Identification method of polyploidy forest gene editing type and application thereof

Abstract

The invention relates to a polyploid forest gene editing type identification method and application thereof, and belongs to the technical field of molecular biology. The invention provides a polyploidy forest gene editing type identification method which comprises the following steps: carrying out a first round of PCR (Polymerase Chain Reaction) amplification by taking genome DNA (Deoxyribonucleic Acid) of a gene editing strain as a template to obtain a first round of amplification product; carrying out second-round PCR amplification by taking the first-round amplification product as a template to obtain a second-round amplification product; and carrying out Hi-TOM sequencing analysis on the second round of amplification product to obtain a Hi-TOM sequencing result. According to the identification method disclosed by the invention, two rounds of PCR amplification are combined with HI-TOM sequencing analysis, so that the identification of the editing type of the polyploidy forest tree gene editing strain can be realized, a homozygous gene editing plant is obtained, the defects of a traditional identification method are overcome, and the method has the characteristics of high efficiency and low cost.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to a method for identifying gene editing types of polyploid trees and applications thereof. Background Art

[0002] Existing technologies for identifying the types of plant gene editing typically involve first amplifying the target region for editing using PCR, connecting it to a T vector and transforming it into E. coli, then picking a single clone for Sanger sequencing, or directly performing Sanger sequencing on the PCR product after amplifying the target region. However, since polyploid forest cells contain more than two sets of chromosomes, the method of picking a single clone for sequencing cannot distinguish between allele editing on different chromosomes; the method of direct sequencing of PCR products is even more incapable of identifying heterozygous editing. Since gene editing on chromosomes is the insertion or deletion of single bases or small fragments, the PCR products obtained by PCR amplification cannot distinguish between different types of gene editing after recovery, resulting in the Sanger sequencing results being reported as double peaks. Therefore, it is impossible to accurately obtain the editing status of different chromosomes in polyploid forest strains.

[0003] Currently commonly used methods for screening and identifying gene editing types have the disadvantages of being time-consuming, labor-intensive, expensive, and having low reliability of results. It is even impossible to identify the gene editing types of polyploid trees with larger genomes. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for identifying the gene editing type of polyploid trees and its application, so as to solve the problems in the prior art of the identification of gene editing types of polyploid trees, which are time-consuming, labor-intensive, expensive and have low reliability of results.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a method for identifying the gene editing type of polyploid forest trees, comprising the following steps:

[0007] (1) Design the first round forward primer and the first round reverse primer according to the location of the gene editing site of the gene editing strain on the genome;

[0008] (2) Using the genomic DNA of the gene-edited strain as a template, the first round of PCR amplification was performed using the first round forward primer and the first round reverse primer to obtain the first round amplification product;

[0009] (3) designing a second round of forward primers and a second round of reverse primers based on the first round of amplification products, and using the first round of amplification products as a template, performing a second round of PCR amplification using the second round of forward primers and the second round of reverse primers to obtain the second round of amplification products;

[0010] (4) Perform Hi-TOM sequencing analysis on the second-round amplification products to obtain Hi-TOM sequencing results.

[0011] Preferably, the gene-edited strain in step (1) is a gene-edited polyploid forest tree strain;

[0012] The concentration of the first-round forward primer is 5-15 μmol / L, and the concentration of the first-round reverse primer is 5-15 μmol / L.

[0013] Preferably, the PCR system for the first round of PCR amplification in step (2) comprises the following components in parts by volume: 1 to 3 parts of genomic DNA, 10 to 15 parts of PCR Mix, 0.5 to 2 parts of the first round forward primer, 0.5 to 2 parts of the first round reverse primer, and 5 to 10 parts of ddH2O.

[0014] Preferably, the PCR conditions for the first round of PCR amplification in step (2) are: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 s; continuous extension at 68°C for 5 min, for a total of 30 to 40 cycles.

[0015] Preferably, in step (3), the concentration of the second round forward primer is 5 to 15 μmol / L, and the concentration of the second round reverse primer is 5 to 15 μmol / L.

[0016] Preferably, in step (3), a bridging sequence GAGTACGGTGTGC is added to the 5' end of the second round forward primer;

[0017] The bridging sequence GGATGCTGGATGG was added to the 5' end of the second round reverse primer.

[0018] Preferably, the PCR system for the second round of PCR amplification in step (3) comprises the following components in parts by volume: 1 to 3 parts of the first round amplification product, 10 to 15 parts of PCR Mix, 0.5 to 2 parts of the second round forward primer, 0.5 to 2 parts of the second round reverse primer, and 5 to 10 parts of ddH2O.

[0019] Preferably, the PCR conditions for the second round of PCR amplification in step (3) are: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 s; continuous extension at 68°C for 5 min, for a total of 30 to 40 cycles.

[0020] Preferably, it is characterized in that when each allele of the second-round amplification product is edited, the gene-edited strain is a homozygous gene-edited strain;

[0021] When at least one allele in the second-round amplification product is not edited, the gene-edited strain is a heterozygous gene-edited strain.

[0022] The present invention provides the application of the identification method in detecting and / or identifying the editing type of gene-edited strains of polyploid forest trees.

[0023] The present invention has the following technical effects and advantages:

[0024] The identification method of the present invention uses two rounds of PCR amplification combined with HI-TOM sequencing analysis to identify the editing type of polyploid forest tree gene-edited strains, thereby obtaining homozygous gene-edited plants, thus overcoming the drawbacks of traditional identification methods.

[0025] In the identification method of the present invention, the price of 10,000 sequencing reads is about 100 yuan, and the average price of 100 reads is about 1 yuan. This not only greatly reduces the identification cost, but also can obtain a more accurate and reliable proportion of gene editing types through a large amount of read data, with the characteristics of high efficiency and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The results of 1% agarose gel electrophoresis of Cas9 gene fragments in each transgenic triploid poplar line are shown. Lane M is a marker, lane 1 is a blank control, lane 2 is a positive control, lane 3 is a negative control, and lanes 4 to 11 are KD-1, KD-2, KD-3, KD-4, KD-5, KD-6, KD-7, and KD-8 lines, respectively.

[0027] Figure 2 The Sanger sequencing results of the Cas9 gene fragments in each transgenic triploid poplar line;

[0028] Figure 3 Schematic diagram of the process of the method for identifying the gene editing type of polyploid forest trees of the present invention;

[0029] Figure 4 This is the result of Hi-TOM sequencing analysis. Genome A, Genome B, and Genome C in the figure represent the three alleles of the transgenic triploid poplar lines. Blue letters represent target sequences, yellow letters represent PAM regions, the letter "D" represents deletion, and the letter "I" represents insertion. The percentage value indicates the proportion of a specific gene editing type to all gene editing types. DETAILED DESCRIPTION

[0030] The present invention provides a method for identifying the gene editing type of polyploid forest trees, comprising the following steps:

[0031] (1) Design the first round forward primer and the first round reverse primer according to the location of the gene editing site of the gene editing strain on the genome;

[0032] (2) Using the genomic DNA of the gene-edited strain as a template, the first round of PCR amplification was performed using the first round forward primer and the first round reverse primer to obtain the first round amplification product;

[0033] (3) designing a second round of forward primers and a second round of reverse primers based on the first round of amplification products, and using the first round of amplification products as a template, performing a second round of PCR amplification using the second round of forward primers and the second round of reverse primers to obtain the second round of amplification products;

[0034] (4) Perform Hi-TOM sequencing analysis on the second-round amplification products to obtain Hi-TOM sequencing results.

[0035] In the present invention, the gene-edited strain in step (1) is a gene-edited polyploid forest tree strain;

[0036] The concentration of the first-round forward primer is 5-15 μmol / L, preferably 10 μmol / L; the concentration of the first-round reverse primer is 5-15 μmol / L, preferably 10 μmol / L.

[0037] In the present invention, the PCR system for the first round of PCR amplification in step (2) comprises the following components in parts by volume: 1 to 3 parts, preferably 2 parts, of genomic DNA; 10 to 15 parts, preferably 12.5 parts, of PCRMix; 0.5 to 2 parts, preferably 1 part, of the first round forward primer; 0.5 to 2 parts, preferably 1 part, of the first round reverse primer; and 5 to 10 parts, preferably 8.5 parts, of ddH2O.

[0038] In the present invention, the PCR conditions for the first round of PCR amplification in step (2) are: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 s; continuous extension at 68°C for 5 min, for a total of 30 to 40 cycles.

[0039] In the present invention, in step (3), the concentration of the second round forward primer is 5-15 μmol / L, preferably 10 μmol / L; the concentration of the second round reverse primer is 5-15 μmol / L, preferably 10 μmol / L.

[0040] In the present invention, in step (3), a bridging sequence GAGTACGGTGTGC is added to the 5' end of the second round forward primer;

[0041] The bridging sequence GGATGCTGGATGG was added to the 5' end of the second round reverse primer.

[0042] In the present invention, the PCR system for the second round of PCR amplification in step (3) includes the following components in parts by volume: 1 to 3 parts, preferably 2 parts, of the first round amplification product; 10 to 15 parts, preferably 12.5 parts, of PCR Mix; 0.5 to 2 parts, preferably 1 part, of the second round forward primer; 0.5 to 2 parts, preferably 1 part, of the second round reverse primer; and 5 to 10 parts, preferably 8.5 parts, of ddH2O.

[0043] In the present invention, the PCR conditions for the second round of PCR amplification in step (3) are: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 s; continuous extension at 68°C for 5 min, for a total of 30 to 40 cycles.

[0044] In the present invention, it is characterized in that when each allele of the second-round amplification product is edited, the gene-edited strain is a homozygous gene-edited strain;

[0045] When at least one allele in the second-round amplification product is not edited, the gene-edited strain is a heterozygous gene-edited strain.

[0046] The present invention provides the application of the identification method in detecting and / or identifying the editing type of gene-edited strains of polyploid forest trees.

[0047] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0048] Among the test materials of the present invention, transgenic triploid poplar KD-1, KD-2, KD-3, KD-4, KD-5, KD-6, KD-7, KD-8, and wild-type (WT) strains were obtained from Hebei Agricultural University;

[0049] Among the reagents of the present invention, KOD One PCR MasterMix was purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.

[0050] Example 1: Sanger sequencing identification

[0051] (1) Leaves of transgenic triploid poplar KD-1, KD-2, KD-3, KD-4, KD-5, KD-6, KD-7 and KD-8 were taken and genomic DNA was extracted using the CTAB method disclosed by Yan Jiuying et al. (Yan Jiuying, Ma Changqing, Chang Bo, et al. Improved CTAB method for extracting genomic DNA from apple fruit [J]. Molecular Plant Breeding, 2017, 15(09): 3610-3615). Based on the nucleotide sequence of the Cas9 gene (NCBI ID: txid2838320), primers for amplifying the nucleotide sequence of the Cas9 gene fragment (as shown in SEQ ID NO. 1) were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd. The nucleotide sequences of the primers are shown in Table 1.

[0052] Table 1 Primer sequences for amplifying Cas9 gene fragments

[0053] name Sequence (5'~3') SEQ ID NO. Cas9-F TAACAGGCTCAGCGATTACGAC 2 Cas9-R GTTCCGCTTAGGCAGAATTGAC 3

[0054] The nucleotide sequence of the Cas9 gene fragment is shown in SEQ ID NO.1.

[0055] SEQ ID NO.1:

[0056] TAACAGGCTCAGCGATTACGACGTCGATCATATCGTTCCACAGTCATTCCTGAAGGATGACTCCATTGACAACAAGGTCCTCACCAGGTCGGACAAGAACCGGGGCAAGTCTGATAATGTTCCTTCAGAGGAGGTCGTTAAGAAGATGAAGAACTACTGGCGCCAGCTCCTGAATGCCAAGCTGATCACGCAGCGGAAGTTCGATAACCTCACAAAGGCTGAGAGGGGCGGGCTCTCTGAGCTGGACAAGGCGGGCTTCATCAAGAGGCAGCTGGTCGAGACACGGCAGATCACTAAGCACGTTGCGCAGATTCTCGACTCACGGATGAACACTAAGTACGATGAGAATGACAAGCTGATCCGCGAGGTGAAGGTCATCACCCTGAAGTCAAAGCTCGTCTCCGACTTCAGGAAGGATTTCCAGTTCTACAAGGTTCGGGAGATCAACAATTACCACCATGCCCATGACGCGTACCTGAACGCGGTGGTCGGCACAGCTCTGATCAAGAAGTACCCAAAGCTCGAGAGCGAGTTCGTGTACGGGGACTACAAGGTTTACGATGTGAGGAAGATGATCGCCAAGTCGGAGCAGGAGATTGGCAAGGCTACCGCCAAGTACTTCTTCTACTCTAACATTATGAATTTCTTCAAGACAGAGATCACTCTGGCCAATGGCGAGATCCGGAAGCGCCCCCTCATCGAGACGAACGGCGAGACGGGGGAGATCGTGTGGGACAAGGGCAGGGATTTCGCGACCGTCAGGAAGGTTCTCTCCATGCCACAAGTGAATATCGTCAAGAAGACAGAGGTCCAGACTGGCGGGTTCTCTAAGGAGTCAATTCTGCCTAAGCGGAAC

[0057] (2) PCR amplification was performed using the genomic DNA of each transgenic triploid poplar as a template. The PCR system was 25 μL, including 12.5 μL of KOD One PCR Master Mix, 2 μL of each genomic DNA, 1 μL of Cas9-F primer, 1 μL of Cas9-R primer, and 8.5 μL of deionized water. The PCR conditions were as follows: pre-denaturation at 98°C for 2 min, followed by denaturation at 98°C for 10 s → annealing at 55°C for 5 s → extension at 68°C for 10 s, for a total of 35 cycles, and finally extension at 68°C for 5 min to obtain the amplified product. The amplified product was detected by 1% agarose gel electrophoresis, with the constructed gene editing vector as the positive control and the wild-type strain DNA as the negative control. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing and sequence alignment. The results are shown in the figure. Figures 1-2 shown.

[0058] Sanger sequencing can produce inaccurate sequences at both ends due to voltage issues in the initial reaction, so the impact of this issue can be ignored. The results showed that the amplified products obtained from genomic DNA of the transgenic triploid poplar lines KD-1, KD-2, KD-3, KD-4, KD-5, KD-6, KD-7, and KD-8 all matched the Cas9 gene nucleotide sequence (Target), indicating that all eight triploid poplar lines were successfully transformed.

[0059] Example 2: Identification of gene editing types in polyploid trees

[0060] (1) Based on the location of the gene editing site of the PalMYB3R-1 gene of the transgenic triploid poplar KD-1, KD-2, KD-3, KD-4, KD-5, KD-6, KD-7, KD-8, and WT strains on the genomic DNA, the first round forward primer and the first round reverse primer were designed and commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis. The nucleotide sequences of the primers are shown in Table 2;

[0061] (2) The genomic DNA of each transgenic triploid poplar prepared in Example 1 was used as a template, and the first-round forward primer and the first-round reverse primer were used to perform the first-round PCR amplification, and the WT strain was used as a control; the first-round PCR amplification system included 12.5 μL of KOD One PCR MasterMix, 2 μL of each genomic DNA, 1 μL of each first-round forward primer (10 μmol / L), 1 μL of each first-round reverse primer (10 μmol / L), and 8.5 μL of deionized water; the first-round PCR amplification conditions were: pre-denaturation at 95°C for 2 min, followed by denaturation at 98°C for 10 s → annealing at 55°C for 5 s → extension at 68°C for 20 s, for a total of 35 cycles, and finally extension at 68°C for 5 min to obtain the first-round amplification product;

[0062] (3) Based on the first-round amplification product, the second-round forward primer and the second-round reverse primer were designed, wherein the bridge sequence GAGTACGGTGTGC was added to the 5' end of the second-round forward primer, and the bridge sequence GGATGCTGGATGG was added to the 5' end of the second-round reverse primer. Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize them. The nucleotide sequences of each primer are shown in Table 2. The first-round amplification product was used as a template, and the second-round forward primer and the second-round reverse primer were used for the second-round PCR amplification, and the WT strain was used as a control. The second-round PCR amplification system was 25 μL, including KOD One PCRMaster Mix 12.5 μL, each first-round amplification product 2 μL, second-round forward primer (10 μmol / L) 1 μL, second-round reverse primer (10 μmol / L) 1 μL, and deionized water 8.5 μL; second-round PCR amplification conditions were: 95°C denaturation for 2 min, followed by 98°C denaturation for 10 s → 55°C annealing for 5 s → 68°C extension for 20 s, for a total of 35 cycles, and a final extension at 68°C for 5 min to obtain the second-round amplification product;

[0063] (4) The second round of amplification products were sequenced and analyzed by Hi-TOM (http: / / 121.40.237.174 / Hi-TOM / ). The results are as follows: Figures 3-4 shown.

[0064] Table 2 Primer sequences for amplifying the PalMYB3R-1 gene

[0065]

[0066] The results showed that among the eight transgenic triploid poplar lines, the target sequences of KD-1, KD-2, KD-3, KD-4, KD-6, KD-7, and KD-8 were successfully edited. All three alleles of KD-1, KD-2, KD-3, and KD-7 were edited, so KD-1, KD-2, KD-3, and KD-7 were identified as homozygous gene-edited lines. Two alleles of KD-4 and KD-6 were edited, while only one allele of KD-8 was edited, so KD-4, KD-6, and KD-8 were identified as heterozygous gene-edited lines. This indicates that the identification method of the present invention can effectively distinguish the editing types of gene-edited lines.

[0067] As can be seen from the above examples, the present invention provides a method for identifying the gene editing type of polyploid forest trees and its application. This identification method, through two rounds of PCR amplification combined with HI-TOM sequencing analysis, can identify the editing type of triploid poplar gene-edited strains, thereby obtaining homozygous gene-edited plants. This method overcomes the drawbacks of traditional identification methods and is highly efficient and cost-effective.

[0068] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for identifying the gene editing type of polyploid forest trees, characterized in that: The steps include: (1) Design the first round forward primer and the first round reverse primer according to the location of the gene editing site of the gene editing strain on the genome; (2) Using the genomic DNA of the gene-edited strain as a template, the first round of PCR amplification was performed using the first round forward primer and the first round reverse primer to obtain the first round amplification product; (3) designing a second round of forward primers and a second round of reverse primers based on the first round of amplification products, and using the first round of amplification products as a template, performing a second round of PCR amplification using the second round of forward primers and the second round of reverse primers to obtain the second round of amplification products; (4) Perform Hi-TOM sequencing analysis on the second-round amplification products to obtain Hi-TOM sequencing results.

2. The identification method according to claim 1, wherein The gene-edited strain described in step (1) is a gene-edited polyploid forest tree strain; The concentration of the first-round forward primer is 5-15 μmol / L, and the concentration of the first-round reverse primer is 5-15 μmol / L.

3. The identification method according to claim 1, wherein The PCR system for the first round of PCR amplification in step (2) includes the following components by volume: 1 to 3 parts of genomic DNA, 10 to 15 parts of PCR Mix, 0.5 to 2 parts of the first round forward primer, 0.5 to 2 parts of the first round reverse primer, and 5 to 10 parts of ddH2O.

4. The identification method according to claim 3, wherein Step (2) The PCR conditions for the first round of PCR amplification are: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 s; and continuous extension at 68°C for 5 min, for a total of 30 to 40 cycles.

5. The identification method according to claim 1, wherein In step (3), the concentration of the second round forward primer is 5 to 15 μmol / L, and the concentration of the second round reverse primer is 5 to 15 μmol / L.

6. The identification method according to claim 5, characterized in that In step (3), a bridging sequence GAGTACGGTGTGC is added to the 5' end of the second round forward primer; The bridging sequence GGATGCTGGATGG was added to the 5' end of the second round reverse primer.

7. The identification method according to claim 6, characterized in that Step (3) The PCR system for the second round of PCR amplification includes the following components in parts by volume: 1 to 3 parts of the first round amplification product, 10 to 15 parts of PCR Mix, 0.5 to 2 parts of the second round forward primer, 0.5 to 2 parts of the second round reverse primer, and 5 to 10 parts of ddH2O.

8. The identification method according to claim 7, characterized in that Step (3) The PCR conditions for the second round of PCR amplification are: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 s; continuous extension at 68°C for 5 min, for a total of 30 to 40 cycles.

9. The identification method according to any one of claims 1 to 8, characterized in that When every allele of the second-round amplification product is edited, the gene-edited strain is a homozygous gene-edited strain; When at least one allele in the second-round amplification product is not edited, the gene-edited strain is a heterozygous gene-edited strain.

10. Use of the identification method according to any one of claims 1 to 9 in detecting and / or identifying the editing type of gene-edited polyploid forest tree lines.

Images