Method and kit for rapidly detecting ralstonia solanacearum on basis of ERA-CRISPR / Cas12a system

Abstract

The invention discloses a method and a kit for rapidly detecting ralstonia solanacearum on the basis of an ERA-CRISPR / Cas12a system. The invention relates to a detection primer group for detecting ralstonia solanacearum by ERA. The detection primer group consists of the following primers: an upstream primer F: AAAAGAGCGTAA GCGGTTCCGGCCAGTGCA; and the downstream primer R is GTTCGCATCGAACACCTGGTTGAGCGTGG G. The invention also discloses a kit for detecting the content of the A set of specific detection primer group and a detection kit containing the detection primer group are designed and screened for specific target genes of ralstonia solanacearum egl, the detection kit is used for amplifying the target genes, and ralstonia solanacearum in a to-be-detected sample is accurately identified. The detection kit and the detection test strip provided by the invention have the advantages of high sensitivity, strong specificity and short reaction time, and the process from sample treatment to result reporting can be completed within 1h. The method is suitable for field on-site rapid screening and accurate diagnosis of ralstonia solanacearum, and provides powerful technical support for early diagnosis, prevention and control of eucalyptus bacterial wilt.

Description

Technical field:

[0001] The present invention belongs to the field of microbial detection, and specifically relates to a detection primer set, a detection kit, and a detection method for rapid detection of Ralstonia solanacearum based on ERA-CRISPR / Cas12a. Background technology:

[0002] Plant bacterial wilt is a soil-borne disease caused by the bacterium Ralstonia solanacearum (Ralstonia solanacearum). Ralstonia has a wide host range and can infect more than 450 plant species from over 50 families, including eucalyptus, casuarinas, tomatoes, potatoes, etc., causing serious economic losses to agricultural and forestry production. Ralstonia invades the vascular bundles of eucalyptus from the rhizomes and is difficult to detect in the early stages of the disease. Once the disease occurs under suitable conditions, the plant quickly wilts and dies, which brings great difficulties to the prevention and control of eucalyptus bacterial wilt. Therefore, timely and effective detection of potential Ralstonia is an effective measure to control the spread and rapid spread of the pathogen.

[0003] Currently, the detection of Ralstonia solanacearum in plant tissues primarily relies on traditional tissue separation and serological methods. However, these methods suffer from long detection cycles and low sensitivity, making them inadequate for complex sample testing and rapid laboratory testing. Furthermore, traditional PCR methods require extensive equipment, such as instruments and gel imagers, a high level of environmental expertise, and high laboratory technical expertise, making them difficult to implement on a large scale within forestry departments and nursery stock production enterprises.

[0004] ERA (Enzymatic Recombinase Amplification) is a new technology developed by Suzhou Xinda Gene Technology Co., Ltd. in 2019. It is an improved version of RPA. This technology combines DNA recombinase with primers to amplify the target gene under constant temperature conditions (37-40°C), and the reaction time is only 15-20 minutes. Moreover, due to the high specificity of the enzyme, the error rate of detection is reduced. Compared with traditional PCR technology, ERA technology has the characteristics of short reaction time, ability to amplify target genes under constant temperature conditions, simple operation, good specificity and high sensitivity. In recent years, ERA amplification technology has been applied in fields such as food and pathogen identification.

[0005] Clustered regularly interspaced short palindromic repeats (CRISPRs) are repetitive DNA fragments found in prokaryotes. CRISPR and related Cas proteins are part of the adaptive immune system of archaea and bacteria, used to defend against invasive nucleic acids from foreign plasmids and phages. Among them, the Cas12a protein can specifically recognize T-rich PAMs, identify target gene sequences under the guidance of crRNA, trigger cleavage activity, cut non-specific single strands, and thus emit a fluorescent signal to detect pathogens. Currently, the CRISPR / Cas12a system has been widely used in the detection of substances such as bacteria, DNA viruses, small molecule peptides and proteins.

[0006] Currently, there are no reports of ERA-CRISPR / Cas12a rapid detection kits / test strips for Ralstonia solanacearum. This study, based on extensive screening of Ralstonia solanacearum-specific target genes, designed ERA primers and crRNA. Combined with the CRISPR / Cas12a system, this study constructed a precise, visual detection kit and test strip. Compared with previous technologies, traditional tissue culture methods are time-consuming and labor-intensive, and the antibody preparation process is tedious and complex. Although traditional PCR methods have been widely used to detect various pathogens, they require steps such as thermal cycling, expensive instrumentation, standardized laboratories, and specialized technicians. The long reaction time makes them difficult to meet the requirements of on-site instant testing and unsuitable for widespread application in grassroots departments. LAMP technology is complex in primer design, requires reactions at 60-65°C, and is prone to aerosol contamination. The ERA method, a modified version of RPA technology, can complete the reaction at a constant temperature (37-40°C), has a short reaction time, is easy to operate, and offers even higher sensitivity when combined with the CRISPR / Cas12a system, demonstrating enhanced specificity, sensitivity, and practicality. Its outstanding advantages are: no need for expensive instruments and equipment, convenient and fast, can be operated by grassroots personnel, and can realize on-site, visual, and rapid batch screening of field / forest samples, which greatly saves time and reduces economic losses of seedlings. It provides important technical support for preventing and controlling the spread of bacterial wilt and ensuring the quality and safety of crops / seedlings. Summary of the invention:

[0007] The purpose of the present invention is to provide a method and kit for rapid detection of Ralstonia solanacearum based on the ERA-CRISPR / Cas12a system, in order to provide a powerful technical means for the early diagnosis, prevention, and control of Ralstonia solanacearum in eucalyptus trees. The detection method of the present invention combines ERA amplification technology with the CRISPR / Cas12a system, with the advantages of rapidity, good specificity, high sensitivity, and ease of operation.

[0008] The first object of the present invention is to provide a primer set for ERA detection of Ralstonia solanacearum, characterized in that it consists of the following primers:

[0009] Upstream primer F (5'-3'): AAAAGAGCGTAAGCGGTTCCGGCCAGTGCA GGATTAATTC GATGCAACGC (as shown in SEQ ID NO. 1);

[0010] Downstream primer R (5'-3'): GTTCGCATCGAACACCTGGTTGAGCGTGGG CTTCCTCCGGT TTGTCAC (as shown in SEQ ID NO. 2).

[0011] The present invention also provides a kit for rapid detection of Ralstonia solanacearum based on ERA-CRISPR / Cas12a, the kit comprising the above-mentioned ERA detection primer set, crRNA, LbCas12a, an ssDNA fluorescent probe modified with a fluorescent group and a quenching group, and a biotin probe labeled with a FAM fluorescent dye at the 5' end and biotin at the 3' end, wherein the nucleotide sequence of the crRNA is: UAAUUUCUAAGUGUAGAUGGGAGGGCAGCCTGCCGGGCAC CT, the ssDNA fluorescent probe is FAM-TTATT-BHQ1, and the biotin probe is FAM-TTATT-Bi otin.

[0012] The second object of the present invention is to provide a method for rapid detection of Ralstonia solanacearum based on ERA-CRISPR / Cas12a, characterized in that bacterial DNA in the sample is extracted, and then the bacterial DNA is amplified by the ERA-CRISPR / Cas12a method to confirm whether there is an amplified product.

[0013] The sample can be plant tissue or bacterial culture.

[0014] The ERA isothermal amplification method uses the above-mentioned detection primer set to amplify bacterial DNA. The specific reaction system is as follows: the total volume of the ERA isothermal amplification system is 50 μL, including 20 μL R solvent, 2.5 μL 10 μM upstream primer F, 2.5 μL 10 μM downstream primer R, 2 μL activator and 3 μL bacterial DNA template, and enzyme-free water is added to 50 μL. The reaction conditions are incubation at a temperature of 37-40°C for 15-20 minutes.

[0015] Furthermore, after the ERA amplification product obtained above is reacted in the CRISPR / Cas12a reaction system, it is detected by a fluorescent quantitative PCR instrument or a lateral flow test strip. When a fluorescent amplification signal or T line coloring appears, it is determined to contain the solanacearum; the CRISPR / Cas12a reaction system includes crRNA, LbCas12a, a modified fluorescent group and a quenching group as shown in Table 1SEQ ID NO.3, and an ssDNA fluorescent probe as shown in Table 1SEQ ID NO.4 and a biotin probe as shown in Table 1SEQ ID NO.5. Specifically, a fluorescent quantitative PCR instrument is used to read the fluorescent signal, react at 38°C for 30 minutes, and record the fluorescent signal once per minute; for lateral flow test strip detection, the mixed components are reacted in a 38°C water bath for 30 minutes, and the incubated product is diluted with enzyme-free water. The bottom of the strip is immersed in the dilution solution, and the result is read with the naked eye after incubation at room temperature for 2 minutes.

[0016] The reaction components of the ERA-CRISPR / Cas12a fluorescence detection system are specifically 0.2 μL 10 μM Cas12a, 0.2 μL 20 μM crRNA, 2 μL 10× Reaction Buffer, 0.2 μL 100 μM FAM-BHQ-labeled ssDNA, 5 μL of ERA amplification product, and enzyme-free water is added to 20 μL.

[0017] The reaction components of the ERA-CRISPR / Cas12a lateral flow test strip detection system are specifically 0.2 μL 10 μM Cas12a, 0.2 μL 20 μM crRNA, 2 μL 10× Reaction Buffer, 0.2 μL 100 μM FAM-Biotin-labeled biotin probe, 5 μL of ERA amplification product, and enzyme-free water is added to 20 μL.

[0018] The present invention designs and screens a specific detection primer set and a detection kit containing the primer set for the EGL-specific target gene of Ralstonia solanacearum. The detection kit is used to amplify the target gene and accurately identify Ralstonia solanacearum in the sample to be tested. The detection kit and test strips of the present invention have the advantages of high sensitivity, strong specificity, and a short reaction time. Sample processing and result reporting can be completed within 1 hour. They are suitable for rapid and accurate field screening and diagnosis of Ralstonia solanacearum, providing strong technical support for the early diagnosis, prevention, and control of eucalyptus bacterial wilt. Description of the drawings:

[0019] Figure 1 、 Figure 2 Feasibility analysis of the ERA-CRISPR / Cas12a detection system;

[0020] Figure 3 、 Figure 4 For sensitivity analysis of the ERA-CRISPR / Cas12a detection system;

[0021] Figure 5 、 Figure 6 Specificity analysis of the ERA-CRISPR / Cas12a detection system.

[0022] Figure 5 In: Rs, Rs1, Rs2, Bc, Bs, Kp, Pa, Pf, Pj, Pm, Pp, Rm, Sm, Xa, Xc, Bs1, Bs2, Pf1, Pf2, Xa1, NC are Ralstonia solanacearum, Ralstonia solanacearum, Ralstoniasolanacearum, Burkhoderia cepacia, and Bacillus respectively. subtilis, Klebsiella pneumoniae, Pectobacterium actinidiae, Paenibacillus favisporus, Pseudomonas jinjuensis, Priestia megaterium, Pseudomonas putida, Ralstonia mannitolilytica, Serratiamarcescens, Xanthomonas axonopodis, Xanthomonas citri, Bacillus subtilis, Bacillus subtilis, Paenibacillus favisporus, Paenibacillus favisporus, Xanthomonas axonopodis, and negative control.

[0023] Figure 6In: Rs, Rs1, Rs2, Bc, Bs, Kp, Pa, Pf, Pj, Pm, Pp, Rm, Sm, Xa, Xc, Bs1, Bs2, Pf1, Pf2, Xa1, NC are Ralstonia solanacearum, Ralstonia solanacearum, Ralstoniasolanacearum, Burkhoderia cepacia, and Bacillus respectively. subtilis, Klebsiella pneumoniae, Pectobacterium actinidiae, Paenibacillus favisporus, Pseudomonas jinjuensis, Priestia megaterium, Pseudomonas putida, Ralstonia mannitolilytica, Serratiamarcescens, Xanthomonas axonopodis, Xanthomonas citri, Bacillus subtilis, Bacillus subtilis, Paenibacillus favisporus, Paenibacillus favisporus, Xanthomonas axonopodis, and negative control. Specific implementation method:

[0024] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0025] Example 1: Target sequence screening and primer design

[0026] 1.1 Analysis of conserved sequences

[0027] The endoglucanase gene (egl) sequence of Ralstonia solanacearum was downloaded from NCBI, and multiple sequence alignment analysis of the egl gene was performed using DANMAN software, and the conserved sequence was finally obtained. The specific sequence is (5'-3'):

[0028] CCACCGACACCACGACCCTGAAGCCCGCCGCCACCTCGACCACCTCGTCCGTGTGGCTCACCATCGCCAAGGACAGTGCAGCGTTCACGGTGAGCGGCACGCGCACGGTGCGCTATGGCGCCGGCAGCGCGTGGGTGGAAAAGAGCGTAAGCGGTTCCGG CCAGTGCACCAGCGCCTTCTTCGGCAAGGACCCCGCGGCCGGCGTCGCCAAGGTGTGCCAGCTGCTGCAGGGCACGGGCACGCTGCTGTGGCGCGGCGTCAGCCTGGCCGGCGGAGTTTGGGGAGGGCAGCCTGCCGGGCACCTACGGCAGCAATTACA TCTATCCGTCCGCCGACAGCGCGACGTACTACAAGAACAAGGGCATGAACCTCGTGCGCCTGCCGTTCCGGTGGGAGCGGCTGCAGCCCACGCTCAACCAGGTGTTCGATGCGAACGAGCTGTCGCGCCTGACCGGGTTTGTCAACGCCGTGACGGCGACC GGCCAGACGGTGCTGCTCGATCCGCACAACTATGCGCGCTACTACGGCAACGTGATCGGGTCGAGCGCGGTGCCCAACAGCGCGTACGCCGATTTCTGGCGGCGCCTGGCCACCCAGTTCAAGGGCAATCCCCGCGTCATCTTCGGGCTGATGAACGAGCC

[0029] 1.2 ERA primer design

[0030] Primer Premier 5 software was used to design primers for the conserved sequences obtained in 1.1. The specific sequences are:

[0031] Upstream primer F: AAAAGAGCGTAAGCGGTTCCGGCCAGTGCA (SEQ ID NO. 1);

[0032] Downstream primer R: GTTCGCATCGAACACCTGGTTGAGCGTGGG (SEQ ID NO. 2).

[0033] 1.3 crRNA design

[0034] The crRNA sequences were designed using the CHOPCHOP online tool. The specific sequences are shown in Table 1.

[0035] Table 1

[0036]

[0037] Example 2: Establishment of detection method

[0038] 2.1 DNA extraction

[0039] The genomic DNA of Ralstonia solanacearum was extracted using a bacterial genomic DNA miniprep kit from Nanjing Novozymes Biotechnology Co., Ltd. The steps are as follows:

[0040] (1) Take 1.5 ml of bacterial culture medium and centrifuge at 10,000 rpm for 1 min. Discard the culture medium. Then add 230 μL of Buffer GA, 20 μL of Proteinase K, and 250 μL of Buffer GB, respectively. Vortex to mix thoroughly and place in a metal water bath at 70°C for 10 min.

[0041] (2) Add 180 μL of anhydrous ethanol, vortex to mix, and briefly centrifuge to collect the liquid on the inner wall of the tube cap. Transfer the entire solution to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0042] (3) Add 500 μL of Buffer PB to the adsorption column and centrifuge at 12,000 rpm for 1 min. Discard the filtrate.

[0043] (4) Add 600 μL of Buffer PW to the column and centrifuge at 12,000 rpm for 1 min. Discard the filtrate. Repeat once.

[0044] (5) Return the adsorption column to the collection tube and centrifuge at 12,000 rpm for 2 minutes. Then transfer the column to a new 1.5 ml centrifuge tube and dropwise add 50-100 μL of Solution Buffer to the center of the adsorption column. Incubate at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, and discard the adsorption column.

[0045] (6) The extracted DNA was stored in a -20°C refrigerator until use.

[0046] 2.2 Construction of standard recombinant plasmids

[0047] (1) Design a pair of primers f and r (6 and 7 in Table 1) and perform PCR amplification using the above DNA as a template.

[0048] (2) The PCR product was purified, and then the purified target fragment was connected to the pBM23 vector (purchased from Guangzhou Xinkailai Biotechnology Co., Ltd.) and transformed into DH5a competent cells (purchased from Guangzhou Xinkailai Biotechnology Co., Ltd.) for overnight culture.

[0049] (3) The recombinant plasmid was extracted using a plasmid DNA mini-extraction kit (purchased from Beijing Jinsha Biotechnology Co., Ltd.). The concentration of the recombinant plasmid was measured using a spectrophotometer and diluted 10-fold to 1 × 10 10 to 1×10 - 2 copies / μL.

[0050] (4) Calculate the plasmid copy number according to the following formula: copies / μL = (A260 (ng / μL) × 10 -9 ×6.02×10 23 ) / (DNA length×650).

[0051] (5) Store at -20°C for subsequent experiments.

[0052] 2.3 Establishment of ERA amplification system

[0053] (1) The ERA reaction system is as follows: 20 μL of dissolving agent, 2.5 μL of 10 μM upstream primer F, 2.5 μL of 10 μM downstream primer R, 3 μL of template DNA, 2 μL of activator, and enzyme-free water to 50 μL.

[0054] (2) The optimized reaction conditions are: 38°C water bath for 20 min.

[0055] (3) After the incubation, add 7.5 μL of Loading Buffer and incubate at 56°C for 5 min to terminate the reaction and obtain the ERA amplification product.

[0056] 2.4 Establishment of the ERA-CRISPR / Cas12a Detection System

[0057] (1) The ERA-CRISPR / Cas12a fluorescence detection reaction system is as follows: 0.2 μL 10 μM LbCas12a, 0.2 μL 20 μM crRNA, 2 μL 10× Reaction Buffer, 0.2 μL 100 μM ssDNA fluorescent probe (ssDNA(FQ), ssDNA(FB)), 5 μL ERA amplification product, and sterile water is added to 20 μL.

[0058] (2) The ERA-CRISPR / Cas12a lateral flow test strip detection reaction system is: 0.2 μL 10 μM LbCas12a, 0.2 μL 20 μM crRNA, 2 μL 10× Reaction Buffer, 0.2 μL 100 μM biotin probe, 5 μL ERA amplification product, and sterile water is added to 20 μL.

[0059] (3) Use a fluorescence quantitative PCR instrument to react at 38°C for 30 minutes, and record the fluorescence signal once every minute.

[0060] (4) For lateral flow assay (LFA) testing, dilute the incubated product with enzyme-free water, immerse the bottom of the strip in the diluent, incubate at room temperature for 2 minutes, and read the result on the strip with the naked eye. If both the T line and the C line are colored or the T line is weakly stained, it indicates a positive result; if only the C line is colored or the T line is not colored, it indicates a negative result; if the C line is not colored, it indicates invalid. A blue light illuminator can also be used to observe fluorescence, and the presence of green fluorescence can be used as an indicator of the presence of target DNA.

[0061] Example 3: Feasibility analysis of the ERA-CRISPR / Cas12a detection system

[0062] Experiments were performed on LbCas12a, crRNA, and ERA amplification products in the CRISPR / Cas12a reaction system, respectively, with the complete reaction system 2.4(1) as the positive control and enzyme-free water as the negative control.

[0063] like Figure 1 、 Figure 2 The test results of the ERA-CRISPR / Cas12a detection system showed that the ERA-CRISPR detection system established by the present invention is feasible.

[0064] Example 4: Sensitivity detection of ERA-CRISPR / Cas12a detection system

[0065] The ERA-CRISPR / Cas12a assay was performed using the constructed standard recombinant plasmid as a template, and the reaction system and procedure were as described above. Figure 3 、 Figure 4 The sensitivity test results of the ERA-CRISPR / Cas12a detection system showed that the concentration of 0 There is still a relatively obvious fluorescence amplification curve of 10 copies / μL. Therefore, it is determined that the minimum detection limit of the ERA-CRISPR / Cas12a detection system established in the present invention is 10 0 copies / μL, with high sensitivity.

[0066] Example 5: Specificity detection of ERA-CRISPR / Cas12a detection system

[0067] Based on the optimized ERA-CRISPR / Cas12a reaction conditions, specific detection of Ralstonia solanacearum and 17 other non-Ralstonia solanacearum strains (shown in Table 2) was performed. Figure 5 、 Figure 6As shown, in the present invention, only the Ralstonia solanacearum strain produced fluorescence positive detection, and the other 17 non-Ralstonia solanacearum strain detection results were all negative (Table 2). Therefore, it was determined that the ERA-CRISPR / Cas12a method established by the present invention has good specificity.

[0068] Table 2: Strains used in the experiment and test results

[0069]

[0070]

[0071] +: Ralstonia solanacearum positive; -: Ralstonia solanacearum negative

[0072] Example 6: Detection of artificially infected eucalyptus samples

[0073] (1) Treatment of artificially infected plant tissues

[0074] Take 2g of healthy eucalyptus tissue and grind it into powder by adding liquid nitrogen. Artificially inoculate different concentrations of Ralstonia solanacearum suspension to make the final concentration be 10 7 -10 -1 CFU / mL, and then the artificially contaminated eucalyptus samples were enriched and cultured for 12-18h.

[0075] (2) Extract DNA from 13 strains according to the above method

[0076] (3) ERA-CRISPR / Cas12a amplification was performed according to the above method

[0077] (4) As shown in Table 3, the ERA-CRISPR / Cas12a detection system of the present invention can detect a concentration of 10 0 CFU / mL of Ralstonia solanacearum, PCR can detect a concentration of 10 3 CFU / mL of Ralstonia solanacearum (Table 3). This shows that the new method is not only accurate and reliable, but also has high sensitivity.

[0078] Table 3

[0079]

[0080]

[0081] +: Ralstonia solanacearum positive; -: Ralstonia solanacearum negative

[0082] Example 7: Detection of Eucalyptus Samples Infected with Ralstonia solanacearum (Actual Sample Detection)

[0083] Using genomic DNA extracted from three eucalyptus samples infected with Ralstonia solanacearum as templates, the ERA-CRISPR / Cas12a detection system was tested to verify its effectiveness on real samples and compared with traditional PCR methods.

[0084] (1) DNA extraction: The genomic DNA of three samples of Ralstonia solanacearum was extracted using the bacterial genomic DNA minipreparation kit from Nanjing Novozymes Biotechnology Co., Ltd.

[0085] (2) ERA amplification system

[0086] The ERA reaction system consists of 20 μL of lytic agent, 2.5 μL of 10 μM upstream primer F, 2.5 μL of 10 μM downstream primer R, 3 μL of template DNA, and 2 μL of activator. Add enzyme-free water to 50 μL. Combine the reaction components and incubate in a 38°C water bath for 20 minutes. After incubation, add 7.5 μL of loading buffer and incubate at 56°C for 5 minutes to terminate the reaction.

[0087] (3) ERA-CRISPR / Cas12a detection

[0088] The ERA-CRISPR / Cas12a fluorescence detection reaction system consists of: 0.2 μL of 10 μM LbCas12a, 0.2 μL of 20 μM crRNA, 2 μL of 10× Reaction Buffer, 0.2 μL of 100 μM ssDNA fluorescent probe, and 5 μL of ERA amplification product. The volume is filled to 20 μL with sterile water. The reaction is incubated at 38°C for 30 minutes using a fluorescence quantitative PCR instrument, and the fluorescence signal is recorded every minute.

[0089] The ERA-CRISPR / Cas12a lateral flow test strip reaction system consists of: 0.2 μL of 10 μM LbCas12a, 0.2 μL of 20 μM crRNA, 2 μL of 10× Reaction Buffer, 0.2 μL of 100 μM biotin probe, and 5 μL of ERA amplification product. The volume is made up to 20 μL with sterile water. The incubated product is diluted with enzyme-free water, and the bottom of the strip is immersed in the diluent. After incubation at room temperature for 2 minutes, the strip is visually read. The results show that both the T and C lines are colored, indicating contamination with Ralstonia solanacearum.

[0090] (4) Results

[0091] As shown in Table 4, the ERA-CRISPR / Cas12a detection kit developed in this patent showed that all three samples tested positive for Ralstonia solanacearum, consistent with the traditional PCR method. This demonstrates the successful application of this method in real-world sample testing. It offers shorter detection times, simpler operation, and is suitable for on-site testing.

[0092] Table 4

[0093]

[0094] +: Ralstonia solanacearum positive; -: Ralstonia solanacearum negative.

Claims

1. A detection primer set for detecting Ralstonia solanacearum using ERA, characterized in that: It consists of the following primers: Upstream primer F: AAAAGAGCGTAAGCGGTTCCGGCCAGTGCA; Downstream primer R: GTTCGCATCGAACACCTGGTTGAGCGTGGG.

2. A kit for rapid detection of Ralstonia solanacearum based on the ERA-CRISPR / Cas12a system, characterized in that: The kit includes the detection primer set according to claim 1, crRNA, LbCas12a, an ssDNA fluorescent probe modified with a fluorescent group and a quenching group, and a biotin probe labeled with a FAM fluorescent dye at the 5' end and biotin at the 3' end, the nucleotide sequence of the crRNA is: UAAUUUCUAAGUGUAGAUGGGAGGGCAGCCTGCCGGGCACCT, the ssDNA fluorescent probe is FAM-TTATT-BHQ1, and the biotin probe is FAM-TTATT-Biotin.

3. A method for rapid, accurate and visual detection of Ralstonia solanacearum, characterized in that: Extract bacterial DNA from the sample, and then amplify the bacterial DNA using the detection primer set of claim 1 using the ERA-CRISPR / Cas12a detection system to confirm whether there is an amplified product.

4. The detection method according to claim 3, characterized in that The sample is plant tissue or bacterial culture.

5. The detection method according to claim 3, characterized in that The method of the ERA-CRISPR / Cas12a detection system is described in claim 1. The detection primer set of claim 1 is used to perform ERA amplification on bacterial DNA. Specifically, the total volume of the ERA amplification system is 50 μL, including 20 μL of solvent, 2.5 μL of 10 μM upstream primer F, 2.5 μL of 10 μM downstream primer R, 22 μL of sterile double distilled water, 2 μL of activator and 1 μL of bacterial DNA template. The reaction conditions are incubated at a temperature of 37-40 ° C for 15-20 minutes, and then detected with LbCas12a, crRNA and ssDNA as described in claim 2, specifically: the total volume of the ERA-CRISPR / Cas12a system is 20 μL, including 0.2 μL of 10 μM LbCas12a, 0.2 μL of 20 μM crRNA, 2 μL of 10× Reaction Buffer, 0.2 μL of ssDNA or biotin probe, 5 μL For ERA amplification products, the volume was made up to 20 μL with enzyme-free water, the reaction temperature was 38°C, and the reaction time was 30 min.

Images