Recombinant lentivirus transfer plasmid as well as construction method and application thereof

Abstract

The invention relates to a recombinant lentivirus transfer plasmid as well as a construction method and application thereof, and belongs to the technical field of gene engineering. The recombinant lentivirus transfer plasmid contains 5 'LTR, a packaging signal coding sequence, a human epidermal growth factor receptor 2 gene and 3' LTR, and the human epidermal growth factor receptor 2 gene is located at the upstream of the 5 'LTR. The lentivirus transfer plasmid is modified, and the human epidermal growth factor receptor 2 gene is inserted into the upstream of the 5 'LTR, so that the yield of the packaged and prepared lentivirus vector can be improved, and a new thought is provided for optimizing the design of the lentivirus vector and improving the expression efficiency of a target gene.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and relates to a recombinant lentiviral transfer plasmid and a construction method and application thereof. Background Art

[0002] Lentiviruses belong to the Retroviridae family and are RNA viruses derived from human immunodeficiency virus-1 (HIV-1). As viral vectors, they contain the essential genetic information for packaging, transfection, and stable integration, and are the core component of the lentiviral vector system. This system primarily consists of three different plasmids: a transfer plasmid, a helper plasmid, and an envelope expression plasmid. The transfer plasmid is used to insert the exogenous gene of interest and retains the key elements required for viral integration and replication. The helper plasmid is responsible for expressing the gag, pol, and rev proteins. gag encodes the viral core protein; pol encodes enzymes required for viral replication; and rev participates in the nucleocytoplasmic transport of HIV structural protein mRNA.

[0003] Lentiviruses are renowned for their efficient gene transfection and ability to infect non-dividing cells. Their ability to stably integrate their genome into host cell DNA has led to their widespread use in gene and cell therapy. Their large transfection capacity makes them suitable for carrying longer exogenous gene fragments for gene editing and recombinant protein production. Lentivirus-based overexpression cell line construction is a common technique in genetic engineering and involves multiple key steps. These steps begin with selecting the target gene and obtaining its complete cDNA sequence. The gene is then cloned into a lentiviral vector (such as pCDH or pLenti), which typically contains an insertion site for a strong promoter. Next, 293T cells are used for viral packaging. The recombinant vector and packaging plasmid are co-transfected, and viral particles are collected from the culture medium within 24 to 48 hours after transfection. Subsequent steps include infecting the target cells, typically by polylysine treatment or viral concentration to enhance infection efficiency.

[0004] When constructing overexpression cell lines using lentiviral methods, packaging exogenous gene fragments from different species often faces challenges such as low viral titers. These challenges are often related to key factors such as gene sequence compatibility, expression of accessory proteins, host cell selection, packaging plasmid design, and infection efficiency. In particular, genetic differences between species can lead to reduced expression efficiency, thereby affecting viral assembly. Therefore, developing methods to prepare high-titer lentiviral vectors is of great significance for the application of lentiviral vectors. Summary of the Invention

[0005] In response to the deficiencies of the existing technology and actual needs, the present invention provides a recombinant lentiviral transfer plasmid and its construction method and application, transforms the lentiviral transfer plasmid, and further develops a method for increasing the yield of lentiviral vectors.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a recombinant lentiviral transfer plasmid comprising a 5'LTR (long terminal repeat), a packaging signal coding sequence, a human epidermal growth factor receptor 2 gene and a 3'LTR, wherein the human epidermal growth factor receptor 2 gene is located upstream of the 5'LTR.

[0008] In the present invention, it was found that inserting the human epidermal growth factor receptor 2 gene before the 5'LTR of the lentiviral transfer plasmid can effectively improve the yield of subsequent packaging and preparation of lentiviral vectors. Compared with before the modification, the copy number of the lentiviral vector increased by 7-10 times, and the titer increased by 3-5 times. It also has wide adaptability and can be used to prepare lentiviral vectors carrying target genes of different species.

[0009] It can be understood that the core strategy of the present invention is to insert the human epidermal growth factor receptor 2 gene before the 5'LTR of the lentiviral transfer plasmid. In theory, similar effects can be achieved by modifying existing lentiviral transfer plasmids.

[0010] Preferably, the lentiviral transfer plasmid further contains a CMV promoter, a ZsGreen1 gene, a Luc2 gene and a WPRE gene.

[0011] Preferably, the nucleic acid sequence of the human epidermal growth factor receptor 2 gene includes the sequence described in SEQ ID NO.1.

[0012] Preferably, the 5'-3' order of the elements in the recombinant lentiviral transfer plasmid is human epidermal growth factor receptor 2 gene, 5'LTR, packaging signal coding sequence, CMV promoter, ZsGreen1 gene, Luc2 gene, WPRE gene and 3'LTR.

[0013] Preferably, the structural diagram of the recombinant lentiviral transfer plasmid is as follows Figure 2 shown.

[0014] In a second aspect, the present invention provides a method for constructing the recombinant lentiviral transfer plasmid described in the first aspect, the construction method comprising:

[0015] The human epidermal growth factor receptor 2 gene sequence was inserted upstream of the 5'LTR of the initial lentiviral transfer plasmid to obtain a recombinant lentiviral transfer plasmid.

[0016] Preferably, the construction method comprises:

[0017] The upstream of the 5'LTR of the initial lentiviral transfer plasmid is treated with a restriction endonuclease to obtain a plasmid fragment, and the human epidermal growth factor receptor 2 gene sequence is seamlessly cloned and ligated to the plasmid fragment to obtain a ligation product. The ligation product is transformed into host cells, screened and identified, and the correctly identified cells are cultured and plasmid purified to obtain the recombinant lentiviral transfer plasmid.

[0018] Preferably, the ligation comprises ligation under a Hieff Clone™ recombination reaction system.

[0019] In a third aspect, the present invention provides use of the recombinant lentiviral transfer plasmid described in the first aspect in preparing a lentiviral vector.

[0020] In a fourth aspect, the present invention provides a lentiviral packaging system, comprising a helper plasmid, an envelope expression plasmid, and the recombinant lentiviral transfer plasmid described in the first aspect.

[0021] Preferably, the helper plasmid contains gag gene, pol gene and rev gene, and the envelope expression plasmid contains viral structural protein encoding genes.

[0022] Preferably, the viral structural protein encoding gene includes a vesicular stomatitis virus glycoprotein gene, etc.

[0023] In a fifth aspect, the present invention provides a method for preparing a lentiviral vector, comprising: inserting a target gene into the recombinant lentiviral transfer plasmid described in the first aspect, then transfecting a host cell with a helper plasmid and an envelope expression plasmid, culturing the cells, and performing separation and purification to obtain a lentiviral vector carrying the target gene.

[0024] It is understandable that the target gene can be selected according to actual needs. For example, the present application exemplarily uses Human_yy1, Mouse_Zdhhc22 and Mouse_Ddx11 genes for construction.

[0025] Preferably, the host cell comprises HEK-293T cell.

[0026] Compared with the prior art, the present invention has at least the following beneficial effects:

[0027] The present invention designs and modifies a lentiviral transfer plasmid by inserting the human epidermal growth factor receptor 2 gene before the 5' LTR of the lentiviral transfer plasmid, which can effectively improve the yield of subsequent packaging and preparation of lentiviral vectors. Compared with before the modification, the copy number of the lentiviral vector increased by 7-10 times, and the titer increased by 3-5 times. It also has wide adaptability and can be used to prepare lentiviral vectors carrying target genes of different species, providing new ideas for optimizing lentiviral vector design and improving the expression efficiency of target genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the structure of the transfer plasmid PGMLV-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0029] Figure 2 Schematic diagram of the structure of the transfer plasmid PGMLV V2-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0030] Figure 3 This is the double enzyme digestion verification result of the transfer plasmid PGMLV V2-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0031] Figure 4 Schematic diagram of the structure of the transfer plasmid PGMLV-CMV-H_yy1-ZsGreen1-T2A-Luc-P2A-Puro.

[0032] Figure 5 This is the double enzyme digestion verification result of the transfer plasmid PGMLV-CMV-H_yy1-ZsGreen1-T2A-Luc-P2A-Puro.

[0033] Figure 6 Schematic diagram of the structure of the transfer plasmid PGMLV-CMV-Mouse_Zdhhc22-ZsGreen1-T2A-Luc-P2A-Puro.

[0034] Figure 7 This is the double enzyme digestion verification result of the transfer plasmid PGMLV-CMV-Mouse_Zdhhc22-ZsGreen1-T2A-Luc-P2A-Puro.

[0035] Figure 8 Schematic diagram of the structure of the transfer plasmid PGMLV-CMV-Mouse_Ddx11-ZsGreen1-T2A-Luc-P2A-Puro.

[0036] Figure 9 This is the double enzyme digestion verification result of the transfer plasmid PGMLV-CMV-Mouse_Ddx11-ZsGreen1-T2A-Luc-P2A-Puro.

[0037] Figure 10 Schematic diagram of the structure of the transfer plasmid PGMLV V2-CMV-H_yy1-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0038] Figure 11 This is the double enzyme digestion verification result of the transfer plasmid PGMLV V2-CMV-H_yy1-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0039] Figure 12 Schematic diagram of the structure of the transfer plasmid PGMLV V2-CMV-Mouse_Zdhhc22-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0040] Figure 13 This is the double enzyme digestion verification result of the transfer plasmid PGMLV V2-CMV-Mouse_Zdhhc22-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0041] Figure 14 Schematic diagram of the structure of the transfer plasmid PGMLV V2-CMV-Mouse_Ddx11-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0042] Figure 15 This is the double enzyme digestion verification result of the transfer plasmid PGMLV V2-CMV-Mouse_Ddx11-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE.

[0043] Figure 16 This is the fluorescence titer detection result. DETAILED DESCRIPTION

[0044] The technical solution of the present invention will be further described below with reference to the accompanying drawings and through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0045] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0046] Unless otherwise defined, scientific and technical terms and abbreviations used in conjunction with the present invention shall have the meanings commonly understood by ordinary technicians in the field to which the present invention belongs. Some of the terms and abbreviations used in the present invention are listed below.

[0047] Packaging signal: A specific RNA secondary structure domain (Ψ) that is recognized by the Gag protein and is a marker for the selective packaging of viral genomic RNA into viral particles.

[0048] CMV: Derived from the promoter of human cytomegalovirus.

[0049] MCS: Multiple Cloning Site, multiple cloning site.

[0050] T2A: Thosea asigna virus 2A peptide, a self-cleaving peptide sequence used to achieve automatic protein separation in multi-gene expression systems.

[0051] P2A: Porcine teschovirus-1 2A peptide, a self-cleaving peptide sequence from porcine tonsil virus, is widely used in multi-gene expression to achieve independent expression and functional maintenance of multiple proteins.

[0052] Puro: A gene encoding a puromycin-resistant enzyme, used to screen cells for successful expression in cell transfection experiments.

[0053] Example 1

[0054] This example constructs lentiviral transfer plasmid vectors and gene transfer plasmids of different species.

[0055] (1) Construction of lentiviral transfer plasmid vectors and gene transfer plasmids of different species

[0056] 1) Take the transfer plasmid (PGMLV-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE), whose nucleic acid sequence contains the ZsGreen1 gene (dark green fluorescent protein gene), the Luc2 gene (firefly luciferase gene), and the WPRE gene (post-transcriptional regulatory sequence), and digest the transfer plasmid with MluI enzyme;

[0057] The transfer plasmid PGMLV-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE was provided by Jiman Biotechnology (Shanghai) Co., Ltd. The structural diagram is shown in Figure 1 shown.

[0058] Amplify the plasmid: Culture the E. coli containing the transfer plasmid overnight. Take 4 mL of the cultured E. coli and extract it to obtain the target plasmid. For specific methods, refer to the instructions of the TIANGEN Plasmid Miniprep Kit.

[0059] MluI enzyme single digestion: Take 1 μg of transfer plasmid and digest it with MluI restriction enzyme at 37°C for about 3 hours to obtain the digestion product. The digestion system is 50 μL system (Table 1).

[0060] Table 1

[0061] Transfer plasmid 1 μg green Buffer 5μL MluI 4μL <![CDATA[ddH2O]]> Make up to 50 μL

[0062] Isolate the transfer plasmid fragment: Perform agarose gel electrophoresis on the digested product, then separate the gel strip containing the transfer plasmid. Calculate the gel strip volume based on 100 mg = 100 μL. Add 1 times the volume of the gel strip to the gel strip and incubate in a 65°C water bath. Completely melt the gel strip to obtain a blank vector fragment gel solution.

[0063] Transfer plasmid recovery: Transfer the entire gel solution of the transfer plasmid fragments to a filter cartridge placed in an EP tube and centrifuge at 13,000 rpm for 30 seconds (repeat this step). Centrifuge to dry, then add ddH₂O to obtain a transfer plasmid fragment solution. Discard the contents of the cartridge, add 500 μL of Wash Solution to the cartridge, and centrifuge at 13,000 rpm for 30 seconds. Discard the contents of the cartridge, add another 500 μL of Wash Solution to the cartridge, and centrifuge at 13,000 rpm for 30 seconds (repeat this step). Empty the cartridge for 3 minutes, place the cartridge in a new 1.5 mL EP tube, air dry at room temperature, add 35 μL of ddH₂O to the cartridge, let it sit for 5 minutes, and centrifuge at 13,000 rpm for 1.5 minutes. To improve recovery, add the dissolved DNA to the cartridge again and centrifuge for 1 minute. Discard the cartridge to obtain a transfer plasmid fragment solution and determine its concentration.

[0064] 2) Seamlessly clone the full-length sequence of human epidermal growth factor receptor 2 gene (V2) into the enzyme-cut transfer plasmid vector

[0065] The full-length sequence of the human epidermal growth factor receptor 2 gene was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.1;

[0066] SEQ ID NO.1:

[0067]

[0068] The concentrations of the transfer plasmid fragment solution and the target gene fragment solution were determined, and the transfer plasmid fragment solution and the target gene fragment solution were ligated in a Hieff Clone™ recombination reaction system. The ligation was carried out at 50° C. for 20 minutes in the Hieff Clone™ recombination reaction system to obtain a ligated plasmid. The Hieff Clone™ recombination reaction system is shown in Table 2.

[0069] Table 2

[0070] 5×CE Buffer 4μL Transfer plasmid fragment 200ng Target gene fragment 56ng Exnase 2μL <![CDATA[ddH2O]]> Make up to 20 μL

[0071] 3) Transformation, plating, and cloning of ligation products

[0072] Ligation product transformation bacterial solution: Place the E. coli competent cells on ice (4°C) and wait for them to thaw naturally. Then take 10 μL of the ligation product and add it to the E. coli competent cells and place it on ice (4°C) for 30 minutes. Then, heat shock it in a 42°C water bath for 90 seconds, and then quickly place it on ice (4°C) for 3 minutes to allow the ligation product to enter the E. coli competent cells to obtain cells to be screened.

[0073] Primary culture of bacterial liquid: Add the cells to be screened to 500 μL of SOC medium without antibiotics, and culture with shaking at 37°C and 225 rpm for 45 min to obtain the primary culture of bacterial liquid.

[0074] Resistance screening: Centrifuge the primary culture at 3000 rpm for 2 minutes, discard 900 μL of the supernatant, disperse the primary culture at the bottom of the tube by pipetting, add it to a SOC medium plate containing antibiotics, spread it evenly with a sterile applicator, and invert it in a 37°C constant temperature incubator for overnight culture to obtain the colonies to be tested. The antibiotic is the antibiotic corresponding to the resistance of the transfer plasmid.

[0075] Sequencing verification: After the colony to be tested is cultured overnight, 4 mL of the cultured E. coli liquid is taken and extracted to obtain the plasmid to be tested. For specific methods, please refer to the instructions of the TIANGEN plasmid extraction kit. The plasmid to be tested is sequenced, and the sequencing is completed by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results show that the inserted target gene fragment is the same as the sequence shown in SEQID NO.1, and it is determined to be a human epidermal growth factor receptor 2 gene recombinant vector. The newly constructed transfer plasmid is named PGMLV V2-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE, and the structural diagram is shown in the figure. Figure 2 shown.

[0076] The sequencing primer sequences are as follows:

[0077] 103905W1F-113162:CGGTGCTAGACAATGGAGACCC;

[0078] 103905W2F-113163:ACACGTTTGAGTCCATGCCC;

[0079] 103905W3F-113164:GGCGCCTACTCGCTGA;

[0080] 103905W4F-113165:GGTGTGAAAACCTGACCTCTCC;

[0081] 103905W5F-113166:ACGAAGCATACGTGATGGCT;

[0082] 103905W6F-113167: GGAAAAGGGGGAGCGG;

[0083] 103905W7F-113168:CCTCCCCACACATGACCC.

[0084] Double enzyme digestion verification: 1 μg of the plasmid to be tested was digested with Bsu15I and SpeI restriction enzymes at 37°C for approximately 3 hours to obtain the digestion product. The digestion system was 50 μL, as detailed in Table 3 below.

[0085] Table 3

[0086] Plasmid to be tested 1 μg green Buffer 5μL Bsu15I 2μL SpeI 2μL <![CDATA[ddH2O]]> Make up to 50 μL

[0087] The digested products were subjected to agarose gel electrophoresis. Figure 3 As shown, lane 1 is the product of Bsu15I single enzyme digestion, lane 2 is the product of SpeI single enzyme digestion, lane 3 is the product of Bsu15I and SpeI double enzyme digestion, and lane 4 is the original plasmid without endonuclease treatment. The results show that the plasmid length is correct, which is 10723bp+3076bp respectively. Double enzyme digestion verification further ensures the correctness of the insertion of the human epidermal growth factor receptor 2 gene transfer plasmid.

[0088] 4) Construction of transfer plasmids containing genes from different species

[0089] The PGMLV-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE and PGMLV V2-CMV-MCS-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE were digested with NotI enzyme and MluI enzyme to construct the vector. The detailed steps are the same as the enzyme digestion operation scheme in the above steps, except that the enzyme digestion reaction system is prepared differently, which will not be repeated here; the specific digestion reaction system is shown in Table 4 below.

[0090] Table 4

[0091]

[0092]

[0093] The three gene fragments, Human_yy1, Mouse_Zdhhc22, and Mouse_Ddx11, were ligated into two vectors by seamless cloning. The Human_yy1 gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.2. The Mouse_Zdhhc22 gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.3. The Mouse_Ddx11 gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.4.

[0094] SEQ ID NO.2:

[0095]

[0096] SEQ ID NO.3:

[0097] atgctggccttgcggctgctcaacgtggtagcccccgcctactttctttgcatttccctggtgaccttcgtactgcagctcttcctcttcctgcccagcatgcgtgaggaccccacagccaccccgctcttctcgcctgctgtgcttcacggggcgctcttcctgttcctctcagccaatgccctgggcaattacgtcctggtcatccagaactccccagacgacctgggcacctgccaggggaccatgtcccagagacctcagtgcccaccgcccagcacccacttctgccgagtgtgttcccgagtcacgctgaggcacgaccatcactgtttcttcaccggcaactgcatcggcagcagaaacatgcgcaacttcatcctgttctgcctctacacctctctggcctgcctttactccatggtggctggagtggcctacatctcagctgtcctttccatctccttcgcccaccccctggccttccttacgctcctgcccacttcaatcagccagttcttctccggagctgtcctcggttctgacatgttcgtcatcctcatgctctacctctggtttgctgtcggcctggcctgcgccggtttctgctgccaccaactgctgttgatcctccgggggcaaacccgctaccaggttcgaaaggggatggctgtaagagcccgaccctggcgcaagaacttacaggaggtcttcggaaagaggtggctgcttggcttgctggtacccatgttcaatgtcggcaccgaaagctcgaagcagcaggacaaa。

[0098] SEQ ID NO.4:

[0099]

[0100] The operation schemes for seamless cloning and ligation, reaction product transformation, plating, and clone identification refer to the above steps and are not repeated here; 6 new transfer plasmids were constructed.

[0101] PGMLV-CMV-H_yy1-ZsGreen1-T2A-Luc-P2A-Puro, structure as Figure 4 As shown; Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd., and the sequencing results showed that the inserted target gene fragment was identical to the sequence shown in SEQ ID NO. 2; the sequencing primer sequences are as follows: 104665W1F-114890: GACGGCTTCGAGGATCAGA; 104665W2F-114891: GAACAATAGCTTG CCCTCATAAAGG. Double enzyme digestion verification: 1 μg of the test plasmid was double digested with two restriction enzymes, BamHI and SpeI. The digestion products were subjected to agarose gel electrophoresis. The results are shown as follows Figure 5 As shown, lane 1 is the product of BamHI single enzyme digestion, lane 2 is the product of SpeI single enzyme digestion, lane 3 is the product of BamHI and SpeI double enzyme digestion, lane 4 is the original plasmid without endonuclease treatment, and the length of the connected plasmid is correct, which is 8805bp+2409bp respectively.

[0102] PGMLV-CMV-Mouse_Zdhhc22-ZsGreen1-T2A-Luc-P2A-Puro, structure as Figure 6 As shown; Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd., and the sequencing results showed that the inserted target gene fragment was identical to the sequence shown in SEQ ID NO.3; the sequencing primer sequences were as follows: 105113W1F-115783: CATCGGCAGCAGAAACATG, double enzyme digestion verification: 1 μg of the test plasmid was double digested with two restriction enzymes, BamHI and SpeI, and the digestion products were subjected to agarose gel electrophoresis. The results were as shown Figure 7 As shown, lane 1 is the product of BamHI single enzyme digestion, lane 2 is the product of SpeI single enzyme digestion, lane 3 is the product of BamHI and SpeI double enzyme digestion, lane 4 is the original plasmid without endonuclease treatment, and the length of the connected plasmid is correct, which is 8352bp+2409bp respectively.

[0103] PGMLV-CMV-Mouse_Ddx11-ZsGreen1-T2A-Luc-P2A-Puro, structure as Figure 8As shown; Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd., and the sequencing results showed that the inserted target gene fragment was identical to the sequence shown in SEQ ID NO.4; the sequencing primer sequences were as follows: 105114W1F-115787: GACCTGGTGGAGAGGCTAAGG; 105114W1R-115789: AATAAGGGGCAAGATGTTGTCTG; 105114W2F-115788: AGCCGATGTCTGACTTTCGG; 105114W2R-115790: GATGTTGTCCACCTGGCTCT; Double enzyme digestion verification: 1 μg of the test plasmid was double digested with EcoRI and SpeI restriction enzymes, and the digestion products were subjected to agarose gel electrophoresis. The results are shown in FIG. Figure 9 As shown, lane 1 is the EcoRI single enzyme digestion product, lane 2 is the SpeI single enzyme digestion product, lane 3 is the EcoRI and SpeI double enzyme digestion product, lane 4 is the original plasmid without endonuclease treatment, and the length of the ligated plasmid is correct, which is 9573bp+3117bp respectively.

[0104] PGMLV V2-CMV-H_yy1-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE, structure as Figure 10 As shown; Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd., and the sequencing results showed that the inserted target gene fragment was identical to the sequence shown in SEQ ID NO.2; the sequencing primer sequences were as follows: 104665W1F-114890: GACGGCTTCGAGGATCAGA; 104665W2F-114891: GAACAATAGCTTGCCCTCATAAAGG; double enzyme digestion verification: 1 μg of the test plasmid was double digested with NotI and NheI restriction enzymes, and the digestion products were subjected to agarose gel electrophoresis. The results are shown as follows Figure 11 As shown, lane 1 is the product of NotI single digestion, lane 2 is the product of NheI single digestion, lane 3 is the product of NotI and NheI double digestion, lane 4 is the original plasmid without endonuclease treatment, and the length of the connected plasmid is correct, which is 9654bp+5340bp respectively.

[0105] PGMLV V2-CMV-Mouse_Zdhhc22-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE, structure as Figure 12As shown; Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd., and the sequencing results showed that the inserted target gene fragment was identical to the sequence shown in SEQ ID NO.3; the sequencing primer sequences were as follows: 105113W1F-115783: CATCGGCAGCAGAAACATG; Double enzyme digestion verification: 1 μg of the test plasmid was double digested with two restriction endonucleases, Bsu15I and SpeI, and the digestion products were subjected to agarose gel electrophoresis. The results are shown as follows Figure 13 As shown, lane 1 is the product of Bsu15I single digestion, lane 2 is the product of SpeI single digestion, lane 3 is the product of Bsu15I and SpeI double digestion, lane 4 is the original plasmid without endonuclease treatment, and the length of the ligated plasmid is correct, which is 10723bp+3818bp respectively.

[0106] PGMLV V2-CMV-Mouse_Ddx11-ZsGreen1-T2A-Luc2-P2A-Puro-WPRE, structure as Figure 14 As shown; Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd., and the sequencing results showed that the inserted target gene fragment was identical to the sequence shown in SEQ ID NO.4; the sequencing primer sequences were as follows: 105114W1F-115787: GACCTGGTGGAGAGGCTAAGG; 105114W1R-115789: AATAAGGGGCAAGATGTTGTCTG; 105114W2F-115788: AGCCGATGTCTGACTTTCGG; 105114W2R-115790: GATGTTGTCCACCTGGCTCT; Double enzyme digestion verification: 1 μg of the test plasmid was double digested with two restriction endonucleases, Bsu15I and SpeI, and the digestion products were subjected to agarose gel electrophoresis. The results are shown as follows Figure 15 As shown, lane 1 is the product of Bsu15I single enzyme digestion, lane 2 is the product of SpeI single enzyme digestion, lane 3 is the product of Bsu15I and SpeI double enzyme digestion, lane 4 is the original plasmid without endonuclease treatment, and the length of the ligated plasmid is correct, which is 10723bp+5747bp respectively.

[0107] Example 2

[0108] The six transfer plasmids constructed in Example 1 were used to package pseudoviruses in HEK-293T cells to obtain pseudovirus particles.

[0109] (1) One day before transfection, the grown cells were passaged into 10 cm culture dishes at an appropriate ratio. The status of HEK-293T cells was observed under a microscope to ensure that the cells were in good condition, had a density of 80%, and were free of contamination.

[0110] (2) Replace each cell dish with 10 mL of DMEM medium containing 2% FBS.

[0111] (3) Prepare the transfection system: Take a sterile 15 mL centrifuge tube. The transfection system is shown in Table 5 below. After mixing, let it stand at room temperature for 15-20 minutes.

[0112] Table 5

[0113]

[0114] (4) Add the transfection system dropwise to the cell culture dish, keep the dish level, shake the dish so that the transfection complex is evenly distributed on the cell surface, and then place it in a CO2 incubator for culture.

[0115] (5) After 10-12 hours of transfection, evenly add 100× Enhancing buffer (100 μL / dish) to promote transfection.

[0116] (6) 18-20 hours after transfection, change the medium: Carefully aspirate the cell culture medium and discard it in a waste liquid cup containing disinfectant, then wash the virus-packaged dish twice with 10 mL of PBS, and add 12 mL of phenol red-free culture medium (1% phenol red-free culture medium containing 2 mM MgCl2 + a final concentration of 100 U / mL universal nuclease, filtered with a 0.22 μm filter to ensure sterility) and continue culturing.

[0117] (7) After 48 hours of liquid replacement, collect the cell supernatant and extract the corresponding pseudovirus particles in the supernatant; observe the cell state and fluorescence under a microscope, collect the lentiviral supernatant in a 50mL centrifuge tube, add a final concentration of 50U / mL universal nuclease, filter it with a 0.22μm filter and transfer it to a new centrifuge tube. Preheat it in a 37℃ water bath for 3 hours. Shake the centrifuge tube every 1 hour to mix the supernatant. Prepare a flat-rotating tube and add the virus supernatant to the flat-rotating tube with a pipette. If the liquid cannot fill the flat-rotating tube, it can be supplemented with PBS. Place the flat-rotating tube containing the virus supernatant into the corresponding flat-rotating rotor, tighten it, and balance the corresponding tube. The balancing tube is balanced with three-free DM. The mass difference is less than 0.2g, and the ID number is clearly marked on the side wall of the tube. Gently remove the swinging rotor containing the supernatant and place it in an ultracentrifuge (set the centrifugal force to 100,000g, time to 3 hours, temperature to 4°C). After centrifugation, remove the rotor from the ultracentrifuge, slowly unscrew the swinging rotor lid, and gently remove the swinging tube with tweezers without shaking. Slowly and gently discard the supernatant and all liquid at the bottom. Invert the centrifuge tube on absorbent paper and gently drain. Add 1 mL of PBS to the swinging tube and pipette up and down the tube for about ten times to collect the virus solution into the centrifuge tube. Wash the tube multiple times with 1 mL of PBS as described above. Collect the PBS from each wash into a 50 mL centrifuge tube. Make up the remaining volume with PBS and mix thoroughly.

[0118] The viruses packaged using the six transfer plasmids were named: H_yy1 Pseudovirus V1 (corresponding to the transfer plasmid with only the Human_yy1 gene inserted), Mouse_Zdhhc22 Pseudovirus V1 (corresponding to the transfer plasmid with only the Mouse_Zdhhc22 gene inserted), Mouse_Ddx11 Pseudovirus V1 (corresponding to the transfer plasmid with only the Mouse_Ddx11 gene inserted), H_yy1 Pseudovirus V2 (corresponding to the transfer plasmid with both the Human_yy1 gene and the human epidermal growth factor receptor 2 gene inserted), Mouse_Zdhhc22Pseudovirus V2 (corresponding to the transfer plasmid with both the Mouse_Zdhhc22 gene and the human epidermal growth factor receptor 2 gene inserted), and Mouse_Ddx11 Pseudovirus V2 (corresponding to the transfer plasmid with both the Mouse_Ddx11 gene and the human epidermal growth factor receptor 2 gene inserted).

[0119] Example 3

[0120] The copy number and titer of the prepared pseudovirus were detected.

[0121] (1) Pseudovirus copy number detection: RNA from the prepared pseudovirus was extracted using the TIANamp Virus RNAKit viral RNA extraction kit (TIANGEN). The extraction experiment was performed according to the kit instructions. qPCR detection was performed using the qPCR SYBR Green Master Mix (Low Rox Plus) (YEASEN) kit according to the kit instructions. The WPRE standard plasmid was constructed and serially diluted. The viral copy number was calculated by detecting the WPRE gene copy number in the collected pseudovirus. The WPRE primer and probe sequences used were as follows: F: CGCTATGTGGATACGCTGCTTTA; R: GCAACCAGGATTTATACAAGGAGGA; T: FAM-CTTTGTATCATGCTATTGCTTCCCG-BHQ1. The results of virus production detection are shown in Table 6 below.

[0122] Table 6

[0123] Pseudovirus Copy number / mL H_yy1 Pseudovirus V1 1.64E+9 H_yy1 Pseudovirus V2 1.38E+10 Mouse_Zdhhc22Pseudovirus V1 2.43E+9 Mouse_Zdhhc22Pseudovirus V2 2.25E+10 Mouse_Ddx11Pseudovirus V1 7.29E+8 Mouse_Ddx11Pseudovirus V2 5.86E+9

[0124] The results showed that after the transformation of the transfer plasmid, the copy number of H_yy1 Pseudovirus V2 increased by 8.4 times compared with H_yy1 Pseudovirus V1; the copy number of Mouse_Zdhhc22 Pseudovirus V2 increased by 9.3 times compared with Mouse_Zdhhc22 PseudovirusV1; and the copy number of Mouse_Ddx11 Pseudovirus V2 increased by 8.0 times compared with Mouse_Ddx11 Pseudovirus V1.

[0125] (2) Fluorescence detection of infected HEK-293T cells

[0126] 1) HEK-293T cells were cultured to the logarithmic growth phase, and the culture medium used for virus dilution was cell culture medium containing 10% FBS.

[0127] 2) On the first day, cells were trypsinized and counted, and then 8,000 cells were seeded into each well of a 96-well plate. The cells were cultured at 37°C overnight. The cells were grown to a confluence density of 30-50% at the time of infection.

[0128] 3) The next day, at the time of infection, the virus solution stored in a -80°C refrigerator was thawed in an ice bath and serially diluted with cell culture medium containing 10% FBS (culture medium: polybrene = 1000:1):

[0129] Dilution No. 1: 12 μL virus solution + 108 μL virus dilution medium;

[0130] Dilution No. 2: 12 μL dilution No. 1 + 108 μL virus dilution medium;

[0131] Dilution No. 3: 12 μL dilution No. 2 + 108 μL virus dilution medium;

[0132] Dilution No. 4: 12 μL dilution No. 3 + 108 μL virus dilution medium;

[0133] Dilution No. 5: 12 μL of dilution No. 4 + 108 μL of virus dilution medium.

[0134] 4) Select the desired cell wells, aspirate and discard the culture medium, gently mix each tube of lentiviral dilution, take 100 μL and add it to each well of cells, and culture in a 37°C cell culture incubator overnight.

[0135] 5) On the third day, remove the culture medium containing the lentivirus and add 100 μL of complete culture medium.

[0136] 6) On the sixth day, the number of fluorescent cells (no contamination) in the seventh well was observed under a fluorescence microscope. The virus titer was the number of cells expressing fluorescence multiplied by 1E+8. The number of fluorescent cells in each well was observed under a fluorescence microscope (e.g. Figure 16 The details of virus titer detection are shown in Table 7 below.

[0137] Table 7

[0138] Packaged viruses TU / mL H_yy1 Pseudovirus V1 3E+8 H_yy1 Pseudovirus V2 1.3E+9 Mouse_Zdhhc22Pseudovirus V1 5E+8 Mouse_Zdhhc22Pseudovirus V2 2.4E+9 Mouse_Ddx11Pseudovirus V1 2E+8 Mouse_Ddx11Pseudovirus V2 9E+8

[0139] The results showed that after the transformation and transfer plasmid, the titer of H_yy1 Pseudovirus V2 increased by 4.3 times compared with H_yy1 Pseudovirus V1; the titer of Mouse_Zdhhc22 Pseudovirus V2 increased by 4.8 times compared with Mouse_Zdhhc22 Pseudovirus V1; and the titer of Mouse_Ddx11 Pseudovirus V2 increased by 4.5 times compared with Mouse_Ddx11 Pseudovirus V1.

[0140] In summary, the present invention modifies the lentiviral transfer plasmid by inserting the human epidermal growth factor receptor 2 gene upstream of the 5' LTR of the transfer plasmid. Using the modified transfer plasmid for lentiviral packaging can increase the virus yield. This design ensures that the human epidermal growth factor receptor 2 gene is not transcribed into the lentivirus and does not affect the viral packaging of the target gene. This provides valuable ideas for optimizing lentiviral vector design and improving the expression efficiency of target genes.

[0141] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. A recombinant lentiviral transfer plasmid, characterized in that: The recombinant lentiviral transfer plasmid contains a 5'LTR, a packaging signal coding sequence, a human epidermal growth factor receptor 2 gene and a 3'LTR, wherein the human epidermal growth factor receptor 2 gene is located upstream of the 5'LTR.

2. The recombinant lentiviral transfer plasmid according to claim 1, characterized in that The lentiviral transfer plasmid also contains a CMV promoter, a ZsGreen1 gene, a Luc2 gene and a WPRE gene.

3. The recombinant lentiviral transfer plasmid according to claim 1 or 2, characterized in that The nucleic acid sequence of the human epidermal growth factor receptor 2 gene includes the sequence described in SEQ ID NO.

1.

4. The recombinant lentiviral transfer plasmid according to any one of claims 1 to 3, characterized in that The 5'-3' sequence of the elements in the recombinant lentiviral transfer plasmid is human epidermal growth factor receptor 2 gene, 5'LTR, packaging signal coding sequence, CMV promoter, ZsGreen1 gene, Luc2 gene, WPRE gene and 3'LTR.

5. The method for constructing the recombinant lentiviral transfer plasmid according to any one of claims 1 to 4, characterized in that: The construction method comprises: The human epidermal growth factor receptor 2 gene sequence was inserted upstream of the 5'LTR of the initial lentiviral transfer plasmid to obtain a recombinant lentiviral transfer plasmid.

6. The method for constructing a recombinant lentiviral transfer plasmid according to claim 5, characterized in that: The construction method comprises: The upstream of the 5'LTR of the initial lentiviral transfer plasmid is treated with a restriction endonuclease to obtain a plasmid fragment, and the human epidermal growth factor receptor 2 gene sequence is seamlessly cloned and ligated to the plasmid fragment to obtain a ligation product. The ligation product is transformed into host cells, screened and identified, and the correctly identified cells are cultured and plasmid purified to obtain the recombinant lentiviral transfer plasmid.

7. Use of the recombinant lentiviral transfer plasmid according to any one of claims 1 to 4 in the preparation of a lentiviral vector.

8. A lentiviral packaging system, characterized in that: The lentiviral packaging system comprises a helper plasmid, an envelope expression plasmid and the recombinant lentiviral transfer plasmid according to any one of claims 1 to 4.

9. The lentiviral packaging system according to claim 8, characterized in that The auxiliary plasmid contains gag gene, pol gene and rev gene, and the envelope expression plasmid contains viral structural protein encoding gene; Preferably, the viral structural protein encoding gene includes a vesicular stomatitis virus glycoprotein gene.

10. A method for preparing a lentiviral vector, characterized in that: The method comprises: inserting a target gene into the recombinant lentiviral transfer plasmid according to any one of claims 1 to 4, then transfecting a host cell with a helper plasmid and an envelope expression plasmid, culturing the cells, and performing separation and purification to obtain a lentiviral vector carrying the target gene.

Images