Kluyveromyces marxianus engineering strain and application thereof in high-temperature fermentation production of 3-hydracrylic acid

Abstract

The invention discloses a Kluyveromyces marxianus engineering strain and an application thereof in high-temperature fermentation production of 3-hydracrylic acid, which are characterized in that heat-resistant Kluyveromyces marxianus is used as a platform, a gene editing technology is utilized, a glycerin metabolism way of the Kluyveromyces marxianus is reconstructed, and MCRN940V / K1106W / S1114R mutant gene is over-expressed to finally obtain a YZB521 strain. Under the aerobic condition of 37-42 DEG C, 21.26 g / L of 3-hydracrylic acid and 23.95 g / L of 3-hydracrylic acid can be synthesized through glycerol fed-batch fermentation, and 10.31 g / L of 3-hydracrylic acid and 9.02 g / L of 3-hydracrylic acid can be synthesized through industrial waste glycerol fed-batch fermentation.

Description

Technical Field

[0001] The invention belongs to the fields of microbial metabolic engineering and microbial fermentation engineering, and particularly relates to an engineered Kluyveromyces marxianus strain and its application in producing 3-hydroxypropionic acid by fermentation at high temperature. Background Art

[0002] 3-Hydroxypropionic acid (3-HP) is an important chemical intermediate that has emerged in recent years. It can be used in the synthesis of a variety of chemical products and is a precursor to many important chemical substances such as acrylic acid, malonic acid, and the biodegradable plastic poly (3-hydroxypropionic acid). It can also be used as an additive and preservative in food or feed, and has certain food application value. 3-HP is also a precursor of many optically active substances and can be used as a monomer for bio-sourced polymers, with a wide range of industrial application value.

[0003] Currently, the main methods for producing 3-hydroxypropionic acid are chemical and biological methods. However, traditional chemical methods use non-renewable resources, produce numerous byproducts, are difficult to separate, and are prone to environmental pollution. Consequently, biological methods have become a research hotspot in recent years. These methods utilize substrates such as propanol, propionic acid, and propionaldehyde through the metabolic activity of microorganisms to produce 3-hydroxypropionic acid. This method offers advantages such as environmental friendliness and sustainability. Although microbial methods can achieve high yields with certain strains, they are often limited by stringent requirements regarding substrate concentration, temperature, pH, and oxygen availability. Furthermore, microbial growth and production processes are susceptible to various environmental factors, leading to decreased fermentation performance and productivity. Furthermore, the production process also presents risks such as contamination. Therefore, the production of 3-hydroxypropionic acid using microbial methods presents numerous challenges. Selecting suitable and reliable strains and improving reaction conditions are currently key research priorities for microbial production of 3-hydroxypropionic acid.

[0004] Kluyveromyces marxianus (K. marxianus) is an unconventional thermotolerant yeast, commonly known as a heat-resistant yeast. It exhibits high temperature tolerance (optimum at 37°C, capable of maintaining efficient fermentation at 42°C), rapid growth (one generation in 40 minutes under optimal conditions, compared to 2 hours for S. cerevisiae), and the ability to utilize various carbon sources, such as xylose, inulin, and glycerol, that are not readily available to S. cerevisiae. These advantages make it ideal for the development of simultaneous saccharification and fermentation of cellulose or lignocellulosic biomass into high-value chemicals. Furthermore, K. marxianus is a GRAS (generally regarded as safe) yeast widely used in dairy and wine fermentation, and is considered safe for the environment, animals, and humans. The heat tolerance and rapid growth of K. marxianus offer excellent advantages for strain improvement for the microbial production of 3-hydroxypropionic acid (3-HPA). However, there are currently no reports on the development of 3-HPA production using K. marxianus.

[0005] Microorganisms generate a significant amount of heat during industrial fermentation. If temperature control is not implemented, this heat, generated during the microbial metabolism process, can cause the fermentation system temperature to rise. Microbial growth and metabolism are highly sensitive to temperature. Maintaining an appropriate temperature range is crucial for efficient microbial growth and metabolism. Excessively high or low temperatures can affect microbial activity, and thus the yield and quality of the fermentation product. Cooling water, passing through equipment such as heat exchangers, removes the heat generated during the fermentation process, thereby maintaining the fermentation system temperature within an appropriate range. Summary of the Invention

[0006] To address the shortcomings of the aforementioned prior art, the present invention provides a thermotolerant engineered Kluyveromyces marxianus strain and its use in the fermentative production of 3-hydroxypropionic acid. Through genetic engineering and breeding, the present invention has obtained the thermotolerant Kluyveromyces marxianus engineered strain YZB521, which can efficiently produce 3-hydroxypropionic acid at high temperatures using substrates such as glycerol and waste glycerol, an industrial byproduct. Compared to other reported strains, it produces 3-hydroxypropionic acid at high temperatures (37-42°C) (producing 21.26 g / L and 23.95 g / L of 3-hydroxypropionic acid from glycerol at 37 and 42°C, respectively). Therefore, the present invention has great application prospects in the efficient bioconversion of biomass to produce high-value-added products.

[0007] The Kluyveromyces marxianus engineered strain YZB521 of the present invention is classified and named: Kluyveromyces marxianus, and has been deposited in the General Microbiology Center (CGMCC) of the China Culture Collection Administration of Microorganisms, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, deposit date: July 8, 2024, deposit number: CGMCC NO.31223.

[0008] The present invention uses K. marxianus NBRC1777 strain as a host to construct an engineered strain that knocks out GUT1, GUT2, and GCY1 and simultaneously expresses OpGDH1, CjFPS1, and KmDKA1. The glycerol metabolic pathway of the engineered strain is reconstructed, and the codon-optimized synthetic MCR from Chloroflexus aurantiacus is recombinantly expressed. N940V / K1106W / S1114R Mutant genes were used to obtain an engineered strain that could efficiently utilize glycerol and glucose to produce 3-hydroxypropionic acid.

[0009] The method for constructing an engineered yeast strain of the present invention is to use wild-type thermotolerant yeast NBRC1777 as a base, knock out its URA3 gene, and obtain recombinant strain YZB040, which can use URA3 as an auxotrophic screening tag. The KU70 gene of YZB040 is then knocked out to construct engineered strain YZB100 with efficient homologous recombination ability. Subsequently, the URA3 gene in YZB100 is knocked out again to obtain YZB101. Based on YZB101, the GUT2 gene is knocked out to obtain strain YZB154. The URA3 gene of YZB154 is then knocked out as a tag for subsequent transformation experiments to obtain strain YZB155. Based on YZB155, the GUT1 gene is knocked out to obtain strain YZB177. The URA3 gene of YZB177 is then knocked out to obtain strain YZB192. The GCY1 gene in strain YZB192 was subsequently knocked out to create strain YZB195. The specific construction process was based on existing technology (Ren LL, LiuYY, Xia YT, et al. Improving glycerol utilization during high-temperature xylitol production with Kluyveromyces marxianus using a transient clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 system. Bioresource Technology, 2022; 365:128179). YZB195 is a deletion strain of the GUT1, GUT2, and GCY1 genes, thus losing the original glycerol metabolism pathway.

[0010] The URA3 gene in YZB195 was knocked out to generate strain YZB196. The OpGDH1 gene from Hansenula parapolymorpha was further overexpressed in YZB196 to generate strain YZB203. The URA3 gene in YZB203 was knocked out to generate strain YZB204. Subsequently, the glycerol transporter CjFPS1 gene from Cyberlindnera jadinii was overexpressed to generate strain YZB218. The URA3 gene in strain YZB218 was knocked out to generate strain YZB301. The endogenous KmDKA1 gene was further overexpressed to generate strain YZB307. The URA3 gene in YZB307 was knocked out to generate strain YZB313. Finally, the 3-hydroxypropionate synthase gene MCR was overexpressed in strain YZB313 to generate the target strain YZB521. The 3-hydroxypropionic acid synthesis ability of the obtained strains was compared through fermentation. The unmodified strain could synthesize 0.025 g / L 3-hydroxypropionic acid using YPG, while the engineered strain YZB521 could synthesize 2.22 g / L 3-hydroxypropionic acid, an increase of 88 times.

[0011] The method for constructing the Kluyveromyces marxianus engineered strain YZB521 of the present invention specifically comprises the following steps:

[0012] Step 1: Using plasmid pMD18T-ΔScURA3 as a template, amplify the ScURA3 knockout fragment, introduce the ScURA3 knockout fragment into YZB195, and knock out the URA3 gene in strain YZB195 again as a screening tag. The obtained strain is named YZB196.

[0013] Step 2: General Biotech was commissioned to codon-optimize the OpGDH1 gene (SEQ ID NO: 31) and synthesize and clone it into the pZB023 vector to obtain plasmid pZB088. Using plasmid pZB088 as a template, primers URA3-M13-F and URA3-M13-R were used to PCR amplify the OpGDH1 gene expression cassette; using plasmid pZB089 as a template, primers SNR52-SMAI-F (sequence 1) and URA3-SNR52-R (sequence 2) were used, and PCR amplification with Fast Pfu DNA polymerase was performed to obtain the SNR52p-sgRNA (URA3) gene fragment; using plasmid pZB090 as a template, primers URA3-CYC1T-F (sequence 3) and CYC1T-SMAI-R (sequence 4) were used, and PCR amplification with Fast Pfu DNA polymerase was performed to obtain the sgRNA (URA3)-CAN1.Y-SUP4t-CYC1t gene fragment; The SNR52p-sgRNA(URA3)-CAN1.Y-SUP4t-CYC1t fragment was fused to the SNR52p-sgRNA(URA3) and sgRNA(URA3)-CAN1.Y-SUP4t-CYC1t fragment using primers SNR52-SMAI-F (SEQ ID NO: 1) and CYC1T-SMAI-R (SEQ ID NO: 4). The CAS9 gene expression fragment was amplified by PCR using primers M13-F (SEQ ID NO: 5) and M13-R (SEQ ID NO: 6) using plasmid p414 as a template. The OpGDH1 gene expression cassette, Cas9 gene expression cassette, and SNR52p-sgRNA(URA3)-CAN1.Y-SUP4t-CYC1t fragment were introduced into YZB196, integrating the OpGDH1 gene expression cassette into the URA3 gene. The resulting strain was named YZB203.

[0014] Step 3: Using plasmid pMD18T-ΔScURA3 as a template, PCR amplify the ScURA3 knockout fragment, introduce the ScURA3 knockout fragment into YZB203, and knock out the URA3 gene in strain YZB203 again as a screening tag. The obtained strain was named YZB204.

[0015] Step 4: We commissioned General Bio to codon-optimize the CjFPS1 gene (SEQ ID NO: 32) and synthesize and clone it into the pZB023 vector to generate plasmid pZB088. Using plasmid pZB087 as a template, we PCR-amplified the CjFPS1 gene expression cassette using primers XYL2-M13-F (SEQ ID NO: 7) and XYL2-M13-R (SEQ ID NO: 8). Using plasmid pZB089 as a template, we used primers SNR52-SMAI-F (SEQ ID NO: 1) and XYL2-SNR52-R (SEQ ID NO: 9), and Fast Pfu DNA polymerase to amplify the SNR52p-sgRNA (XYL2) gene fragment. Using plasmid pZB090 as a template, we used primers XYL2-CYC1T-F (SEQ ID NO: 10) and CYC1T-SMAI-R (SEQ ID NO: 4), and Fast Pfu DNA polymerase to amplify the SNR52p-sgRNA (XYL2) gene fragment. DNA polymerase was used for PCR amplification to obtain the sgRNA(XYL2)-CAN1.Y-SUP4t-CYC1t gene fragment; primers SNR52-SMAI-F (sequence 1) and CYC2T-SMAI-R (sequence 4) were used to fuse the fragments SNR52p-sgRNA(XYL2) and sgRNA(XYL2)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA(XYL2)-CAN1.Y-SUP4t-CYC2t fragment; using plasmid p414 as a template, primers M13-F (sequence 5) and M13-R (sequence 6) were used to PCR amplify the CAS9 gene expression fragment. The CjFPS1 gene expression cassette, Cas9 gene expression cassette, and SNR52p-sgRNA (XYL2)-CAN1.Y-SUP4t-CYC1t fragment obtained above were introduced into YZB204, so that the strain integrated the CjFPS1 gene expression cassette into the position of the XYL2 gene and restored the function of the URA3 gene. The resulting strain was named YZB298.

[0016] Step 5: Use the same method as step 11 to knock out the URA3 gene of strain YZB218 to obtain strain YZB301.

[0017] Step 6: The KmDAK1 gene (SEQ ID NO: 33) was cloned into the pZJ042 vector to generate plasmid pZB007. The KmDKA1 gene expression cassette was amplified by PCR using primers XYL1-M13-F (SEQ ID NO: 11) and M13-R (SEQ ID NO: 12) using plasmid pZB007 as a template. The URA3 gene expression cassette was amplified by PCR using primers M13UPRM13-F (SEQ ID NO: 13) and XYLI-M13-R (SEQ ID NO: 14) using plasmid pZB075 as a template. The SNR52p-sgRNA (XYL1) gene fragment was obtained by PCR amplification using plasmid pZB089 as a template, primers SNR52-SMAI-F (sequence 1) and XYL1-SNR52-R (sequence 15), and Fast Pfu DNA polymerase. The SNR52p-sgRNA (XYL1) gene fragment was obtained by PCR amplification using plasmid pZB090 as a template, primers XYL1-CYC1T-F (sequence 16) and CYC1T-SMAI-R (sequence 4), and Fast Pfu DNA polymerase was used for PCR amplification to obtain the sgRNA(XYL1)-CAN1.Y-SUP4t-CYC1t gene fragment; primers SNR52-SMAI-F (sequence 1) and CYC1T-SMAI-R (sequence 4) were used to fuse the fragments SNR52p-sgRNA(XYL1) and sgRNA(XYL1)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA(XYL1)-CAN1.Y-SUP4t-CYC1t fragment; using plasmid p414 as a template, primers M13-F (sequence 5) and M13-R (sequence 6) were used to PCR amplify the CAS9 gene expression fragment. The KmDKA1 gene expression cassette, URA3 gene expression cassette, Cas9 gene expression cassette, and SNR52p-sgRNA (XYL1)-CAN1.Y-SUP4t-CYC1t fragment obtained above were introduced into YZB301, so that the strain integrated the KmDKA1 gene expression cassette into the position of the XYL1 gene, and at the same time restored the function of the URA3 gene in the strain. The resulting strain was named YZB307.

[0018] Step 7: Knock out the URA3 gene in YZB307 again to obtain strain YZB313.

[0019] Step 8: Commission General Bio to codon optimize CaMCR N940V / K1106W / S1114R The gene (SEQ ID NO: 34) was synthesized and cloned into the pZB023 vector to obtain plasmid pZB216. The CaMCR gene was amplified by PCR using primers LAC4-M13-F (SEQ ID NO: 17) and LAC4-M13-R (SEQ ID NO: 18). N940V / K1106W / S1114RMutant gene expression cassette. Using plasmid pZB089 as a template, primers SNR52-SMAI-F (SEQ ID NO: 1) and LAC4-SNR52-R (SEQ ID NO: 19) were used to amplify the SNR52p-sgRNA (LAC4) gene fragment using Fast Pfu DNA polymerase. Using plasmid pZB090 as a template, primers LAC4-CYC1T-F (SEQ ID NO: 20) and CYC1T-SMAI-R (SEQ ID NO: 4) were used to amplify the sgRNA (LAC4)-CAN1.Y-SUP4t-CYC1t gene fragment using Fast Pfu DNA polymerase. The primers SNR52-SMAI-F (sequence 1) and CYC2T-SMAI-R (sequence 4) were used to fuse the fragments SNR52p-sgRNA (LAC4) and sgRNA (LAC4)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA (XYL2)-CAN1.Y-SUP4t-CYC2t fragment; using plasmid p414 as a template, primers M13-F (sequence 5) and M13-R (sequence 6) were used to PCR amplify the CAS9 gene expression fragment. The CAS9 gene fragments and CaMCR obtained above were combined. N940V / K1106W / S1114R The mutant gene expression cassette and SNR52p-sgRNA(MCR)-CAN1.Y-SUP4t-CYC1t were integrated into strain YZB313 to obtain strain YZB521 capable of producing 3-hydroxypropionic acid (3-HP).

[0020] The plasmids used in the preparation process of the present invention can be prepared by conventional existing technologies. The functions and sources of the plasmids are as follows:

[0021] ① Plasmid pMD18T-ΔURA3 contains a knockout cassette for the URA3 gene, which is used to knock out the uracil biosynthesis gene URA3 in uracil prototrophic Kluyveromyces marxianus strains, thereby generating a strain deficient in uracil biosynthesis. Therefore, the URA3 gene can serve as a selection marker for genetic transformation of uracil biosynthesis-deficient strains. This plasmid was constructed by the inventors. The detailed construction process is described in the prior art (Zhang J, Zhang B, Wang DM, et al. Rapid ethanol production at elevated temperatures by engineered thermotolerant Kluyveromyces marxianus via the NADP(H)-preferring xylose reductase-xylitol dehydrogenase pathway. Metab Eng, 2015; 31:140-152).

[0022] Plasmid p414 contains the expression cassette of the Cas9 gene required for gene editing and was purchased from Addgene.

[0023] Plasmid pZB023 contains the promoter P required for yeast expression PGK1 The specific construction process of the URA3 gene and terminator is described in the prior art (Ren LL, Liu YY, Xia YT, et al. Improving glycerol utilization during high-temperature xylitol production with Kluyveromyces marxianus using a transient clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 system. Bioresource Technology, 2022; 365: 128179).

[0024] Plasmid pZB075 contains the URA3 gene tag required for yeast transformation and screening. This plasmid was constructed by the inventors. The specific construction process can be found in the prior art (Ren LL, Liu YY, Xia YT, et al. Improving glycerol utilization during high-temperature xylitol production with Kluyveromyces marxianus using a transient clustered regularly interspaced short palindromicrepeats (CRISPR) / CRISPR-associated protein 9 system. Bioresource Technology, 2022; 365:128179).

[0025] Plasmid pZB087, containing a codon-optimized OpGDH gene expression cassette, was synthesized by General Biotech.

[0026] Plasmid pZB088 contains a codon-optimized CjFPS1 gene expression cassette and was synthesized by General Biotech.

[0027] Plasmid pZB089 contains the SNR52 promoter required for guide RNA (gRNA) expression and is used to amplify the SNR52 promoter, followed by fusion PCR to obtain the gRNA transcription frame. This plasmid was constructed by the inventors. The detailed construction process is described in the prior art (Ren LL, Liu YY, Xia YT, et al. Improving glycerol utilization during high-temperature xylitol production with Kluyveromyces marxianus using a transient clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 system. Bioresource Technology, 2022; 365:128179).

[0028] Plasmid pZB090 contains the CYC1 terminator required for guide RNA (gRNA) expression and is used to amplify the CYC1 terminator, followed by fusion PCR to obtain the gRNA transcription frame. This plasmid was constructed by the inventors. For detailed construction procedures, please refer to the prior art (Ren LL, Liu YY, Xia YT, et al. Improving glycerol utilization during high-temperature xylitol production with Kluyveromyces marxianus using a transient clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 system. Bioresource Technology, 2022; 365:128179).

[0029] Plasmid pZB216 contains the codon-optimized CaMCR N940V / K1106W / S1114R The mutant gene expression cassette was synthesized by General Biotechnology.

[0030] The invention discloses an application of the Kluyveromyces marxianus engineered strain YZB521 in the fermentation production of 3-hydroxypropionic acid.

[0031] Specifically, under high-temperature aerobic conditions, the Kluyveromyces marxianus engineered strain YZB521 can utilize 40 g / L glycerol or waste glycerol for efficient production of 3-HP by batch or fed-batch aerobic fermentation.

[0032] Using YPG medium as the reaction system, the initial inoculum size is 10% of the fermentation broth volume. No additional additives are required during the fermentation process. Here, the inoculum size is 10% of the fermentation broth volume, where the fermentation broth volume is the same as the YPD medium volume.

[0033] The number of viable bacteria in the YZB521 seed solution at the time of inoculation ranged from 1×10 7 to 1×10 9 pieces / mL.

[0034] The fermentation temperature is 37-42℃.

[0035] The present invention uses the thermotolerant Kluyveromyces marxianus as a platform and utilizes genetic engineering and metabolic engineering methods to knock out its own glycerol decomposition-related GUT1, GUT2 and GCY1 genes. At the same time, a heterologous glycerol metabolic pathway with NADH as a coenzyme was reconstructed. On this basis, the codon-optimized CaMCR N940V / K1106W / S1114R Mutant gene. The constructed strain YZB521 can produce 21.26 g / L 3-hydroxypropionic acid from glycerol under aerobic conditions at 37°C; even under aerobic conditions at 42°C, it can still synthesize 23.95 g / L 3-hydroxypropionic acid from glycerol. The research results of this invention will expand the platform for the biosynthesis of 3-hydroxypropionic acid and provide a new chassis for fermentation using inexpensive substrates. The heat-resistant yeast engineered strain YZB521 of the present invention is of great significance for the microbial production of 3-hydroxypropionic acid under high-temperature fermentation.

[0036] The beneficial effects of the present invention are embodied in:

[0037] This project utilizes techniques and methods from genetic engineering, metabolic engineering, molecular biology, and synthetic biology to rationally design a glycerol production pathway. Combining the efficiency and pollution-free nature of biosynthesis with the sustainable availability of natural fermentation feedstock, this project uses Kluyveromyces marxianus as a platform to construct an effective engineered strain for 3-hydroxypropionic acid production. This strain uses glycerol, an inexpensive industrial byproduct, as a substrate to produce 3-hydroxypropionic acid. The successful implementation of this project provides a low-cost, highly efficient, and green resource for the utilization of waste glycerol, an industrial byproduct. YZB521 produced 13.53 g / L 3-hydroxypropionic acid from 40 g / L glycerol at 37°C, 450 rpm, and 1 vvm; 21.26 g / L 3-hydroxypropionic acid from glycerol fed-batch fermentation at 37°C, 450 rpm, and 1 vvm; 23.95 g / L 3-hydroxypropionic acid from glycerol fed-batch fermentation at 42°C, 450 rpm, and 1 vvm; 10.31 g / L 3-hydroxypropionic acid from waste glycerol fed-batch fermentation at 37°C, 450 rpm, and 1 vvm; and 9.02 g / L 3-hydroxypropionic acid from waste glycerol fed-batch fermentation at 42°C, 450 rpm, and 1 vvm. This strain is of great significance for the development of high-value-added 3-hydroxypropionic acid production from waste fermentation. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a map of plasmid p414.

[0039] Figure 2 A map of plasmid pZB023.

[0040] Figure 3 A map of plasmid pZB075 is shown.

[0041] Figure 4 A map of plasmid pZB087 is shown.

[0042] Figure 5 A map of plasmid pZB088 is shown.

[0043] Figure 6 A map of plasmid pZB089 is shown.

[0044] Figure 7 A map of plasmid pZB090.

[0045] Figure 8 A map of plasmid pZB216 is shown.

[0046] Figure 9 Comparison of the synthesis of 3-hydroxypropionic acid by YPG between wild type WT and YZB521.

[0047] Figure 10Figure A shows the results of 3-hydroxypropionic acid production by Kluyveromyces marxianus engineered strain YZB521 using 40 g / L glycerol (37°C); Figure B shows the results of 3-hydroxypropionic acid production by Kluyveromyces marxianus engineered strain YZB521 using glycerol fed-batch fermentation (37°C); Figure C shows the results of 3-hydroxypropionic acid production by Kluyveromyces marxianus engineered strain YZB521 using glycerol fed-batch fermentation (42°C); Figure D shows the results of 3-hydroxypropionic acid production by Kluyveromyces marxianus engineered strain YZB521 using waste glycerol fed-batch fermentation (37°C); Figure E shows the results of 3-hydroxypropionic acid production by Kluyveromyces marxianus engineered strain YZB521 using waste glycerol fed-batch fermentation (42°C).

[0048] Figure 11 It is a schematic diagram of the preparation process of the present invention. DETAILED DESCRIPTION

[0049] Reagents and strains: All reagents in the present invention are of commercially available reagent grade or higher purity. Among them, glycerol, ethyl yeast basic nitrogen source, uracil, gel recovery kit and all restriction endonucleases are from Shanghai Sangon Biotechnology Co., Ltd. T4 DNA ligase was purchased from Dalian Bao Biotechnology Co., Ltd. Fast Pfu and Fast Taq DNA polymerase were purchased from Chuzhou Tolu Port Biological Co., Ltd. Escherichia coli XL10-gold strain was used as the host bacteria for DNA manipulation (Stratagene, California, USA), and Luria-Bertani (LB) medium containing 100 μg / mL ampicillin was used to culture E. coli. Synthetic medium (YNB glucose 20 g / L, yeast basic nitrogen source 6.7 g / L, uracil 20 mg / mL) was mainly used for transformation. Plasmids p414, pZB075, pZB089 and pZB090 were all obtained by conventional methods. YPD medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose) was used for yeast pre-culture, and YNB medium (6.7 g / L yeast basic nitrogen source plus 20 g / L various carbon sources) was used for fermentation culture.

[0050] The Kluyveromyces marxianus engineered strain YZB521 of the present invention is classified and named as Kluyveromyces marxianus, and the deposit unit is the General Microbiology Center of China Culture Collection Administration (CGMCC), the address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is July 8, 2024, and the deposit number is CGMCC NO.31223.

[0051] Primer sequences used in the preparation process:

[0052] Sequence 1 - SEQ ID NO:1 (SNR52 - SMAI - F)

[0053] TCCCCCGGGTCTTTGAAAAGATAATGTATG

[0054] Sequence 2 - SEQ ID NO:2 (URA3 - SNR52 - R)

[0055] CAACTAATCTTAACAACTCTGATCATTTATCTTTCACTGC

[0056] Sequence 3 - SEQ ID NO:3 (URA3 - CYC1T - F)

[0057] AGAGTTGTTAAGATTAGTTGGTTTTAGAGCTAGAAATAGC

[0058] Sequence 4 - SEQ ID NO:4 (CYC1T - SMAI - R)

[0059] TCCCCCGGGCAAATTAAAGCCTTCGAGC

[0060] Sequence 5 - SEQ ID NO:5 (M13 - F)

[0061] CGCCAGGGTTTTCCCAGTCACGAC

[0062] Sequence 6 - SEQ ID NO:6 (M13 - R)

[0063] AGCGGATAACAATTTCACACAGGA

[0064] Sequence 7 - SEQ ID NO:7 (XYL2 - M13 - F)

[0065] ATGACCAACACTCAAAAAGCCGTTGTTTTGAAGAAGCAAGGAGAGATTGCTTTCGAAGAGAGGGTTTTCCCAGTCACGAC

[0066] Sequence 8 - SEQ ID NO:8 (XYL2 - M13 - R)

[0067] TCATTCTGGACCATCAATGATAGTCTTGACAACTTCATTACCGTGATCTCTGTTGAAATTAGCGGATAACAATTTCACAC

[0068] Sequence 9 - SEQ ID NO:9 (XYL2 - SNR52 - R)

[0069] GTCTTCTTGATGTGAACCTTGATCATTTATCTTTCACTGC

[0070] Sequence 10 - SEQ ID NO:10 (XYL2 - CYC1T - F)

[0071] AAGGTTCACATCAAGAAGACGTTTTAGAGCTAGAAATAGC

[0072] Sequence 11 - SEQ ID NO:11 (XYL1 - M13 - F)

[0073] ATGACATACCTCGCACCAACAGTTACCTTGAACAATGGATCCAAGATGCCAGGGTTTTCCCAGTCACGAC

[0074] Sequence 12 - SEQ ID NO:12 (M13R - R)

[0075] AGCGGATAACAATTTCACACAGGA

[0076] [[ID=L24]]Sequence 13 - SEQ ID NO:13 (M13UPRM13 - F)

[0077] GCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTTGCAAGGCGATTAAGTTGGG

[0078] Sequence 14 - SEQ ID NO:14 (XYL1 - M13 - R)

[0079] TTAGATAAAGGTTGGGAATTCGTTGCCCAACCAGTCCCATGGGTCGTTAAAGCGGATAACAATTTCACAC <L

[0080] Sequence 15 - SEQ ID NO:15 (XYL1 - SNR52 - R)

[0081] CGTCTTGTTGAAGTGGTCCAGATCATTTATCTTTCACTGC

[0082] Sequence 16 - SEQ ID NO:16 (XYL1 - CYC1T - F)

[0083] TGGACCACTTCAACAAGACGGTTTTAGAGCTAGAAATAGC

[0084] Sequence 17 - SEQ ID NO:17 (LAC4 - M13 - F)

[0085] ATGTCTTGCCTTATTCCTGAGAATTTAAGGAACCCTAAAAAGGTTCACGAAAATAGATTGAGGGTTTTCCCAGTCACGAC

[0086] Sequence 18 - SEQ ID NO:18 (LAC4 - M13 - R)

[0087] CCATTCTCCTCGTTCAACAAAGAGCTTGCATCGTAAACTTTAGATCCATCTTCAGGTTCGAGCGGATAACAATTTCACAC

[0088] Sequence 19 - SEQ ID NO:19 (LAC4 - SNR52 - R)

[0089] GAGAGCCACCATTGATCTTGGATCATTTATCTTTCACTGC

[0090] Sequence 20 - SEQ ID NO:20 (LAC4 - SNR52 - R)

[0091] CAAGATCAATGGTGGCTCTCGTTTTAGAGCTAGAAATAGC

[0092] Sequence 21 - SEQ ID NO:21 (KmURA3 - F)

[0093] ATGTCGACTAAGAGTTACTCGGAA

[0094] Sequence 22 - SEQ ID NO:22 (KmURA3 - R)

[0095] TTAAGCGGATCTGCCTACT

[0096] Sequence 23 - SEQ ID NO:23 (URA3 - F)

[0097] ATGTCGACTAAGAGTTACTC

[0098] Sequence 24 - SEQ ID NO:24 (URA3 - R)

[0099] TTAAGCGGATCTGCCTACTC

[0100] Sequence 25-SEQ ID NO:25 (XYL2-F)

[0101] ATGACCAACACTCAAAAAGCCGT

[0102] Sequence 26-SEQ ID NO:26 (XYL2-R)

[0103] TCATTCTGGACCATCAATGATAGT

[0104] Sequence 27-SEQ ID NO:27 (XYL1-F)

[0105] ATGACATACCTCGCACCAAC

[0106] Sequence 28-SEQ ID NO:28 (XYL1-R)

[0107] TTAGATAAAGGTTGGGAATTC

[0108] Sequence 29-SEQ ID NO:29 (LAC4-F)

[0109] ATGTCTTGCCTTATTCCTGAG

[0110] Sequence 30-SEQ ID NO:30 (LAC4-R)

[0111] CCATTCTCCTCGTTCAACAAAG

[0112] SEQ ID NO:31 (OpGDH)

[0113]

[0114] Sequence 32-SEQ ID NO:32 (CjFPS1)

[0115]

[0116] Sequence 33-SEQ ID NO:33 (DAK1)

[0117]

[0118] Sequence 34-SEQ ID NO:34 (MCR N940V / K1106W / S1114R )

[0119]

[0120] Example 1: Preparation of strains

[0121] 1. The specific steps for extracting the Kluyveromyces marxianus genome are as follows:

[0122] ① Pick a single colony and inoculate it into 5 mL of liquid YPD medium. Incubate at 37°C, 250 rpm for 24 h.

[0123] ② Centrifuge at 12,000 rpm for 5 seconds at room temperature to collect the bacteria and discard the supernatant.

[0124] ③ Resuspend the cells in 500 μL of distilled water, centrifuge at 12,000 rpm for 5 sec to harvest the cells, and discard the supernatant.

[0125] ④ Resuspend the bacteria in 200 μL of 1× breaking buffer (Triton X-100 (2% (w / v)), SDS (1% (w / v)), NaCl (100 mM), Tris-Cl (10 mM, pH 8.0), EDTA (1 mM)) and transfer the bacterial solution into an EP tube containing 0.3 g of glass beads (425-600 um, Sigma, USA).

[0126] ⑤ After adding 200 μL of phenol-chloroform solution, shake at high speed for 3 min, add 200 μL of 1×TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and shake gently.

[0127] ⑥ Centrifuge at 12,000 rpm for 5 min, transfer the top layer of supernatant into a new EP tube, and add 1 mL of pre-cooled anhydrous ethanol.

[0128] ⑦ Centrifuge at 12,000 rpm and 4°C for 10 min, discard the supernatant, dry the pellet at room temperature, and resuspend it in 400 μL of 1×TE.

[0129] ⑧ Add 2 μL RNase (RNA hydrolase, Shanghai Sangon Biotechnology, China, 2 mg / mL) into the EP tube, mix well, and digest at 37°C for 1 h.

[0130] ⑨ Add 40 μL of 3 M sodium acetate (pH 5.2) to the tube, mix well, and add 1 mL of pre-chilled anhydrous ethanol.

[0131] ⑩ Centrifuge at 12,000 rpm at 4°C for 30 min, discard the supernatant, and dry at room temperature. Resuspend the pellet in 100 μL of sterile water. This is the yeast genomic DNA.

[0132] 2. Introducing foreign DNA into Kluyveromyces marxianus:

[0133] ① Streak the strain to be transformed on a YPD plate and culture at 37°C for 24 h.

[0134] ② Take 5 mL of liquid YPD and pick single clones on the YPD plate. Incubate at 37°C, 250 rpm for 18 h.

[0135] ③ Transfer 1 mL of the culture to a 50 mL Erlenmeyer flask filled with 9 mL of liquid YPD and culture on a shaker at 37°C and 250 rpm for 5 h.

[0136] ④ Remove the culture and centrifuge at 5000 rpm for 3 min at room temperature. Discard the supernatant and retain the bacteria.

[0137] ⑤ Prepare 1 mL of transformation buffer: 800 μL 50% PEG4000, 50 μL 4 M lithium acetate, 50 μL ddH2O, and 100 μL 1 M DTT (dissolved in 10 mM sodium acetate, pH 5.2).

[0138] ⑥ Resuspend the cells in 200 μL of transformation buffer, centrifuge at 5000 rpm for 3 min, and discard the supernatant.

[0139] ⑦ Resuspend the cells in 100 μL of transformation buffer, add 5 μL (1-10 μg) of the linearized plasmid to be transformed, and shake gently for 30 seconds.

[0140] ⑧ Incubate in a water bath at 47°C for 15 min.

[0141] ⑨ Spread the cells onto synthetic medium containing leucine (Leu) or uracil (Ura) and culture at 37°C for 2 days.

[0142] Single colonies on the plate were picked and cultured in liquid YPD, the genome was extracted, and the transformation results were identified by PCR.

[0143] 3. Construction of YZB196

[0144] Using the pMD18T-ΔURA3 knockout fragment as a template, the URA3 knockout fragment was amplified by PCR using primers URA3-F (SEQ ID NO: 23) and URA3-R (SEQ ID NO: 24). The URA3 knockout fragment was introduced into YZB195. After homologous recombination, the URA3 gene in YZB195 was knocked out, resulting in the loss of uracil synthesis. The ScURA3 knockout strain was selected on synthetic medium containing uracil (formula: 20 g / L glucose, 6.7 g / L yeast basic nitrogen base, 2 mg / mL uracil, 15 g / L agar) and 5'-FOA plates. The resulting strain was named YZB196.

[0145] 4. Construction of YZB203

[0146] ① Using plasmid pZB089 as a template and primers SNR52-SMAI-F and URA3-SNR52-R, PCR amplification was performed using FastPfu DNA polymerase to obtain the SNR52p-sgRNA (URA3) gene fragment;

[0147]

[0148] ② Using plasmid pZB090 as a template, primers URA3-CYC1T-F and CYC1T-SMAI-R were used, and PCR amplification was performed using FastPfu DNA polymerase to obtain the sgRNA (URA3)-CAN1.Y-SUP4t-CYC1t gene fragment;

[0149]

[0150] ③Use primers SNR52-SMAI-F and CYC1T-SMAI-R to fuse the fragments SNR52p-sgRNA(URA3) and sgRNA(URA3)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA(URA3)-CAN1.Y-SUP4t-CYC1t fragment;

[0151]

[0152] ④ Using plasmid pZB088 as a template, primers URA3-M13-F and URA3-M13-R, and Fast Pfu DNA polymerase, PCR amplification was performed to obtain the OpGDH1 gene expression fragment.

[0153]

[0154] ⑤ The gene products obtained from steps ③ and ④ were concentrated by ethanol precipitation. Competent cells of Kluyveromyces marxianus YZB196 were prepared by the lithium acetate method. The gene products were introduced into the competent cells by heat shock transformation. The transformants were plated on synthetic yeast medium (0.67% YNB + 2% glucose, where YNB is the basic nitrogen source for yeast) and positive transformants were screened by nutritional deficiency complementation.

[0155] ⑥ Streak out the transformants grown on synthetic yeast medium to obtain single colonies. Inoculate the single colony into a liquid YPD test tube and culture overnight.

[0156] ⑦ Extract the genome from the test tube bacterial solution using the glass bead method.

[0157] ⑧ Use specific primers to identify the positive clone in which the target gene was knocked out in the transformant and name it YZB203.

[0158]

[0159] 5. Construction of YZB204

[0160] Using the pMD18T-ΔURA3 knockout fragment as a template, the URA3 knockout fragment was amplified by PCR using primers URA3-F (SEQ ID NO: 23) and URA3-R (SEQ ID NO: 24). The URA3 knockout fragment was introduced into YZB203. After homologous recombination, the URA3 gene in YZB203 was knocked out, resulting in the loss of uracil synthesis. The ScURA3 knockout strain was screened on synthetic medium containing uracil (formula: 20 g / L glucose, 6.7 g / L yeast basic nitrogen base, 2 mg / mL uracil, 15 g / L agar) and 5'-FOA plates. The resulting strain was named YZB204.

[0161] 6. Construction of YZB218

[0162] ① Using plasmid pZB089 as a template and primers SNR52-SMAI-F and XYL2-SNR52-R, PCR amplification was performed using FastPfu DNA polymerase to obtain the SNR52p-sgRNA (XYL2) gene fragment;

[0163]

[0164] ② Using plasmid pZB090 as a template and primers XYL2-CYC1T-F and CYC1T-SMAI-R, PCR amplification was performed using FastPfu DNA polymerase to obtain the sgRNA (XYL2)-CAN1.Y-SUP4t-CYC1t gene fragment;

[0165]

[0166] ③Use primers SNR52-SMAI-F and CYC1T-SMAI-R to fuse the fragment SNR52p-sgRNA(XYL2) and sgRNA(XYL2)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA(XYL2)-CAN1.Y-SUP4t-CYC1t fragment;

[0167]

[0168] ④ Using plasmid pZB087 as a template, primers XYL2-M13-F and XYL2-M13-R, and Fast Pfu DNA polymerase, PCR amplification was performed to obtain the CjFPS1 gene fragment.

[0169]

[0170] ⑤ The gene products obtained from steps ③ and ④ were concentrated by ethanol precipitation, and competent cells of Kluyveromyces marxianus YZB204 strain were prepared by the lithium acetate method. The gene products were introduced into the competent cells by heat shock transformation, and the transformants were spread on yeast synthetic medium (0.67% YNB + 2% glucose, YNB is the basic nitrogen source for yeast), and positive transformants were screened by nutritional deficiency complementation.

[0171] ⑥ Streak out the transformants grown on synthetic yeast medium to obtain single colonies. Inoculate the single colony into a liquid YPD test tube and culture overnight.

[0172] ⑦ Extract the genome from the test tube bacterial solution using the glass bead method.

[0173] ⑧ Use specific primers to identify the positive clone in which the target gene was knocked out in the transformant and name it YZB218.

[0174]

[0175] 7. Construction of YZB301

[0176] Using the pMD18T-ΔURA3 knockout fragment as a template, the URA3 knockout fragment was amplified by PCR using primers URA3-F (SEQ ID NO: 23) and URA3-R (SEQ ID NO: 24). The URA3 knockout fragment was introduced into YZB218. After homologous recombination, the URA3 gene in YZB218 was knocked out, resulting in the loss of uracil synthesis. The ScURA3 knockout strain was screened on synthetic medium containing uracil (formula: 20 g / L glucose, 6.7 g / L yeast basic nitrogen base, 2 mg / mL uracil, 15 g / L agar) and 5'-FOA plates. The resulting strain was named YZB301.

[0177] 8. Construction of YZB307

[0178] ① Using plasmid pZB089 as a template and primers SNR52-SMAI-F and XYL1-SNR52-R, PCR amplification was performed using FastPfu DNA polymerase to obtain the SNR52p-sgRNA (XYL1) gene fragment;

[0179]

[0180] ② Using plasmid pZB090 as a template, primers XYL1-CYC1T-F and CYC1T-SMAI-R were used, and FastPfu DNA polymerase was used for PCR amplification to obtain the sgRNA (XYL1)-CAN1.Y-SUP4t-CYC1t gene fragment;

[0181]

[0182] ③Use primers SNR52-SMAI-F and CYC1T-SMAI-R to fuse the fragment SNR52p-sgRNA(XYL1) and sgRNA(XYL1)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA(XYL1)-CAN1.Y-SUP4t-CYC1t fragment;

[0183]

[0184] ④ Using plasmid pZB007 as a template, primers XYL1-M13-F and M13-R were used to amplify the KmDKA1 gene fragment by PCR using Fast Pfu DNA polymerase. Using plasmid pZB075 as a template, primers M13UPRM13-F (SEQ ID NO: 13) and XYL1-M13-R (SEQ ID NO: 14) were used to amplify the URA3 gene expression cassette.

[0185]

[0186]

[0187] ⑤ The gene products obtained from steps ③ and ④ were concentrated by ethanol precipitation, and competent cells of Kluyveromyces marxianus YZB301 strain were prepared by the lithium acetate method. The gene products were introduced into the competent cells by heat shock transformation, and the transformants were spread on yeast synthetic medium (0.67% YNB + 2% glucose, YNB is the basic nitrogen source for yeast), and positive transformants were screened by nutritional deficiency complementation.

[0188] ⑥ Streak out the transformants grown on synthetic yeast medium to obtain single colonies. Inoculate the single colony into a liquid YPD test tube and culture overnight.

[0189] ⑦ Extract the genome from the test tube bacterial solution using the glass bead method.

[0190] ⑧ Use specific primers to identify the positive clone in which the target gene was knocked out in the transformant and name it YZB307.

[0191]

[0192] 9. Construction of YZB313

[0193] Using the pMD18T-ΔURA3 knockout fragment as a template, the URA3 knockout fragment was amplified by PCR using primers URA3-F (SEQ ID NO: 23) and URA3-R (SEQ ID NO: 24). The URA3 knockout fragment was introduced into YZB307. After homologous recombination, the URA3 gene in YZB307 was knocked out, resulting in the loss of uracil synthesis. The ScURA3 knockout strain was selected on synthetic medium containing uracil (formula: 20 g / L glucose, 6.7 g / L yeast basic nitrogen base, 2 mg / mL uracil, 15 g / L agar) and 5'-FOA plates. The resulting strain was named YZB313.

[0194] 10. Construction of YZB521

[0195] ① Using the genome of pZB216 as a template, primers LAC4-M13-F and LAC4-M13-R, and FastPfu DNA polymerase, PCR amplification was performed to obtain the MCR gene fragment;

[0196]

[0197] ② Using plasmid p414 as a template and primers M13-F and M13-R, PCR amplification was performed using Fast Pfu DNA polymerase to obtain the Cas9 gene fragment;

[0198]

[0199] ③ Using plasmid pZB089 as a template and primers SNR52-SMAI-F and LAC4-SNR52-R, PCR amplification was performed using FastPfu DNA polymerase to obtain the SNR52p-sgRNA (XYL1) gene fragment;

[0200]

[0201] ④ Using plasmid pZB090 as a template, primers LAC4-CYC1T-F and CYC1T-SMAI-R were used, and PCR amplification was performed using FastPfu DNA polymerase to obtain the sgRNA (LAC4)-CAN1.Y-SUP4t-CYC1t gene fragment;

[0202]

[0203] ⑤Use primers SNR52-SMAI-F and CYC1T-SMAI-R to fuse the fragment SNR52p-sgRNA(LAC4) and sgRNA(LAC4)-CAN1.Y-SUP4t-CYC1t to obtain the SNR52p-sgRNA(LAC4)-CAN1.Y-SUP4t-CYC1t fragment;

[0204]

[0205] ⑥The gene products obtained from the three-step amplification of ①② and ⑤ were concentrated by ethanol precipitation, and competent cells of Kluyveromyces marxianus YZB313 strain were prepared by the lithium acetate method. The gene products were introduced into the competent cells by heat shock transformation, and the transformants were spread on yeast synthetic medium (0.67% YNB + 2% glucose, YNB is the basic nitrogen source for yeast), and positive transformants were screened by nutritional deficiency complementation.

[0206] ⑥ Streak out the transformants grown on synthetic yeast medium to obtain single colonies. Inoculate the single colony into a liquid YPD test tube and culture overnight.

[0207] ⑦ Extract the genome from the test tube bacterial solution using the glass bead method.

[0208] ⑧ Use specific primers to identify the positive clone in which the target gene was knocked out in the transformant and name it YZB521.

[0209]

[0210] Example 2: Fermentation of the engineered strain

[0211] This example is used to test the effect of the constructed engineered strain in producing 3-hydroxypropionic acid using glycerol and waste glycerol at 37°C and 42°C.

[0212] 1. The effect of the best strain YZB521 and the control strain in producing 3-hydroxypropionic acid using glycerol and waste glycerol:

[0213] ① Resuscitate strain YZB521 on YPD medium plates and culture at 37°C for 1 day.

[0214] ② Pick a single clone and inoculate it into 5 mL of liquid YPD medium at 37°C and 220 rpm overnight.

[0215] ③ Transfer 5 mL of the above liquid YPD seed medium (10% inoculum) to 250 mL of YPD seed fermentation medium and ferment overnight.

[0216] ④ Transfer the culture to a 5 L fermentor with a working volume of 2.5 L YPG medium for batch and fed-batch fermentation at 37°C and 42°C and 450 rpm.

[0217] ⑤ Take the supernatant of the sample and analyze it by HPLC ( Figure 9 and Figure 10 ).

[0218] ⑥ The control strain could only synthesize 0.025 g / L 3-hydroxypropionic acid using YPG, while YZB521 could synthesize 2.22 g / L. Figure 10 It can be seen that strain YZB521 produced 13.53 g / L 3-hydroxypropionic acid using 40 g / L glycerol under the conditions of 37°C, 450 rpm, and 1 vvm (A); 21.26 g / L 3-hydroxypropionic acid was produced by glycerol fed-batch fermentation under the conditions of 37°C, 450 rpm, and 1 vvm (B); 23.95 g / L 3-hydroxypropionic acid was produced by glycerol fed-batch fermentation under the conditions of 42°C, 450 rpm, and 1 vvm (C); 10.31 g / L 3-hydroxypropionic acid was produced by waste glycerol fed-batch fermentation under the conditions of 37°C, 450 rpm, and 1 vvm (D); and 9.02 g / L 3-hydroxypropionic acid was produced by waste glycerol fed-batch fermentation under the conditions of 42°C, 450 rpm, and 1 vvm (E). It was proved that the strain has excellent ability to synthesize 3-hydroxypropionic acid by high-temperature fermentation, which can significantly reduce the cost of cooling water and other costs in industrial fermentation.

[0219] The bacteria currently reported for biosynthesis of 3-hydroxypropionic acid all ferment at 37°C, while yeast strains all ferment at 30°C. Temperature control requires a lot of cooling water. This project will increase the fermentation temperature of Kluyveromyces marxianus to 42°C, an increase of 12°C compared to yeast, which can significantly reduce the consumption of cooling water during industrial fermentation.

[0220] The relationship between fermentation temperature and cooling water is shown in the following formula:

[0221]

[0222] Where, m: cooling water flow, Q gen : Heat generated by fermentation, c : Specific heat capacity of water, T f: fermentation temperature, A: heat dissipation area, h: natural heat dissipation coefficient, T ambient : Ambient temperature, ΔT water : Cooling water temperature difference.

[0223] Assuming the volume of the fermentation tank: 1000 tons (≈1000 m 3 , density ≈ 1000 kg / m 3 ), the fermentation heat production Qgen is 500kW (typical value, actual value needs to be determined according to the process), the ambient temperature T ambient : 25℃, cooling water inlet temperature T in =20℃, outlet temperature T out =30℃, temperature difference ΔT water =10℃, heat transfer area A=300m 2 , original fermentation temperature T f1 =30℃, after increasing T f2 =45°C, annual operating time: 8,000 hours (≈333 days). Substituting this into the formula, we can calculate that the annual energy saving of cooling water is 155,000 tons, a saving ratio of 60%.

[0224] The reduction in carbon emissions is:

[0225] Based on the calculation of saving 155,000 tons of cooling water per year, the cooling water circulation requires water pumps and refrigeration equipment, and the comprehensive energy consumption is 0.3 kWh / ton of water (typical industrial system range: 0.1-0.5 kWh / ton). The carbon emission factor of electricity: the average value of China's power grid is 0.581 kg CO2 / kWh (2022 data). According to the calculation formula:

[0226]

[0227] Substitute the values: 155,000 tons × 0.3 kWh / ton × 0.581 kg CO2 / kWh = 27,136.5 kg CO2 = 27.1 tons CO2 / year. That is, for a 1,000-ton industrial fermentation tank, increasing the fermentation temperature alone can reduce CO2 emissions by 27.1 tons per year.

Claims

1. An engineered strain of Kluyveromyces marxianus, characterized in that: The engineered Kluyveromyces marxianus strain is abbreviated as YZB521, classified as Kluyveromyces marxianus, and has been deposited in the China General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration. The deposit date is July 8, 2024, and the deposit number is CGMCC NO.31223.

2. Use of the engineered Kluyveromyces marxianus strain according to claim 1 in the fermentation production of 3-hydroxypropionic acid.

3. The use according to claim 1, characterized in that: The Kluyveromyces marxianus engineered strain uses glycerol or industrial waste glycerol as a substrate and produces 3-hydroxypropionic acid through fermentation under high-temperature aerobic conditions.

4. The use according to claim 3, characterized in that: The fermentation temperature is 37-42℃.

Images