Application of knockout of TaDOF7.6 gene by gene editing to increase wheat yield
By knocking out the wheat TaDOF7.6 gene through CRISPR/Cas9 technology, the technical problem of increasing wheat yield was solved, the yield traits of wheat were significantly improved, and the foundation for wheat molecular breeding was laid.
Patent Information
- Application Number
- CN202510757818.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-09-26
AI Technical Summary
In the existing technology, the role of DOF transcription factors in wheat yield improvement has not been fully studied, resulting in the potential for increasing wheat yield not being fully explored.
The TaDOF7.6 gene in wheat was knocked out using CRISPR/Cas9 gene editing technology, and the plant binary expression vector pBUN411-TaDOF7.6 was designed and constructed. The TaDOF7.6 gene was targeted and knocked out using sgRNA to increase wheat plant height, ear length, number of effective tillers, grain length, grain width and 1000-grain weight.
It significantly improved the yield traits of wheat, including plant height, ear length, number of effective tillers, grain length, grain width and 1000-grain weight, providing a basis for wheat molecular breeding and ensuring the safety of gene editing.
Smart Images

Figure CN120699981A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and particularly to the application of using gene editing to knock out the TaDOF7.6 gene to increase wheat yield. Background Art
[0002] Wheat provides approximately 20% of human calorie and protein intake, and its yield is directly related to the stability and security of the food supply. Among the many factors influencing wheat yield, grain weight is a key improvement target. Grain formation involves endosperm development and grain filling, a process that relies on the coordinated action of multiple transcription factors and proteins. Through genome-wide association analysis, linkage analysis, and gene cloning, several key genes regulating wheat grain size and weight have been identified, including TaGW2, KAT-2B, CAKE1, CAKE2, TaSUTs, TaSnRK2.3, and TaSnRK2.4. These genes collectively influence grain development by regulating processes such as photosynthesis, the ubiquitin-proteasome pathway, G protein signaling, and hormone response.
[0003] DOF transcription factors play a key role in plant photosynthesis, stress response, and secondary metabolism. Members of this family are involved in regulating multiple processes of plant growth and development. Currently, research on DOF transcription factors is mainly focused on diploid crops such as rice and maize. In wheat, researchers cloned the WPBF and TaDOF1 genes, which are homologous to maize ZmDOF1, and further found that overexpression of TaDOF1 can improve nitrogen use efficiency during the grain filling stage. In addition, TaDOF3.4 and TaDOF5.6 have been shown to improve wheat genetic transformation efficiency, while TaDOF2, TaDOF3, and TaDOF6 are involved in seed-specific regulation. However, revealing the role of DOF transcription factors in improving wheat yield-related traits is of great scientific significance.
[0004] With rapid population growth, food demand continues to rise. Against this backdrop, cultivating high-yielding, nutritious crop varieties that can adapt to a variety of biotic and abiotic stresses has become a pressing task in the agricultural sector. This demand has strongly driven the innovation and development of plant breeding technology. Crop improvement through CRISPR editing technology allows targeted gene modification to optimize plant traits, such as enhancing stress and disease resistance, increasing crop nutritional content, and boosting crop yield. Targeted genome modification has evolved from random mutations to precise base changes, and further to the insertion, deletion, and substitution of small fragments, and is now gradually achieving precise manipulation of large fragments. In agricultural applications, CRISPR technology has demonstrated tremendous potential for improving food crops. It not only accelerates the crop breeding process but also effectively addresses many challenges in traditional breeding methods, providing strong technical support for achieving sustainable agricultural development. Summary of the Invention
[0005] In response to the above-mentioned prior art, the present invention aims to provide an application for improving wheat yield by knocking out the TaDOF7.6 gene through gene editing. The present invention has found that knocking out the TaDOF7.6 gene can increase wheat plant height, ear length, number of effective tillers, grain length, grain width, and 1000-grain weight. Therefore, the TaDOF7.6 gene can be used as a regulatory gene for wheat yield traits, laying the foundation for increasing wheat yield and improving its traits.
[0006] To achieve this technical purpose, the present invention adopts the following technical solutions:
[0007] The present invention provides a TaDOF7.6 gene, wherein the TaDOF7.6 gene:
[0008] a) encodes TaDOF7.6 protein; or
[0009] b) having the nucleotide sequence shown in SEQ ID NO: 1.
[0010] The present invention provides a TaDOF7.6 protein, wherein the TaDOF7.6 protein:
[0011] 1) having the amino acid sequence shown in SEQ ID NO: 2;
[0012] 2) a derivative amino acid sequence obtained by substituting, deleting and / or adding one or more amino acids from the amino acid sequence in 1), said derivative amino acid sequence having the activity of the amino acid sequence shown in 1); or
[0013] 3) An amino acid sequence having at least 80% homology to the amino acid sequence in 1).
[0014] The present invention provides sgRNA targeting TaDOF7.6 gene, wherein the sgRNA includes sgRNA1, sgRNA2, sgRNA3 and sgRNA4, wherein:
[0015] The nucleotide sequence of the sgRNA1 is CAGGGCCCGGCGTCCCGGTGCGG;
[0016] The nucleotide sequence of the sgRNA2 is GTGCGGCGTGTTCTCGCAGGCGG;
[0017] The nucleotide sequence of the sgRNA3 is GCTCTTGGCGTCCGTGGCCGCGG;
[0018] The nucleotide sequence of the sgRNA4 is TTCCGCAGCGGCCGTGGGGCTGG.
[0019] It should be noted that, by analyzing the structure of the TaDOF7.6 gene, the present invention found that the gene contains an intron and a conserved domain of the DOF family. When designing sgRNA, the present invention avoided this region and designed four sgRNAs at the front end of CDS, namely sgRNA1, sgRNA2, sgRNA3 and sgRNA4, among which the nucleotide sequence of sgRNA1 is CAGGGCCCGGCGTCCCGGTG CGG The nucleotide sequence of sgRNA2 is GTGCGGCGTGTTCTCGCAGG CGG The nucleotide sequence of sgRNA3 is GCTCTTGGCGTCCGTGGCCG CGG The nucleotide sequence of sgRNA4 is TTCCGCAGCGGCCGTGGGGC TGG The last three deoxynucleotide sequences at the 3' end of the above sgRNA are NGG, where N is adenine, guanine, thymine, or cytosine.
[0020] The present invention provides a plant binary expression vector pBUN411-TaDOF7.6 targeting the TaDOF7.6 gene, wherein the plant binary expression vector pBUN411-TaDOF7.6 comprises an expression cassette E1, an expression cassette E2, an expression cassette E3 and an expression cassette E4, wherein:
[0021] The expression cassette E1 has the nucleotide sequence shown in SEQ ID NO: 3;
[0022] The expression cassette E2 has the nucleotide sequence shown in SEQ ID NO: 4;
[0023] The expression cassette E3 has the nucleotide sequence shown in SEQ ID NO: 5;
[0024] The expression cassette E4 has the nucleotide sequence shown in SEQ ID NO:6.
[0025] It should be noted that the present invention constructs a plant binary expression vector pBUN411-TaDOF7.6 by the GoldenGate method, and the plant binary expression vector pBUN411-TaDOF7.6 includes an expression cassette E1, an expression cassette E2, an expression cassette E3, and an expression cassette E4, wherein the expression cassette E1 has a nucleotide sequence as shown in SEQ ID NO: 3, which, from upstream to downstream, is the TaU6 promoter, sgRNA1 targeting the TaDOF7.6 gene, and a terminator sgRNA scaffold. The expression cassette E2 has a nucleotide sequence as shown in SEQ ID NO: 4, which, from upstream to downstream, is the TaU6 promoter, sgRNA2 targeting the TaDOF7.6 gene, and a terminator sgRNA scaffold. The expression cassette E3 has a nucleotide sequence as shown in SEQ ID NO: 5, which, from upstream to downstream, is the TaU3 promoter, sgRNA3 targeting the TaDOF7.6 gene, and a terminator sgRNA scaffold. The expression cassette E4 has the nucleotide sequence shown in SEQ ID NO:6, which contains, from upstream to downstream, the TaU3 promoter, sgRNA4 targeting the TaDOF7.6 gene, and the terminator sgRNA scaffold. The plant binary expression vector pBUN411-TaDOF7.6 was transformed into common wheat Fielder using Agrobacterium tumefaciens and then sent to the wheat transgenic platform of the National Key Laboratory of Crop Stress Tolerance and Efficient Production at Northwest Agriculture and Forestry University for transformation. This resulted in gene-edited wheat with the TaDOF7.6 gene knocked out, significantly improving key yield traits such as plant height, ear length, number of effective tillers, grain length, grain width, and 1000-grain weight.
[0026] Also provided are a polynucleotide construct, a host cell, a recombinant vector or a recombinant bacterium containing the TaDOF7.6 gene of the present invention.
[0027] The present invention provides an application of knocking out the TaDOF7.6 gene by gene editing in improving wheat yield.
[0028] Preferably, the wheat yield includes plant height, ear length, number of effective tillers, grain length, grain width and thousand-grain weight.
[0029] Also provided is the use of the TaDOF7.6 gene or the TaDOF7.6 protein of the present invention in increasing wheat plant height, ear length, number of effective tillers, grain length, grain width and 1000-grain weight.
[0030] Also provided is the use of the TaDOF7.6 gene or the TaDOF7.6 protein described in the present invention in wheat molecular breeding.
[0031] Also provided is a method for cultivating gene-edited wheat with improved yield traits, the method comprising the following steps:
[0032] Knocking out the expression of the TaDOF7.6 gene of the present invention in target wheat to obtain gene-edited wheat;
[0033] The content and / or activity of the TaDOF7.6 protein of the present invention is knocked out in the target wheat to obtain gene-edited wheat; wherein,
[0034] The yield trait of the gene-edited wheat is higher than that of the target wheat;
[0035] The yield traits are wheat plant height, ear length, number of effective tillers, grain length, grain width and thousand-grain weight.
[0036] The present invention provides a method for increasing wheat plant height, ear length, effective tiller number, grain length, grain width and 1000-grain weight by knocking out the TaDOF7.6 gene through gene editing.
[0037] Compared with the prior art, the present invention has the following beneficial effects:
[0038] (1) The TaDOF7.6 gene knockout vector provided by the present invention can be used to quickly knock out the TaDOF7.6 gene in wheat, providing an effective method for gene knockout; the four sgRNAs provided by the present invention are key sites for knocking out the TaDOF7.6 gene in wheat.
[0039] (2) Transgene-free homozygous mutants with no vector residues were screened through Hi-TOM high-throughput sequencing and Sanger sequencing. The results of this study provide important evidence for the safety of CRISPR gene editing in wheat and lay a solid foundation for molecular breeding of wheat.
[0040] (3) The present invention successfully constructed a plant binary expression vector pBUN411-TaDOF7.6 for knocking out the TaDOF7.6 gene, and successfully knocked out the TaDOF7.6 gene in wheat materials through Agrobacterium-mediated method. The resulting wheat materials achieved significant improvements in key yield traits such as plant height, ear length, number of effective tillers, grain length, grain width and 1000-grain weight.
[0041] (4) The present invention confirms for the first time that knocking out the TaDOF7.6 gene or knocking out the expression of the TaDOF1 protein can increase wheat plant height, ear length, number of effective tillers, grain length, grain width and 1000-grain weight. BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Figure 1 The construction process of the TaDOF7.6-CRISPR vector. (a) The TaDOF7.6 gene structure; (b) The map of the plant binary expression vector pBUN411-TaDOF7.6; (c) The expression cassette construction and Agrobacterium transformation.
[0043] Figure 2 Identification of TaDOF7.6-CRISPR gene-edited strains. (a) Screening for glufosinate resistance; (b) PCR amplification of the Cas9 gene to identify gene-edited strains. Lanes 1-17 represent different TaDOF7.6-CRISPR gene-edited strains.
[0044] Figure 3 Analysis of TaDOF7.6-CRISPR gene editing types. (a) Analysis of TaDOF7.6 gene editing types based on Hi-TOM high-throughput sequencing; (b) Sanger sequencing peak diagram of the KO-1 strain to verify the gene editing type.
[0045] Figure 4 Figure 1 shows the phenotypic and agronomic trait statistical analysis of the TaDOF7.6-CRISPR gene-edited lines under normal water conditions. (a) Plant height and tiller number phenotype; (b) Ear length phenotype; (c) Grain width and grain length phenotype; (d) Statistical analysis of plant height, ear length, effective tiller number, grain length, grain width, and 1000-grain weight.
[0046] Figure 5 Analysis of dry matter accumulation in TaDOF7.6-CRISPR gene-edited wheat.
[0047] Among them, WT in the figure represents wild-type wheat, KO-1 represents the TaDOF7.6-CRISPR gene-edited line, and KO-2 represents the TaDOF7.6-CRISPR gene-edited line. DETAILED DESCRIPTION
[0048] The technical solutions of the present invention are described clearly and completely below with reference to the embodiments. It is obvious that the embodiments described are only a portion of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.
[0049] To ensure a complete and unambiguous understanding of the technical solutions of the present invention, it is necessary to further clarify that the TaDOF7.6 gene described herein is represented by italicized characters "TaDOF7.6," while the TaDOF7.6 protein is represented by non-italicized characters "TaDOF7.6." Of course, those skilled in the art will clearly and completely understand the meaning and representation of the relevant genes and their encoded proteins based on the descriptions herein.
[0050] In the embodiments of the present invention, WT in the figure represents wild-type wheat, KO-1 represents the TaDOF7.6-CRISPR gene-edited strain, and KO-2 represents the TaDOF7.6-CRISPR gene-edited strain.
[0051] Figure 1 The construction process of TaDOF7.6-CRISPR vector.
[0052] (a) TaDOF7.6 gene structure;
[0053] (b) is a map of the plant binary expression vector pBUN411-TaDOF7.6;
[0054] (c) shows the construction of expression cassettes and Agrobacterium transformation; the upper left picture shows the construction of expression cassette E1 (487bp) and expression cassette E2 (487bp); the upper right picture shows the construction of expression cassette E3 (526bp) and expression cassette E4 (526bp); the lower left picture shows the Agrobacterium transformation of the plant binary expression vector pBUN411-TaDOF7.6; the lower right picture shows the TaDOF7.6-CRISPR wheat seedlings obtained by Agrobacterium-infected callus tissue.
[0055] Figure 2 Identification of the TaDOF7.6-CRISPR gene-edited strain.
[0056] (a) Screening for glufosinate resistance;
[0057] (b) PCR amplification of the Cas9 gene to identify gene-edited strains; lanes 1-17 represent different TaDOF7.6-CRISPR gene-edited strains.
[0058] Figure 3 Analysis of TaDOF7.6-CRISPR gene editing types.
[0059] (a) Analysis of TaDOF7.6 gene editing types based on Hi-TOM high-throughput sequencing;
[0060] (b) Sanger sequencing peak diagram of KO-1 strain to verify the gene editing type.
[0061] Figure 4Statistical analysis of the phenotypic and agronomic traits of the TaDOF7.6-CRISPR gene-edited strain under normal water conditions.
[0062] (a) is the plant height and tiller number phenotype;
[0063] (b) is the ear length phenotype;
[0064] (c) is the phenotype of grain width and grain length;
[0065] (d) Statistical analysis of plant height, ear length, effective tiller number, grain length, grain width and 1000-grain weight.
[0066] Figure 5 Analysis of dry matter accumulation in TaDOF7.6-CRISPR gene-edited wheat.
[0067] Example 1 Bioinformatics Analysis of TaDOF7.6 Gene
[0068] Using the NCBI website ( https: / / www.ncbi.nlm.nih.gov / ) and the WheatOmics 1.0 website ( http: / / 202.194.139.32 / ) Search for gene ID: TraesCS6A02G287700 to download the nucleotide and amino acid sequences. The gene containing this nucleotide sequence was named TaDOF7.6 gene (TaDOF7.6), and the TaDOF7.6 gene has the nucleotide sequence shown in SEQ ID NO: 1. The amino acid sequence of the protein encoded by the TaDOF7.6 gene is shown in SEQ ID NO: 2, and this protein was named TaDOF7.6 protein (TaDOF7.6).
[0069] Using InterPro( https: / / www.ebi.ac.uk / interpro / ) website to analyze the protein domain of TaDOF7.6, avoid the conserved domain of the DOF family, and design sgRNA at the front end of gene translation initiation, which can terminate the gene function prematurely. Figure 1 Middle (a).
[0070] Example 2 Design of sgRNA targeting TaDOF7.6 gene knockout
[0071] Principles of sgRNA design: (1) Both the sense and antisense strands of the gene should be designed to have the same knockout efficiency, and the directionality of the insertion vector must be ensured. (2) The GC content of the sgRNA should be around 65% to ensure knockout efficiency, and the target site should not have consecutive bases. (3) Ensure that the sgRNA sequence does not contain stable secondary structures to improve its effectiveness under experimental conditions. (4) When the U6 promoter drives the expression of the sgRNA, the 5' end base of the sgRNA is generally G. First, the sequence of the TaDOF7.6 gene was entered into the website CRISPR-Cereal (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR-Cereal / main). When designing sgRNA, it was important to target the 5' end of the TaDOF7.6 gene coding region to allow for premature transcriptional termination of gene translation. At the same time, the specificity of the sgRNA should be ensured. Wheat has three homologous chromosomes, A / B / D. BLAST comparison was performed on the WheatOmics 1.0 website to ensure that there was no off-target editing and that the knockout target was only for the three homologous chromosomes, ABD. If an sgRNA could not be designed to edit all three chromosomes, it was also necessary to ensure that a combination of two sgRNAs could achieve editing of all three chromosomes. Furthermore, sgRNAs with higher scores and total scores on the website were selected for better editing effects. Through the above analysis, four sgRNA targets were designed in the CDS region of the TaDOF7.6 gene, named sgRNA1, sgRNA2, sgRNA3, and sgRNA4. The nucleotide sequence of the sgRNA1 is CAGGGCCCGGCGTCCCGGTGCGG; the nucleotide sequence of the sgRNA2 is GTGCGGCGTGTTCTCGCAGGCGG; the nucleotide sequence of the sgRNA3 is GCTCTTGGCGTCCGTGGCCGCGG; and the nucleotide sequence of the sgRNA4 is TTCCGCAGCGGCCGTGGGGCTGG.
[0072] Example 3 Construction of CRISPR gene editing vector sgRNA expression cassette
[0073] The U6 and U3 promoters were cloned using the vectors pYLsgRNA-TaU6 / LacZ and pMD19T-TaU3 modified by Chen Kunming's research group at the State Key Laboratory of Crop Stress Resistance and Efficient Production at Northwest Agriculture and Forestry University, and the sgRNA scaffold functional elements were cloned in pYLsgRNA-TaU6 / LacZ. Homologous recombination primers were designed to introduce the restriction site BsaI and the sgRNA expression cassette, and the BsaI restriction site was introduced into the 5' end of the U6 and U3 promoters, which were then connected to the pBUN411 vector end. sgRNA1 and sgRNA2 were introduced into the 3' end of the U6 promoter, and sgRNA3 and sgRNA4 were introduced into the 3' end of the U3 promoter. sgRNA was introduced into the 5' end of the sgRNA scaffold functional element and connected to the sgRNA scaffold functional element. Finally, the common sgRNA sequence was used to connect the U6 and U3 promoters and sgRNA and the sgRNA scaffold functional element through Overlap PCR to form an sgRNA expression cassette. sgRNA1 and sgRNA2 were activated by the U6 promoter, and sgRNA3 and sgRNA4 were activated by the U3 promoter. See [see sgRNA expression cassette for details]. Figure 1 Middle (c).
[0074] Example 4 Construction of pBUN411 vector using the GoldenGate method
[0075] By designing primers for homologous recombination, sgRNA1 and sgRNA4 were ensured to be connected to the two ends of the pBUN411 vector respectively. Each expression cassette and vector were connected by enzyme digestion and ligation in a "digestion-ligation" manner, with approximately 10-15 ng for each target (Table 1).
[0076] Table 1 pBUN411 vector assembly reaction system preparation
[0077] Reagents Addition volume (μL) Final concentration 10×CutSmart Buffer 1.5 1× final concentration 10mM ATP 1.5 1mM pYLCRISPR / Cas9 Plasmid 60-80ng 4-6 ng / μL sgRNA expression cassette mixture 10-15ng per expression cassette / BsaI-HF 10U 0.1-0.2 U / μL T4 DNA ligase 35U 2-3 U / μL <![CDATA[H2O]]> Final volume: 15 μL /
[0078] In a PCR instrument, perform 15 cycles of 37°C for 5 minutes, 10°C for 5 minutes, and 20°C for 5 minutes, followed by a final 37°C for 5 minutes. After the program is complete, perform agarose gel electrophoresis. The details are as follows:
[0079] (1) Gel preparation: 25 mL 1× TBE buffer + 0.25 g agarose;
[0080] (2) 1× TBE buffer solution (1 L): 10.8 g Tris (hydroxymethyl)aminomethane, 5.5 g boric acid, 4 mL EDTA (0.5 M, pH 8.0);
[0081] (3) Electrophoresis was performed at 160 V, 200 mA, and 80 W (the larger the parameter, the faster the band migration speed);
[0082] (4) Recover the target band according to the instructions of the gel extraction kit (GeneJET Gel Extraction Kit, thermos scientific).
[0083] The constructed vector is the plant binary expression vector pBUN411-TaDOF7.6 targeting the TaDOF7.6 gene, see Figure 1 In (b), the plant binary expression vector pBUN411-TaDOF7.6 includes expression cassette E1, expression cassette E2, expression cassette E3 and expression cassette E4, wherein the expression cassette E1 has the nucleotide sequence shown in SEQ ID NO: 3; the expression cassette E2 has the nucleotide sequence shown in SEQ ID NO: 4; the expression cassette E3 has the nucleotide sequence shown in SEQ ID NO: 5; and the expression cassette E4 has the nucleotide sequence shown in SEQ ID NO: 6.
[0084] Example 5: Heat-stimulated transformation of Escherichia coli
[0085] The details are as follows:
[0086] (1) Take the competent E. coli stored at -80℃, insert it into ice, wait for it to thaw naturally, and add the homologous recombination product in the PCR instrument to the competent cell;
[0087] (2) Gently pipette to mix the liquid and place it in an ice bath for 30 minutes;
[0088] (3) Heat shock in a 42°C water bath for 60 seconds, followed by an ice bath for 2 minutes;
[0089] (4) Add 1 mL of sterilized antibiotic-free LB medium and incubate at 37°C and 170 rpm for recovery (Amp resistance recovery takes about 30 minutes, Kan resistance recovery takes about 1 hour);
[0090] (5) Shake at 37°C, 180 rpm for cell recovery (Amp resistance recovery takes about 30 min, Kan resistance recovery takes about 1 h);
[0091] (6) Collect the bacterial precipitate, spin at 5000 rpm for 2 min, and naturally pour off the supernatant in a clean bench. Mix the remaining liquid by pipetting the precipitate and then smear the plate; or perform the above operation next to the flame of an alcohol lamp on the laboratory bench;
[0092] (7) Inverted culture in a 37°C incubator (Amp resistance culture for about 14 hours, Kan resistance culture for about 18 hours);
[0093] (8) Pick a single clone, pipette it into the corresponding resistance solution, and culture it;
[0094] (9) Perform bacterial liquid PCR to verify the positive strains.
[0095] Example 6 Liquid nitrogen transformation of Agrobacterium
[0096] The details are as follows:
[0097] (1) Take the competent Agrobacterium stored at -80℃ and place it in the room temperature or in the palm of your hand for a while until it partially thaws. When it is in an ice-water mixture, insert it into ice;
[0098] (2) Add 0.01-1 μg of plasmid DNA per 100 μL competent medium, stir the bottom of the tube by hand to mix, and place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.
[0099] (3) Add 700 μL of LB or YEB liquid medium without antibiotics and culture at 28°C with shaking for 23 h;
[0100] (4) Harvest the bacteria at 6000 rpm for 1 min, retain about 100 μL of supernatant, gently blow to resuspend the bacterial mass, spread it on LB or YEB plates containing the corresponding antibiotics, and invert it in a 28°C incubator for 2-3 days (when the plate contains only 50 μL / mL kan, incubate at 28°C for 48 hours; when 50 μL / mL kan and 20 μg / mL rif are added to the plate at the same time, incubate at 28°C for 60 hours; if the plate used contains 50 μg / mL rif, incubate at 28°C for 72-90 hours).
[0101] The ligation product was transformed into competent E. coli using heat stimulation, and positive clones were verified by bacterial liquid PCR. The plasmid was transformed into Agrobacterium GV3101 using liquid nitrogen method, and the positive clones were verified and sent to the wheat gene transformation platform of the National Key Laboratory of Crop Resistance and High-efficiency Production of Northwest Agriculture and Forestry University for Agrobacterium genetic transformation. The resulting callus wheat seedlings were soil-cultured and grown to the seedling stage to identify the gene-edited wheat plants. Figure 1 In (c), by Figure 1 As shown in (c), the present invention successfully constructed expression cassette E1, expression cassette E2, expression cassette E3 and expression cassette E4; the plant binary expression vector pBUN411-TaDOF7.6 of the present invention was successfully transformed by Agrobacterium; and the callus tissue was infected by Agrobacterium of the present invention to successfully obtain TaDOF7.6-CRISPR wheat seedlings.
[0102] Example 7 Identification of TaDOF7.6-CRISPR Gene Edited Wheat
[0103] The details are as follows:
[0104] (1) Basta patch: Prepare 0.05% glufosinate-ammonium resistance culture medium. When wheat grows to the seedling stage, cut three 2cm×2cm leaf segments and stick them on the resistance culture medium. Culture in a light culture room for about 3 days and observe the color change of the leaves. The gene-edited strains appear green, while the wild type (WT) turns yellow. Figure 2 Middle (a).
[0105] Preparation method of 0.05% (500mL) glufosinate medium: 2.37g plant tissue culture medium, 4g agar powder, add 500mL ddH2O, heat and mix the above liquid thoroughly, boil 2-3 times, add 2.5mL 10% glufosinate solution, mix well, and pour into a plate.
[0106] (3) Gene-edited wheat was identified by Basta patch, and the Cas9 gene in the transformation vector was cloned to identify gene-edited positive seedlings carrying the vector. Figure 2 Middle (b).
[0107] (2) Sanger sequencing: Specific primers for the three homologous chromosomes ABD were designed, and PCR cloning was performed. The target fragments were then purified by gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with SnapGene software and the peak graph was observed to verify whether it was CRISPR gene-edited wheat. Specific primers for the ABD chromosomes were designed near the target site. The Sanger peak graph showed that homozygous editing had occurred in the T1 generation. Figure 3 Middle (a).
[0108] (3) Hi-TOM high-throughput sequencing: According to the conventional PCR primer design principles, universal primers for the three homologous chromosomes ABD were designed. The target region should be within 100 bp of the forward or reverse primer, and the amplification length should be 150-300 bp. A bridge sequence 5'-gagtacggtgtgc-3' was added before the 5' specific sequence of the forward primer, and a bridge sequence 5'-ggatgctggatgg-3' was added before the 5' specific sequence of the reverse primer. The next step was PCR amplification. After the PCR amplification was completed, 5 μL of the product was aspirated and run on the gel to ensure that the target band was amplified. Hi-TOM result analysis can determine the difference between the uploaded WT sequence and the sequence after mutation, as well as the mutation type of the homologous chromosome. Detailed mutation sequence information can be obtained for each sample and each target site, and the mutation situation of each target region can be intuitively seen. A total of two editing types were identified, and only sgRNA1 and sgRNA2 targets underwent editing events. sgRNA3 and sgRNA4 did not undergo editing events, and the probability of two editing types for sgRNA1 and sgRNA2 targets was 100%, which is a homozygous mutation. The first editing type (KO-1) is to insert 1 base T on chromosome 6A, delete 2 bases C and G on chromosome 6B, and delete a total of 12 bases G, C, G, T, C, C, C, C, T, C, G, C at two positions on chromosome 6D; the second editing type (KO-2) deletes 3 bases C, G, C on chromosome 6A, 5 bases C, T, C, G, C on chromosome 6B, and inserts 1 base A on chromosome 6D. Figure 3 Middle (b).
[0109] Example 8 TaDOF7.6-CRISPR gene editing wheat phenotypic analysis
[0110] During the wheat growth to maturity period, relevant data collection work was carried out at the Caoxinzhuang Experimental Farm of Northwest Agriculture and Forestry University (34°28'N, 108°28'E). During the experiment, wild-type and transgenic wheat were selected, and indicators such as plant height, ear length, and effective tiller number were accurately measured. The automatic seed detection and thousand-grain weight analysis system was used to accurately measure data such as grain length, grain width, and thousand-grain weight. Figure 4 ,Depend on Figure 4 It can be seen that genetically modified wheat can increase wheat plant height, ear length, number of effective tillers, grain length, grain width and thousand-grain weight.
[0111] Example 9 Analysis of Physiological Indicators of TaDOF7.6-CRISPR Gene Editing Wheat
[0112] The wheat was sampled at maturity. The wheat plants were divided into different parts, namely, vegetative organs (stems, leaves, sheaths) and reproductive organs (ears). The parts were dried in an oven at 105°C for 30 min, and then dried at 50°C for 2 days to constant weight. The parts were weighed using a 1 / 1000 analytical balance. Figure 5 ,Depend on Figure 5 It can be seen that the dry matter weight per plant of KO-1 and KO-2 in both vegetative and reproductive organs was higher than that of WT (wild type).
[0113] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but rather represents selected embodiments of the present invention. All other embodiments obtained without creative effort and through deduction and substitution by a person of ordinary skill in the art based on the concepts of the present invention are within the scope of protection of the present invention.
Claims
1. TaDOF7.6 gene, characterized in that The TaDOF7.6 gene: a) encodes TaDOF7.6 protein; or b) having the nucleotide sequence shown in SEQ ID NO:
1.
2. TaDOF7.6 protein, characterized in that The TaDOF7.6 protein: 1) having the amino acid sequence shown in SEQ ID NO: 2; 2) a derivative amino acid sequence obtained by substituting, deleting and / or adding one or more amino acids from the amino acid sequence in 1), said derivative amino acid sequence having the activity of the amino acid sequence shown in 1); or 3) An amino acid sequence having at least 80% homology to the amino acid sequence in 1).
3. sgRNA targeting TaDOF7.6 gene, characterized in that The sgRNA includes sgRNA1, sgRNA2, sgRNA3 and sgRNA4, wherein, The nucleotide sequence of the sgRNA1 is CAGGGCCCGGCGTCCCGGTGCGG; The nucleotide sequence of the sgRNA2 is GTGCGGCGTGTTCTCGCAGGCGG; The nucleotide sequence of the sgRNA3 is GCTCTTGGCGTCCGTGGCCGCGG; The nucleotide sequence of the sgRNA4 is TTCCGCAGCGGCCGTGGGGCTGG.
4. The plant binary expression vector pBUN411-TaDOF7.6 targeting the TaDOF7.6 gene is characterized by: The plant binary expression vector pBUN411-TaDOF7.6 includes expression cassette E1, expression cassette E2, expression cassette E3 and expression cassette E4, wherein, The expression cassette E1 has the nucleotide sequence shown in SEQ ID NO: 3; The expression cassette E2 has the nucleotide sequence shown in SEQ ID NO: 4; The expression cassette E3 has the nucleotide sequence shown in SEQ ID NO: 5; The expression cassette E4 has the nucleotide sequence shown in SEQ ID NO:
6. 5 . A polynucleotide construct, host cell, recombinant vector or recombinant bacterium containing the TaDOF7.6 gene according to claim 1 .
6. Application of gene editing to knock out TaDOF7.6 gene in improving wheat yield.
7. The use according to claim 6, characterized in that The wheat yield includes plant height, ear length, number of effective tillers, grain length, grain width and thousand-grain weight.
8. Use of the TaDOF7.6 gene according to claim 1 or the TaDOF7.6 protein according to claim 2 in increasing plant height, ear length, number of effective tillers, grain length, grain width and 1000-grain weight of wheat.
9. Use of the TaDOF7.6 gene according to claim 1 or the TaDOF7.6 protein according to claim 2 in wheat molecular breeding.
10. A method for cultivating transgenic wheat with improved yield traits, characterized in that: The method comprises the following steps: Knocking out the expression of the TaDOF7.6 gene described in claim 1 in the target wheat to obtain gene-edited wheat; Knock out the content and / or activity of the TaDOF7.6 protein according to claim 2 in the target wheat to obtain gene-edited wheat; wherein, The yield trait of the gene-edited wheat is higher than that of the target wheat; The yield traits are wheat plant height, ear length, number of effective tillers, grain length, grain width and thousand-grain weight.