Non-competitive detection method based on aptamer allosteric activation CRISPR / Cas and application

By allosterically activating the CRISPR/Cas system through aptamers and utilizing cascade reactions to activate the CRISPR/Cas system, the design difficulties of the CRISPR/Cas system in non-nucleic acid target detection were solved, and highly sensitive and rapid ATP detection was achieved, which was applied to meat freshness evaluation.

CN120683231APending Publication Date: 2025-09-23UNIV OF SHANGHAI FOR SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510815046.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-18
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

The existing CRISPR/Cas system relies on competitive binding of nucleic acid aptamers in non-nucleic acid target detection. The design requirements are strict and it is difficult to achieve both low background signal and efficient recognition. In addition, traditional microbial detection methods are time-consuming and labor-intensive.

Method used

Aptamers are used to allosterically activate the CRISPR/Cas system. By designing a cascade reaction, the conformational changes during the aptamer's target recognition process are converted into a toehold-mediated chain displacement reaction to activate the CRISPR/Cas system, avoid competitive binding, and achieve non-competitive detection.

Benefits of technology

It achieves highly sensitive and rapid ATP detection, simplifies the detection process, and can evaluate the freshness of meat within 45 minutes, avoiding the long detection cycle of traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683231A_ABST
    Figure CN120683231A_ABST
Patent Text Reader

Abstract

The invention discloses a non-competitive detection method based on aptamer allosteric activation CRISPR / Cas and application, and belongs to the technical field of biosensing. The detection method solves the problems that in a CRISPR / Cas detection system based on the nucleic acid aptamer in a competitive mode, the design requirement for partial complementary chains of the nucleic acid aptamer is high, and multiple requirements of low background signals, efficient target recognition and effective activation of the CRISPR / Cas system are difficult to consider. According to the detection method, the conformational change in the process that the aptamer recognizes the target is converted into the dynamic difference of the footrest-mediated strand displacement reaction, and the cascade footrest-mediated strand displacement reaction is designed to activate the CRISPR / Cas system. The detection method realizes high-sensitivity, simple, convenient and rapid ATP detection, and is applied to freshness evaluation of pork, beef and mutton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a non-competitive detection method and application of aptamer allosteric activation of CRISPR / Cas, belonging to the field of biosensor technology. Background Art

[0002] The emerging CRISPR / Cas system, comprised of clustered regularly interspaced short palindromic repeats (CRISPR) and its associated proteins (Cas proteins), holds great promise for biosensing due to its exceptionally specific recognition capabilities and highly sensitive trans-cleavage activity. Since the CRISPR / Cas system can only be activated by nucleic acids, a strategy that leverages the specific recognition capabilities of aptamers (aptamers) to convert non-nucleic acid target recognition into a nucleic acid signal that activates the trans-cleavage activity of the CRISPR / Cas system has been widely adopted to detect non-nucleic acid targets. However, this aptamer-based signal conversion approach often relies on competitive binding between the aptamer and the target. This competitive mechanism places high demands on the sequence design of the partially complementary strand to the aptamer, making it difficult to achieve the multiple requirements of low background signal, efficient target recognition, and effective CRISPR / Cas system activation. While immobilizing the aptamer on a support and employing a separation strategy can reduce the design complexity of the partially complementary strand, challenges remain regarding aptamer interface modification and recognition.

[0003] Fresh meat, as an important animal-derived nutrient matrix, is considered one of the most perishable foods due to its susceptibility to microbial proliferation and deterioration during storage and distribution. The gold standard plate count method for detecting microorganisms typically has a long measurement cycle and is time-consuming and labor-intensive. Adenosine triphosphate (ATP), an energy source maintained at a relatively constant level in living cells, can reflect the number of viable microbial cells. Numerous studies have shown a significant positive correlation between ATP content and the level of microbial contamination in food. Summary of the Invention

[0004] In order to solve the above problems, the present invention provides a non-competitive detection method and application based on aptamer allosteric activation of CRISPR / Cas.

[0005] The present invention provides a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas and its application adopts the following technical solutions: In one aspect, the present invention provides a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas, which converts the conformational changes of the aptamer during target recognition into kinetic differences in the toehold-mediated strand displacement reaction. The CRISPR / Cas system is activated by designing a cascade toehold-mediated strand displacement reaction, comprising the following steps: Step 1): The complementary chain and the activation chain were added to a Tris-HCl buffer solution (20mM Tris, 100mM NaCl and 5mM MgCl2, pH=7.5) in a molar ratio (1-3):1 and mixed evenly. The mixture was annealed at 95°C for 5 minutes, then slowly cooled at room temperature to form a double chain. The resulting double chain was stored at 4°C. 1µM of the aptamer chain was annealed at 95°C for 5 minutes, slowly cooled to room temperature, and stored at 4°C. Step 2): CRISPR RNA (crRNA) and LbCas12a were added to NEBuffer r2.11× buffer solution at a molar ratio of 1:(1-2) and mixed evenly, then incubated at 25°C for 15-20 minutes to form a Cas12a / crRNA complex, which was then stored at 4°C; Step 3): The double-stranded DNA prepared in step 1), the aptamer chain, the Cas12a / crRNA complex prepared in step 2), and the single-stranded DNA substrate (ssDNA-FQ) simultaneously labeled with the fluorescent group FAM and the fluorescent quencher group BHQ1 were mixed at a molar ratio of 7: (6-14): (1-8): 40, and different concentrations of ATP were added to make a total volume of 100 µL, reacted at 37 ° C for 45 minutes, and then placed at 65 ° C for 10 minutes to inactivate Cas12a. Finally, the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm to obtain a linear relationship between the lg value of ATP concentration and the fluorescence intensity. Step 4): According to the linear relationship between the lg value of the ATP concentration obtained in step 3) and the fluorescence intensity and the fluorescence intensity of the sample to be tested, the concentration of ATP in the sample to be tested is obtained.

[0006] Another aspect of the present invention provides an application of a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas for evaluating the freshness of pork, beef, and mutton, comprising the following steps: Step 1): Place 5g of pork, beef or mutton in a sterile bag and homogenize for 3 minutes, add it to 10ml of 5% trichloroacetic acid solution, vortex for 3 minutes, centrifuge at 4℃ for 20 minutes, remove the supernatant, filter it with a 0.22μm microporous membrane, and finally store the filtered supernatant at -20℃; Step 2): The filtered supernatant obtained in step 1) is adjusted to pH 7.5 with a Tris base solution, and diluted 10 times with a Tris-HCl buffer solution to obtain a dilution of the supernatant; Step 3): The prepared double-stranded protein, aptamer chain, Cas12a / crRNA complex and ssDNA-FQ were mixed at a molar ratio of 7: (6-14): (1-8): 40, and 10 μL of the dilution of the supernatant obtained in step 2) was added to make a total volume of 100 μL, reacted at 37 ° C for 45 minutes, and then placed at 65 ° C for 10 minutes to inactivate Cas12a. Finally, the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. According to the linear relationship between the lg value of the ATP concentration obtained above and the fluorescence intensity, the ATP concentration in pork, beef or mutton was calculated; Step 4): Using the total colony count (TVC) to evaluate the freshness of meat is used as an indicator to obtain the corresponding ATP concentration in pork, beef or mutton, which is used to evaluate the freshness of pork, beef or mutton.

[0007] Compared with the prior art, the present invention has the following beneficial effects: 1. It avoids the stringent requirement of designing partial complementary chains with aptamers in the CRISPR / Cas detection method based on nucleic acid aptamers in the competitive mode.

[0008] 2. The coupling of two-stage chain displacement reactions avoids background signals generated by overlapping activation chain sequences and achieves high-sensitivity rapid detection in homogeneous solutions.

[0009] 3. Compared with the traditional freshness evaluation method based on total viable count (TVC) which takes 1-2 days, this method only takes 45 minutes, enabling rapid meat freshness evaluation. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Schematic diagram of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas in the present invention.

[0011] Figure 2 This is a real-time fluorescence profile of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas in the present invention: Cas12a / crRNA and double-stranded; Cas12a / crRNA and aptamer chain; Cas12a / crRNA, double-stranded and aptamer chain; Cas12a / crRNA, double-stranded, aptamer chain and 20µM ATP.

[0012] Figure 3 This is the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas in Examples 1-4 of the present invention: (A) Real-time fluorescence graph under different ATP concentration conditions; (B) ATP linearity; (C) ATP selectivity; (D) Daytime and intraday experiments.

[0013] Figure 4To evaluate the freshness of pork, beef, and mutton in Examples 5 and 6 of the present invention: (A) The TVC method was used to evaluate the freshness of pork, and the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas was applied to the freshness evaluation of pork; (B) The TVC method was used to evaluate the freshness of beef, and the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas was applied to the freshness evaluation of beef; (C) The TVC method was used to evaluate the freshness of mutton, and the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas was applied to the freshness evaluation of mutton. DETAILED DESCRIPTION

[0014] To make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0015] Figure 1 Figure 1 shows a schematic diagram of the present invention's non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas. After the aptamer chain recognizes the target, it promotes hybridization of the short stem portion within the chain, closing the distance between the toehold domain and the displacement strand domain, accelerating the strand displacement reaction mediated by toehold 1. During the strand displacement reaction, strand migration drives the exposure of toehold 2, which then undergoes a secondary strand displacement reaction within the Cas protein / crRNA complex and binds to the activation strand, ultimately activating the trans-cleavage activity of CRISPR Cas12a. In contrast, in aptamer chains that are not bound to the target, the toehold domain and displacement strand domain are further apart, resulting in a slower strand displacement reaction mediated by toehold 1 and inability to rapidly activate the trans-cleavage activity of CRISPR Cas12a. The present invention converts the conformational changes during aptamer recognition into kinetic differences in the toehold-mediated strand displacement reaction, thereby activating the CRISPR / Cas system by designing a cascade of toehold-mediated strand displacement reactions. This detection method achieves highly sensitive, simple, and rapid ATP detection and has been applied to evaluate the freshness of pork, beef, and lamb.

[0016] Example 1 The present invention provides a real-time fluorescence spectrum detection method based on a non-competitive detection method of aptamer allosteric activation of CRISPR / Cas: Step 1): 1µM of the aptamer chain shown in SEQ ID NO.1 (GTCCATCAATCTCTTTCTTGGGGGAGTATTGCGGAGGAAAGTTGCCATAGCCAGTAGTCTC) was annealed at 95°C for 5 minutes, slowly cooled to room temperature, and stored at 4°C; the complementary chain shown in SEQ ID NO.3 (CCGATGACCTGGAGACTACTGGCTATGGCTTAGAGATTGATGGAC) and the activation chain shown in SEQ ID NO.2 (CCATAGCCAGTAGTCTCCAGGTCATCGG) were added to a Tris-HCl buffer solution (20mM Tris, 100mM NaCl and 5mM MgCl2, pH=7.5) at a molar ratio of (1-3):1, mixed evenly, annealed at 95°C for 5 minutes, and then slowly cooled at room temperature to form a double chain, and the obtained double chain was stored at 4°C; Step 2): The crRNA shown in SEQ ID NO.4 (UAAUUUCUACUAAGUGUAGAUCCGAUGACCUGGAGACUACU) and LbCas12a were added to NEBuffer r2.1 1× buffer solution at a molar ratio of 1: (1-2) and mixed evenly, and then incubated at 25°C for 15-20 minutes to form a Cas12a / crRNA complex, which was then stored at 4°C; Step 3): The double-stranded DNA prepared in step 1), the aptamer chain, the Cas12a / crRNA complex prepared in step 2), and the ssDNA-FQ (FAM-ACACACAC-BHQ1) simultaneously labeled with the fluorescent group FAM and the fluorescent quencher group BHQ1 were mixed at a molar ratio of 7: (6-14): (1-8): 40, and different concentrations of ATP were added to make a total volume of 100 µL. At 37 ° C, a multifunctional microplate reader was used to record the fluorescence intensity of the solution every 3 minutes under the conditions of an excitation wavelength of 480 nm and an emission wavelength of 520 nm.

[0017] Figure 2 The real-time fluorescence spectrum of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas is shown, indicating that the addition of ATP increases the rate of strand displacement, thereby further increasing the Cas12a trans-cleavage rate.

[0018] Figure 3 A shows a real-time fluorescence graph of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas under different ATP concentration conditions, showing that the fluorescence intensity FI generated by Cas12a cutting ssDNA-FQ gradually increases with the increase of ATP concentration in the range of 0nM-400µM.

[0019] Example 2 The present invention provides a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas, which has a linear relationship: The steps are the same as those described in Example 1, except that: in step 3), the double strand, the adaptor chain, the Cas12a / crRNA complex and the ssDNA-FQ are mixed at a molar ratio of 7: (6-14): (1-8): 40, and different concentrations of ATP are added to make a total volume of 100 μL, and the reaction is carried out at 37 ° C for 45 min, and then placed at 65 ° C for 10 min to inactivate Cas12a. Finally, the fluorescence intensity of the solution is measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm to obtain a linear relationship between the lg value of the ATP concentration and the fluorescence intensity.

[0020] Figure 3 The linear relationship between the lg value of ATP concentration and the FI value of the non-competitive detection method based on aptamer recognition and allosteric activation of CRISPR / Cas shown in B is FI=84097.49lg[ATP]+521802.72, and the linear correlation coefficient is R 2 =0.993, and the linear range of ATP concentration detection was 2nM-200µM.

[0021] Example 3 The present invention provides a non-competitive detection method for ATP selectivity based on aptamer allosteric activation of CRISPR / Cas: The steps are the same as those described in Example 1, except that: in step 3), the double strand, the adaptor strand, the Cas12a / crRNA complex, and the ssDNA-FQ are mixed at a molar ratio of 7: (6-14): (1-8): 40, and 10 μL of 2mM UTP, 2mM CTP, 2mM GTP, 2mM dTTP, 2mM dCTP, 2mM dGTP, 2mM dATP, 2mM ADP, 2mM AMP, 200μM ATP or a mixture containing all of the above nucleotides are added respectively, and 10μL Tris-HCl buffer solution is used as a blank control group, the total volume is 100μL, the reaction is carried out at 37°C for 45min, and then Cas12a is inactivated at 65°C for 10min, and the fluorescence intensity of the solution is measured using a multifunctional microplate reader at an excitation wavelength of 480nm and an emission wavelength of 520nm.

[0022] Figure 3 Figure C shows the ATP selectivity of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas, which shows that the detection method has good ATP selectivity.

[0023] Example 4 The present invention provides a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas for intra-day and inter-day experiments: (1) Intraday experiment Three experiments were performed at three different time periods during the day, with the same steps as described in Example 1, except that in step 3), the double-stranded DNA, aptamer chain, Cas12a / crRNA complex, and ssDNA-FQ were mixed at a molar ratio of 7:(6-14):(1-8):40, and 10 µL of 200 µM ATP or Tris-HCl buffer solution was added to a total volume of 100 µL. The reaction was carried out at 37 ° C for 45 min, and then placed at 65 ° C for 10 min to inactivate Cas12a. Finally, the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm.

[0024] (2) Daytime experiment Three experiments were performed over three days, following the same steps as described in Example 1, except that in step 3), the double-stranded DNA, aptamer chain, Cas12a / crRNA complex, and ssDNA-FQ were mixed at a molar ratio of 7:(6-14):(1-8):40, and 10 µL of 200 µM ATP or Tris-HCl buffer solution was added to a total volume of 100 µL. The reaction was carried out at 37 ° C for 45 min, and then placed at 65 ° C for 10 min to inactivate Cas12a. Finally, the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm.

[0025] Figure 3 D shows the inter-day and intra-day experiments of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas, which demonstrates the good reproducibility of this detection method.

[0026] Example 5 The TVC method for evaluating the freshness of pork, beef, and mutton includes the following steps: (1) Pretreatment of pork, beef and mutton: 10 g of pork, beef, or mutton that had been stored for different periods of time was placed in a sterile bag and added with 90 ml of 0.9% sterile saline and homogenized for 3 minutes to extract microorganisms; (2) TVC method for evaluating the freshness of pork, beef and mutton: The extract solution was serially diluted with 0.9% sterile saline (volume ratio 1:10), 0.1 mL of the dilution was spread on an agar plate, and the plate was incubated at 37 °C for 48 h before colony counting. The results were expressed as 1 g CFU / g.

[0027] Example 6 The present invention provides an application of a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas for evaluating the freshness of pork, beef, and mutton, comprising the following steps: Step 1) Pre-processing of pork, beef and lamb: Take 5 g of pork, beef or mutton that has been stored for different periods of time and place it in a sterile bag for homogenization for 3 minutes. Then add it to 10 ml of 5% trichloroacetic acid solution, vortex for 3 minutes, centrifuge at 4°C for 20 minutes, remove the supernatant, filter it with a 0.22 μm microporous membrane, and store it at -20°C. Step 2) Pretreatment of the filtered supernatant: The filtered supernatant obtained in step 1) is adjusted to pH 7.5 with a Tris base solution, and diluted 10-fold with a Tris-HCl buffer solution to obtain a dilution of the supernatant; Step 3) Calculate the ATP concentration in pork, beef, or lamb: The double-stranded, aptamer chain, Cas12a / crRNA complex, and ssDNA-FQ prepared in Example 1 were mixed in a molar ratio of 7:(6-14):(1-8):40, and 10 μL of supernatant was added to a total volume of 100 μL. The reaction was carried out at 37 ° C. for 45 min, and then placed at 65 ° C. for 10 min to inactivate Cas12a. Finally, the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. The ATP concentration in pork, beef or mutton was calculated based on the linear relationship between the lg value of the ATP concentration obtained in Example 2 and the fluorescence intensity. Step 4) Evaluate the freshness of pork, beef and lamb: The total colony count (TVC) is used as an indicator to evaluate the freshness of meat and obtain the corresponding ATP concentration in pork, beef or mutton, which is used to evaluate the freshness of pork, beef or mutton.

[0028] Figure 4 A shows the change in freshness of pork stored at 25°C. At the 36th hour, the total colony count was 6.04lgCFU / g, exceeding the national standard limit of 6lgCFU / g, indicating that the pork had deteriorated. The corresponding ATP content at this time was 2.03µg / g. Figure 4 B shows the change in freshness of beef stored at 25°C. At 36 hours, the total colony count was 6.08lgCFU / g, exceeding the national standard limit of 6lgCFU / g, indicating that the beef has deteriorated. The corresponding ATP content at this time is 2.07µg / g. Figure 4C shows the change in freshness of mutton under storage conditions at 25°C. At the 36th hour, the total colony count was 6.12lgCFU / g, exceeding the national standard limit of 6lgCFU / g, indicating that the mutton has deteriorated. The corresponding ATP content at this time is 2.10µg / g.

[0029] In summary, the present invention provides a non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas to achieve highly sensitive, simple and rapid ATP detection, and is applied to the rapid evaluation of the freshness of pork, beef and mutton.

[0030] The above embodiments are merely examples for illustrating the present invention and are not intended to limit the embodiments of the present invention. Those skilled in the art will appreciate that other variations and modifications may be made based on the above description. Any obvious variations or modifications arising from the technical solutions of the present invention remain within the scope of protection of the present invention.

Claims

1. A non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas, characterized in that: The conformational change during target recognition by the aptamer is converted into the kinetic difference of the toehold-mediated strand displacement reaction, and the CRISPR / Cas system is activated by designing a cascade toehold-mediated strand displacement reaction, including the following steps: Step 1): The complementary chain and the activation chain were added to a Tris-HCl buffer solution with a molar ratio of (1-3):1 and mixed evenly. The mixture was annealed at 95°C for 5 minutes, and then slowly cooled at room temperature to form a double chain. The obtained double chain was stored at 4°C. 1µM aptamer chain was annealed at 95°C for 5 minutes, and then slowly cooled to room temperature and stored at 4°C. Step 2): Add CRISPR RNA (crRNA) and LbCas12a to NEBuffer r2.1 1× buffer solution at a molar ratio of 1:(1-2) and mix evenly, then incubate at 25°C for 15-20 minutes to form a Cas12a / crRNA complex, and then store it at 4°C; Step 3): The double-stranded DNA prepared in step 1), the aptamer chain, the Cas12a / crRNA complex prepared in step 2), and the single-stranded DNA substrate (ssDNA-FQ) simultaneously labeled with the fluorescent group FAM and the fluorescent quencher group BHQ1 were mixed at a molar ratio of 7: (6-14): (1-8): 40, and different concentrations of ATP were added to make a total volume of 100 µL, reacted at 37 ° C for 45 minutes, and then placed at 65 ° C for 10 minutes to inactivate Cas12a. Finally, the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm to obtain a linear relationship between the lg value of ATP concentration and the fluorescence intensity. Step 4): Calculate the ATP concentration in the sample to be tested based on the linear relationship between the lg value of the ATP concentration obtained in step 3) and the fluorescence intensity and the detected fluorescence intensity of the sample to be tested.

2. An application of the non-competitive detection method based on aptamer allosteric activation of CRISPR / Cas according to claim 1, characterized in that: Used to evaluate the freshness of pork, beef and lamb, including the following steps: Step 1): Place 5g of pork, beef or mutton in a sterile bag and homogenize for 3 minutes, add it to 10ml of 5% trichloroacetic acid solution, vortex for 3 minutes, centrifuge at 4℃ for 20 minutes, remove the supernatant, filter it with a 0.22μm microporous membrane, and finally store the filtered supernatant at -20℃; Step 2): The filtered supernatant obtained in step 1) is adjusted to pH 7.5 with a Tris base solution, and diluted 10 times with a Tris-HCl buffer solution to obtain a dilution of the supernatant; Step 3): The double-stranded, aptamer chain, Cas12a / crRNA complex and ssDNA-FQ prepared in claim 1 were mixed in a molar ratio of 7: (6-14): (1-8): 40, and 10 µL of the dilution of the supernatant obtained in step 2) was added to make a total volume of 100 µL, reacted at 37 ° C for 45 minutes, and then placed at 65 ° C for 10 minutes to inactivate Cas12a, and finally the fluorescence intensity of the solution was measured using a multifunctional microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. The ATP concentration in pork, beef or mutton was calculated according to the linear relationship between the lg value of the ATP concentration obtained in claim 1 and the fluorescence intensity. Step 4): Using the total colony count (TVC) to evaluate the freshness of meat is used as an indicator to obtain the corresponding ATP concentration in pork, beef or mutton, which is used to evaluate the freshness of pork, beef or mutton.