0041] Gel recovery kit, brand is Vazyme, item number is DC301-01.

[0042] Escherichia coli competent bacteria TOP10 were purchased from Shanghai Weidi Biotechnology Co., Ltd. with the product number DL1010S.

[0043] One Step Cloning Kit, brand is Vazyme, product number is C112-02.

[0044] The rice variety used in the following examples is Zhonghua 11 (ZH11), and its seeds are propagated and stored in this laboratory. The nucleotide sequence of the ORF8 gene is shown in SEQ ID NO.1 (5'-3'), SEQ ID NO.1:

[0045]

[0046] The amino acid sequence of ORF8 protein is shown in SEQ ID NO.2:

[0047]

[0048] Example 1 Construction of transgenic rice overexpressing ORF8

[0049] 1. Construction and identification of ORF8 overexpression vector

[0050] (1) Obtaining ORF8 of the target gene

[0051] The location and size of ORF8 in the RSMV genome are as follows Figure 1 The nucleotide sequence of the ORF8 gene is shown in SEQ ID NO.1, and the amino acid sequence of the ORF8 protein is shown in SEQ ID NO.2.

[0052] Using cDNA from wild-type rice infected with RSMV as a template, primers were designed to amplify the ORF8 gene sequence. The ORF8 gene was amplified by PCR. The PCR product was separated by agarose gel electrophoresis, and the target gene fragment was recovered using a gel recovery kit (Vazyme). Specific steps were followed according to the kit instructions.

[0053] The specific primers for amplifying the ORF8 gene are as follows:

[0054] pRHV-ORF8-HA-F: gatccagtgggatccATGCGGATACTAAAAAGGCC (SEQ ID NO. 3);

[0055] pRHV-ORF8-HA-R: cgcactagtaagcttCCTTAGACTCATCTGTGACT (SEQ ID NO.4);

[0056] Lowercase letters represent the homologous sequences of the vector, italic letters are the restriction sites of BamHI and HindIII, and uppercase letters represent the specific sequences of the gene.

[0057] (2) Enzyme digestion to obtain pRHV linearized vector

[0058] The pRHV empty vector plasmid was subjected to double enzyme digestion experiment using BamHI and HindIII restriction endonucleases, and the vector digestion products were recovered using a gel recovery kit (Vazyme). The specific steps were carried out according to the kit instructions.

[0059] (3) Homologous recombination

[0060] use One Step Cloning Kit (Vazyme) was used to perform homologous recombination experiments with the target gene fragment and the vector enzyme digestion product according to its instructions. The reaction system is shown in Table 1. The reaction procedure was: 37°C, 30 min, to obtain the homologous recombination product.

[0061] Table 1 Reaction system

[0062]

[0063] (4) Transformation of recombinant plasmid into Escherichia coli

[0064] The homologous recombination product was transformed into competent Escherichia coli TOP10 (Shanghai Weidi Biotechnology Co., Ltd.), and the transformation steps were referred to the product manual.

[0065] (5) Screening and identification of positive transformants and extraction of recombinant plasmids

[0066] Single colonies from the plates were selected for colony PCR. Positive transformants were screened after agarose gel electrophoresis. In a clean bench, positive clones were inoculated into 5 mL of liquid LB medium containing the appropriate antibiotics and incubated at 37°C on a shaker at 200 rpm for 8-12 hours. Glycerol stocks were then stored, and plasmids were extracted and sent to the company for sequencing and verification. Plasmid extraction was performed using an Axygen plasmid extraction kit.

[0067] (6) Identification results such as Figure 2 As shown, ORF8 was successfully linked into the pRHV vector. After sequencing and identification, some plasmids were delivered to Weimi Biotechnology (Hainan) Co., Ltd. for genetic transformation of rice, using the rice variety ZH11.

[0068] 2. Screening of transgenic rice overexpressing ORF8

[0069] The T0 generation overexpression rice plants obtained by genetic transformation were screened for gene expression, and the screening results were as follows: Figure 3 and Figure 4 As shown, the results showed that the expression level of ORF8 gene in each rice plant increased to varying degrees, and the rice plants with high gene expression levels could detect the expression of the target protein by HA tag.

[0070] Example 2: Treatment of wild-type rice ZH11 and ORF8 overexpressing rice with poison

[0071] 1. Experimental Methods

[0072] (1) Rice seed germination and cultivation

[0073] After preparing the rice seeds required for the experiment, they were individually packaged in disposable plastic cups and labeled. The seeds were added to clean water, and the floating seed shells and inferior seeds were removed. Repeated screening was performed to retain the plump seeds. Subsequently, the screened seeds were placed in a 37°C constant temperature incubator and soaked in clean water for 1-2 days. During this period, the water was changed 2-3 times to keep the water clean. After the seeds were fully absorbed by the water, they were wrapped in clean and moist white gauze and continued to be placed in a 37°C incubator for germination for 1-2 days. During this process, it was necessary to pay attention to changes in humidity and maintain a humid environment. After the seeds germinated, they could be sown.

[0074] When sowing, mix the substrate soil and rice nutrient soil in a ratio of 1:1, add water and stir thoroughly, then evenly sow the germinated seeds on the soil surface, and apply appropriate amount of fertilizer 10 days after sowing. During this period, the sown rice seedlings are placed in an artificial constant temperature and light-controlled climate incubator (Ningbo Life Technology Co., Ltd.) for cultivation. The culture conditions are: temperature 25℃±1℃, relative humidity 70%±5%, and photoperiod of 16 hours of light / 8 hours of darkness. Water once every 3-4 days to ensure that the soil is moist. When the rice grows to the 3-4 leaf stage, it can be used for virus transmission experiments.

[0075] (2) Preparation of poison for the vector insect, the electric leafhopper

[0076] Before conducting the inoculation experiment, the infected insect vector, the electric leafhopper, must be prepared in advance. First, select one or two rice strains infected with RSMV (Rice Stripe Mosaic Virus), place them in an insect cage, and introduce an appropriate number of electric leafhopper nymphs. After approximately 14 days of feeding, allowing the virus to circulate within the insects, 5-10 electric leafhoppers are randomly selected and tested for virus infection using RT-PCR. A virus infection rate of ≥80% is considered optimal.

[0077] At the same time, to ensure the synchronization of the poisoning experiment, the rice material used for the poisoning process must be sown in the pots at the same time as the poisoning process. When the rice is 15-18 days old (3-4 leaves), the poisoning experiment can begin.

[0078] (3) Treatment of rice with rice stripe mosaic virus (RSMV)

[0079] Rice plants were inoculated using the bagged cup method. The cups used were disposable transparent plastic cups, which were punctured to allow for ventilation. Ten test rice seedlings and 15 infected leafhoppers were placed in each cup (rice seedling:leafhopper ratio = 1:1.5). After bagging, the rice plants were incubated for two days, with insects being sprayed every 12 hours to ensure that each plant was fully ingested. After inoculation, the leafhoppers were returned to the insect cages, and the rice plants were hardened in the wild for one day before being transplanted to the paddy field or a controlled-temperature, light-controlled climate chamber for further cultivation.

[0080] RSMV-inoculated rice plants included wild-type rice ZH11 (WT), ORF8-overexpressing plants PRHV-ORF8-HA#9, and ORF8-overexpressing plants PRHV-ORF8-HA#14. Avirulent electric leafhoppers fed on wild-type rice ZH11 (WT), ORF8-overexpressing plants PRHV-ORF8-HA#9, and ORF8-overexpressing plants PRHV-ORF8-HA#14 for the same period of time served as mock-inoculated groups.

[0081] Fourteen days after transplanting, rice samples were collected and tested for RSMV infection using Dot-ELISA. Positive strains were used for subsequent experimental analysis. Rice plant symptoms were observed 15, 30, and 45 days post-inoculation (dpi). Total RNA was extracted from leaves, and RSMV accumulation was determined by qRT-PCR and Western blot.

[0082] The primers used in the qRT-PCR experiment are as follows:

[0083] Upstream primer sequence of the internal reference gene EF1a (5'-3'): ACATTGCCGTCAAGTTTGCTG (SEQ ID NO. 5);

[0084] Downstream primer sequence of the internal reference gene EF1a (5'-3'): AACAGCCACCGTTTGCCTC (SEQ ID NO. 6);

[0085] RSMV quantitative upstream primer sequence (5'-3'): TCTGGGTGAAGTGTCTTCTCA (SEQ ID NO. 7);

[0086] The quantitative downstream primer sequence of RSMV (5'-3'): GCCCTCTTCTAATGTGCGG (SEQ ID NO. 8).

[0087] 2. Experimental Results

[0088] The results of virus accumulation detection after ORF8 transgenic rice was infected with RSMV are as follows Figure 5 As shown, the results showed that at 30dpi and 45dpi, the RSMV accumulation in ORF8-overexpressing rice was significantly reduced compared with that in wild-type ZH11.

[0089] The expression levels of RSMV N protein in wild-type and ORF8-overexpressing rice at 45 dpi were detected by Western blot. Figure 6As shown, the results showed that the N protein level of RSMV in ORF8-overexpressing rice was significantly lower, indicating that ORF8-overexpressing rice has an inhibitory effect on RSMV infection of rice.

[0090] Comparison of phenotypes of wild-type rice and overexpression rice after RSMV inoculation and mock inoculation Figure 7 As shown, the results showed that the disease symptoms of ORF8 overexpressing rice were significantly alleviated compared with those of wild-type ZH11 rice.

[0091] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A gene encoding a rice virus protein, characterized in that: The nucleotide sequence is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID NO. 1, (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 2, (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

2. A rice virus-encoded protein, characterized in that: It has the amino acid sequence shown in SEQ ID NO.

2.

3. Use of the gene according to claim 1 or the protein according to claim 2 in enhancing plant resistance to rice stripe mosaic virus.

4. Use of the gene according to claim 1 or the protein according to claim 2 in the preparation of a product for enhancing plant resistance to rice stripe mosaic virus.

5. Use of the gene according to claim 1 as a target in constructing plant varieties with enhanced resistance to rice stripe mosaic virus.

6. Use of an agent for promoting the expression of the gene according to claim 1 in enhancing the resistance of plants to rice stripe mosaic virus.

7. An agent for enhancing plant resistance to rice stripe mosaic virus, characterized in that An agent for promoting the expression of the gene according to claim 1.

8. The reagent according to claim 7, characterized in that The reagent is an overexpression vector of the gene according to claim 1.

9. Use of the agent according to claim 7 or 8 in constructing a plant variety with enhanced resistance to rice stripe mosaic virus, or in enhancing the resistance of a plant to rice stripe mosaic virus.

10. A method for cultivating plants with enhanced resistance to rice stripe mosaic virus, characterized in that: The gene according to claim 1 is introduced into a plant for overexpression.

Images