TsRNA markers for diagnostic assessment of vascular aging, kits and uses thereof
By detecting the expression level of tsRNA-3031b, the challenge of early diagnosis and assessment of vascular aging has been solved, providing a highly efficient diagnostic biomarker and potential therapeutic target for vascular aging, and enabling accurate assessment and intervention of vascular aging.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
- Filing Date
- 2025-04-15
- Publication Date
- 2026-06-26
AI Technical Summary
Current technologies lack accurate examination and testing methods for assessing vascular aging, especially in the early stages of the disease, making intervention difficult. There is an urgent clinical need for new biomarkers of vascular aging.
tsRNA-3031b is provided as a diagnostic biomarker for vascular aging. The expression level of tsRNA-3031b can be detected by RT-PCR, real-time quantitative PCR, in situ hybridization, microarray or high-throughput sequencing platform. Specific primers and kits are used for diagnosis, screening, prognostic assessment and differentiation of vascular aging.
tsRNA-3031b was expressed significantly higher in patients with vascular aging than in healthy controls. ROC curves showed that it has high sensitivity and specificity, can reflect the severity of vascular aging, and demonstrates its potential as a therapeutic target at the cellular level.
Smart Images

Figure CN120700128B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a biomarker for diagnosing vascular aging, specifically a tsRNA biomarker, and also to a kit for detecting the tsRNA biomarker and its application, belonging to the field of medical molecular diagnostics. Background Technology
[0002] Despite a decline in the prevalence of cardiovascular disease (CVD) over the past 30 years, it remains a leading cause of morbidity and mortality globally. By 2030, the population aged 65 and over is projected to comprise 20% of the total population, and CVD will account for 40% of all deaths in this age group, making it the leading cause of death. Furthermore, the costs of CVD treatment and hospitalization are expected to more than triple during this period. Notably, 90% of CVD cases occur in adults aged 40 and over. Among age-related heart and vascular diseases, vascular aging has become a crucial research area in the era of population aging. Previously, the fields of cardiovascular disease and the molecular biology of aging were largely independent; however, with increasing focus on changes in the vascular system with age, improving the early diagnostic capabilities for vascular aging has become a vital direction in cardiovascular disease research.
[0003] The characteristics of vascular aging include luminal dilation, increased arterial stiffness, endothelial dysfunction, and diffuse intimal thickening. Increased arterial stiffness is the most prominent feature, primarily caused by multiple factors, including accelerated breakage and depletion of elastin in the vascular media and collagen deposition. Increased arterial stiffness leads to elevated blood pressure due to the earlier return time of the systolic reflected wave.
[0004] tRNA-derived small RNAs (tsRNAs) are a class of non-coding small RNAs. With advancements in research techniques, it has been discovered that tsRNAs are not random products of tRNA degradation, but rather small RNAs cleaved according to specific sequences, and are associated with various diseases. Based on different tRNA cleavage sites, numerous studies have shown that tsRNAs can function as functional molecules, influencing disease progression. Because the occurrence and development of vascular aging are often insidious, there is currently a lack of accurate diagnostic and laboratory methods for assessing vascular aging in clinical practice, especially in the early stages of the disease when cardiac function has not yet significantly weakened, making intervention difficult. Therefore, there is an urgent clinical need to discover a new biomarker for vascular aging. Changes in non-coding RNAs occur upstream of transcription, and these changes are faster and earlier. In the past, due to the immaturity of detection methods, tsRNAs were difficult to detect. However, with technological advancements, tsRNA detection methods have become increasingly sophisticated, making them a promising new biomarker for the diagnosis and assessment of vascular aging. Summary of the Invention
[0005] The primary technical problem to be solved by this invention is to provide a new application of tsRNA biomarkers, which can be used in the preparation of substances for diagnosis, screening, prognostic assessment and differentiation of vascular aging.
[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting novel tsRNA biomarkers, which can be used for diagnosis, screening, prognostic assessment and differentiation of vascular aging.
[0007] Another technical problem to be solved by the present invention is to provide a primer for detecting novel tsRNA biomarkers, which can be used for diagnosis, screening, prognostic assessment and differentiation of vascular aging.
[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:
[0009] According to a first aspect of the present invention, an application of a substance for detecting tsRNA biomarkers is provided, comprising one or more of the following applications:
[0010] A1) Application in the preparation of diagnostic products for vascular aging;
[0011] A2) Application in the preparation of products for screening vascular aging;
[0012] A3) Application in the preparation of products for treating vascular aging;
[0013] A4) Application in the preparation of products for assessing the prognosis of vascular aging;
[0014] A5) Application in the preparation of products for differentiating vascular aging from other diseases;
[0015] The tsRNA marker is tsRNA-3031b, and its nucleotide sequence is shown in SEQ ID No. 1.
[0016] The "products" described above can be products used to diagnose vascular aging by detecting tsRNA-3031b expression levels through RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms.
[0017] In the above applications, tsRNA-3031b expression was significantly upregulated in plasma samples from patients with vascular aging; the expression level of tsRNA-3031b in healthy individuals was significantly lower than that in patients with vascular aging.
[0018] Preferably, the substance is a reagent for detecting the expression level of tsRNA-3031b, or for specifically recognizing tsRNA-3031b, or for detecting the content of tsRNA-3031b.
[0019] Preferably, the substance is a substance used to detect tsRNA-3031b, specifically a), b), or c) below.
[0020] a) Primers used to detect or specifically recognize tsRNA-3031b;
[0021] b) A reagent group containing the reagents described in a);
[0022] c) A kit containing either a) or b).
[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.
[0024] According to a second aspect of the present invention, a kit for detecting tsRNA biomarkers is provided, the kit comprising one or more of the following applications:
[0025] A1) Application in the preparation of diagnostic products for vascular aging;
[0026] A2) Application in the preparation of products for screening vascular aging;
[0027] A3) Application in the preparation of products for treating vascular aging;
[0028] A4) Application in the preparation of products for assessing the prognosis of vascular aging;
[0029] A5) Application in the preparation of products for differentiating vascular aging from other diseases;
[0030] The tsRNA marker is tsRNA-3031b, and its nucleotide sequence is shown in SEQ ID No. 1. The kit includes reagents for detecting or specifically recognizing tsRNA-3031b, or reagents for detecting the expression level of tsRNA-3031b.
[0031] Using the kit provided by this invention, the expression of the tsRNA-3031b characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject can be detected. Then, based on the information of upregulation or downregulation of these gene expressions, the probability of vascular aging in the subject can be determined, thereby realizing the diagnosis of vascular aging.
[0032] The kit provided by this invention may include appropriate packaging and instructions for use in the methods disclosed herein. The detection kit provided by this invention is a nucleic acid detection kit, including reagents required for RNA extraction and quantitative real-time PCR (qRT-PCR). The kit may further include appropriate buffers and polymerases, and may also include control primers and / or probes.
[0033] Preferably, the reagent used for detecting or specifically recognizing tsRNA-3031b is a specific primer, wherein the specific primer is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.
[0034] According to a third aspect of the present invention, a primer for detecting tsRNA markers is provided, the primer comprising one or more of the following applications:
[0035] A1) Application in the preparation of diagnostic products for vascular aging;
[0036] A2) Application in the preparation of products for screening vascular aging;
[0037] A3) Application in the preparation of products for treating vascular aging;
[0038] A4) Application in the preparation of products for assessing the prognosis of vascular aging;
[0039] A5) Application in the preparation of products for differentiating vascular aging from other diseases;
[0040] The primers are used to detect the expression level of tsRNA-3031b or to specifically recognize tsRNA-3031b.
[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.
[0042] Compared with the prior art, the present invention has the following technical effects:
[0043] (1) This invention provides a tsRNA (tsRNA-3031b) biomarker that can be used as a diagnostic biomarker for vascular aging. Clinical validation trials have shown that the expression level of tsRNA-3031b in the plasma of patients with vascular aging is significantly higher than that in healthy controls, indicating that tsRNA-3031b is a potential biomarker for vascular aging.
[0044] (2) The efficacy of tsRNA-3031b in diagnosing patients with vascular aging was evaluated by ROC curves. The results showed that it had high sensitivity and specificity, indicating that it has good diagnostic efficacy as a diagnostic tool.
[0045] (3) In clinical trials, researchers explored the relationship between PWV (pulse wave velocity) and tsRNA-3031b expression levels and found that the two were positively correlated. PWV is an important clinical indicator for assessing vascular stiffness and aging. Therefore, the level of tsRNA-3031b in plasma can reflect the severity of vascular aging and can be used for prognostic assessment of vascular aging.
[0046] (4) In in vitro cell experiments, vascular smooth muscle cells (VSMCs) treated with the aging inducer D-gal showed increased expression of tsRNA-3031b. This finding provides a cellular and molecular basis for tsRNA-3031b as a diagnostic biomarker for vascular aging.
[0047] (5) Further experiments showed that knocking down tsRNA-3031b reduced the mRNA expression levels of aging-related P21 and IL-1β, indicating that knocking down tsRNA-3031b can slow down the cellular senescence process. In addition, knocking down tsRNA-3031b also reduced the expression level of galactosidase, which further confirmed that knocking down tsRNA-3031b can alleviate the degree of D-gal-induced cellular senescence, thus demonstrating the potential of tsRNA-3031b as a therapeutic target for vascular aging at the cellular level. Attached Figure Description
[0048] Figure 1 A heatmap showing the difference in tsRNA expression between senescent VSMCs and normal controls obtained from sequencing.
[0049] Figure 2 To determine the tsRNA-3031b content in the plasma of patients with vascular aging and normal controls using qRT-PCR;
[0050] Figure 3 ROC curve for tsRNA-3031b in diagnosing patients with vascular aging;
[0051] Figure 4 To further determine the tsRNA-3031b content in the plasma of patients with vascular aging and normal controls in the external validation population using qRT-PCR;
[0052] Figure 5 ROC curves for tsRNA-3031b in an external validation population of patients with vascular aging.
[0053] Figure 6 The relationship between PWV and tsRNA-3031b expression levels in patients;
[0054] Figure 7 The relationship between the positive rate of galactosidase, a senescence marker, and the expression level of tsRNA-3031b in D-gal-induced VSMCs;
[0055] Figure 8A The graph shows the expression level of tsRNA-3031b after transfection of VSMCs with small interfering RNA (siRNA) of tsRNA-3031b.
[0056] Figure 8B The graph shows the expression levels of messenger RNA (mRNA) after VSMCs were transfected with tsRNA-3031b siRNA.
[0057] Figure 9A The expression of P21 mRNA in D-gal-induced VSMCs after siRNA knockdown of tsRNA-3031b in VSMCs;
[0058] Figure 9B The expression of IL-1β mRNA in D-gal-induced VSMCs after siRNA knockdown of tsRNA-3031b in VSMCs;
[0059] Figure 10A The expression of galactosidase in the control group VSMCs after D-gal treatment;
[0060] Figure 10B To determine the expression of galactosidase, a marker of cellular senescence, under a light microscope after knocking down tsRNA-3031b. Detailed Implementation
[0061] The present invention is further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0062] First, total RNA was extracted from three senescent VSMCs and three normal control VSMCs and sent to Guangzhou Epigenetics Co., Ltd. for tsRNA sequencing. tsRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. Then, the levels of the top 10 tsRNAs in patient plasma were measured using qRT-PCR, and the most significantly elevated tsRNA was used for subsequent experiments. Next, the relationship between tsRNA-3031b expression and vascular aging was further verified at the in vitro cellular level. Specific data are as follows:
[0063] Example 1: Screening and Correlation Study of tsRNA Markers for Vascular Aging
[0064] 1. Clinical Samples:
[0065] Venous blood was collected at admission to the General Hospital of the People's Liberation Army from 2020 to 2023 from 50 patients aged 60–90 years who were hospitalized after excluding other vascular diseases. Venous blood was also collected from 50 healthy individuals aged ≤30 years during physical examinations. The participants were divided into a control group and an aging group for subsequent measurement of plasma tsRNA levels.
[0066] The external validation population consisted of 52 inpatients aged 60-90 years who were hospitalized at Fuwai Hospital, Chinese Academy of Medical Sciences, between 2022 and 2023, excluding those with other vascular diseases. Additionally, 44 healthy individuals aged ≤30 years were included. Venous blood samples were collected upon admission, and the participants were divided into a control group and an aging group. Clinical data were recorded for all participants.
[0067] Inclusion criteria:
[0068] (1) Inpatients aged 60 to 90 years with PWV > 1800 cm / s;
[0069] (2) Healthy individuals aged ≤30 years undergoing physical examinations with PWV <1400cm / s;
[0070] (3) Complete blood sample data is available.
[0071] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe hematologic diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and peripheral vascular disease.
[0072] 2. Plasma extraction:
[0073] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes. The tubes were centrifuged at 2500g for 15 minutes, and the supernatant plasma was transferred to a 2ml sterile tube and stored at -80℃.
[0074] 3. RNA extraction and qRT-PCR:
[0075] 3.1. RNA Extraction
[0076] Total RNA was extracted from plasma using the RNA Simple Total RNA Kit (DP419, TIANGEN). 1 ml of TRIZOL Reagent and 200 μL of chloroform were added to the plasma, vortexed for 20 seconds, and incubated at room temperature for 10 minutes. The plasma was then centrifuged at 13000 rpm for 15 minutes at 4°C. The supernatant was carefully aspirated, and 800 μL of isopropanol was added. The mixture was gently mixed by inverting the container and incubated at -20°C for 1 hour. The supernatant was then discarded. 1 ml of 75% ethanol was added to gently wash the precipitate. The precipitate was centrifuged at 4°C for 13000 rpm for 5 minutes, and the supernatant was removed. The precipitate was dried. An appropriate amount of enzyme-free water was added, and the RNA was dissolved at 65°C for 10 minutes. The OD value and concentration of the RNA were then measured, and the RNA was stored at -80°C for later use.
[0077] 3.2. RNA reverse transcription to synthesize cDNA
[0078] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).
[0079] 3.3. Reverse transcription of tsRNA:
[0080] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:
[0081] Table 1
[0082]
[0083] 3.4. Reverse transcription of mRNA:
[0084] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:
[0085] Table 2
[0086]
[0087] The reaction procedure was: 37℃ for 45 min, 85℃ for 5 min, and maintained at 4℃.
[0088] 3.5. qRT-PCR
[0089] tsRNA primer sequences were designed according to tsRNA primer design principles. The cDNA obtained from the reverse transcription reaction was diluted 1:10 and subjected to the following qRT-PCR reaction.
[0090] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:
[0091] Table 3
[0092]
[0093] After mixing the reaction solution, the Real-time PCR program is as follows:
[0094] Stage 1: 95℃ for 2 minutes;
[0095] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;
[0096] Stage 3: 95℃15s, 60℃1min, 95℃5s;
[0097] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.
[0098] 4. tsRNA sequencing analysis:
[0099] Total RNA was extracted from three naturally aging VSMCs and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for tsRNA sequencing. tsRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened, and the content of the top 10 tsRNAs in the patient's plasma was measured by qRT-PCR. The first significantly elevated tsRNA was used for subsequent experiments. Figure 1 This is a volcano plot showing the differential expression of tsRNAs between senescent vascular MCs and normal controls obtained through sequencing. Table 4 shows the top 10 upregulated tsRNAs obtained through sequencing; the tsRNAs with the highest expression levels were selected for subsequent experiments.
[0100] Table 4 shows the top 10 upregulated tsRNAs obtained from sequencing data.
[0101]
[0102] 5. ROC curve plotting:
[0103] The receiver operating characteristic (ROC) curve is a curve obtained by plotting the true positive rate and false positive rate, and it can be used to reflect the relationship between sensitivity and specificity. It is calculated by plotting sensitivity on the ordinate and 1-specificity on the abscissa, using a series of cutoff values based on the measurements of the experimental and control groups. Connecting these points forms the ROC curve. The ROC curve was plotted using GraphPad Prism software. The ROC curve reflects the diagnostic efficacy of the biomarker for the disease.
[0104] 6. Statistical Analysis:
[0105] For normally distributed variables, t-tests and ANOVA were used; for non-normally distributed variables, Mann-Whitney U tests and Kruskal-Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism (9.1.0). Biological replicates were displayed as single data points superimposed on the bar chart. P < 0.05 was considered statistically significant.
[0106] 7. Experimental Results:
[0107] like Figure 2 As shown, the tsRNA-3031b content in the plasma of patients with vascular aging was determined using qRT-PCR. The results showed that the expression of tsRNA-3031b in the plasma of patients with vascular aging was significantly higher than that in healthy controls, indicating that tsRNA-3031b is a potential biomarker for vascular aging.
[0108] like Figure 3 The ROC curve of tsRNA-3031b in diagnosing patients with vascular aging is shown in the figure; it indicates that tsRNA-3031b has good sensitivity and specificity, demonstrating its good diagnostic efficacy.
[0109] like Figure 4 As shown, after selecting an external validation population, the qRT-PCR method was used to determine the tsRNA-3031b level in the plasma of patients with vascular aging. The results showed that the tsRNA-3031b level in the plasma of patients with vascular aging was...
[0110] The expression of tsRNA-3031b in plasma was significantly higher than that in healthy controls, which verified the reliability of tsRNA-3031b as a biomarker of vascular aging.
[0111] like Figure 5 As shown in the figure, the ROC curve of tsRNA-3031b in diagnosing patients with vascular aging in the external validation set shows that it has excellent specificity and sensitivity, indicating that tsRNA-3031b also has good diagnostic efficacy in the external validation set.
[0112] Example 2: Relationship between PWV and tsRNA-3031b expression levels
[0113] 1. Research Background:
[0114] PWV (Pulse Wave Velocity) is a non-invasive indicator reflecting arterial elasticity and dilatability. It is an indicator of the degree of arterial wall hardening closely related to brain and cardiovascular diseases. It refers to the speed at which a pulse wave travels from one specific location along the arterial wall to another. Utilizing the principle that the propagation speed of the pulse wave generated by the blood pumped by the heart increases during arteriosclerosis, the propagation speed of the pulse wave between the examined sites is measured to determine the elasticity of the blood vessels. A higher value indicates a harder arterial wall. The calculation formula and clinical judgment criteria are: Acquisition = Distance / Time Difference (Δt). A higher PWV value indicates a harder blood vessel wall. Clinically, the degree of vascular hardening is often used to represent the degree of vascular aging.
[0115] Peripheral blood vessel volume (PWV) represents the degree of vascular stiffness. An increase in PWV is an important clinical indicator for assessing vascular aging and provides a reliable indicator for evaluating the effectiveness of clinical interventions. The collected values increase with age, with a baseline value of 1400 cm / s. Higher PWV indicates more severe vascular aging. According to the American College of Cardiology's Medical Science Report: a. <1400 cm / s: Normal arteriosclerosis. b. 1400 cm / s ≤ PWV ≤ 1800 cm / s: Mild peripheral arteriosclerosis. c. PWV > 1800 cm / s: Severe peripheral arteriosclerosis.
[0116] 2. Experimental Methods:
[0117] PWV Measurement: PWV was measured using a fully automated arteriosclerosis detector BP-203RPEⅢ (manufactured by Omron Corporation, Japan). Blood pressure cuffs were placed on the brachial arteries of both upper arms and 2-3 cm above the ankles of both lower limbs. All four cuffs were inflated simultaneously, and the instrument automatically measured the pulse wave conduction time in the upper arms and ankles. The average pulse wave conduction velocity of both arteries was taken as the final statistical value.
[0118] 3. Experimental Results:
[0119] Figure 6 The figure shows the relationship between PWV and tsRNA-3031b expression levels. From... Figure 6 The results showed a positive correlation between plasma vascular volume (PWV) and tsRNA-3031b expression; PWV is a functional marker of vascular aging, and tsRNA-3031b levels were positively correlated with PWV levels. These results indicate that plasma tsRNA-3031b levels can reflect the severity of disease.
[0120] Example 3: In vitro cellular experiments to verify the relationship between tsRNA-3031b expression and vascular aging.
[0121] 1. Cell culture:
[0122] Human vascular smooth muscle cell lines (VSMCs) were purchased from Wuhan Pronosai. The cells were cultured in RPMI-1640 medium with 10% fetal bovine serum at 37°C in a 5% carbon dioxide incubator.
[0123] siRNA knockdown method: siRNA was ordered from Thermo Fisher Scientific. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was measured by qRT-PCR after 24 hours of induction.
[0124] 2. Cell-induced senescence treatment:
[0125] Cultured VSMCs were exposed to 10 mM D-galactose (D-gal) to induce cellular senescence. D-gal is a well-established senescence model inducing agent, a more potent glycation agent than glucose, and capable of inducing oxidative stress. D-gal concentrations can induce cytotoxicity and senescence-like changes, causing VSMCs to secrete senescence-related proteins (such as P21 and IL-1β). After 24 h, the levels of tsRNA and senescence-related protein mRNA in VSMCs were compared with those in the control group.
[0126] 3. The qRT-PCR method is the same as in Example 1.
[0127] 4. Galactosidase staining experiment:
[0128] Cells were stained using the Beyotime galactosidase staining kit (C0602). In 6-well plates, the cell culture medium was aspirated, and the cells were washed once with PBS. 1 mL of galactosidase staining fixative was added, and the plates were fixed at room temperature for 15 minutes. The cell fixative was then aspirated, and the cells were washed three times with PBS for 3 minutes each time. PBS was then aspirated, and 1 mL of staining working solution was added to each well. The staining working solution was prepared as follows: 10 μL of galactosidase staining solution a, 10 μL of galactosidase staining solution b, 930 μL of galactosidase staining solution c, and 50 μL of X-Gal solution. The plates were incubated overnight at 37°C, and the 6-well plates were sealed with plastic wrap to prevent evaporation. Note: Incubation at 37°C cannot be performed in a CO2 incubator. Cells were observed under a regular optical microscope.
[0129] 5. Experimental Results:
[0130] like Figure 7 As shown, the expression levels of galactosidase, a marker of vascular cell aging, and tsRNA-3031b showed a good correlation, indicating that tsRNA-3031b has good diagnostic efficacy.
[0131] Figure 8A After transfecting VSMCs with tsRNA-3031b siRNA, tsRNA-3031b expression was reduced. Figure 8B The results show that the total amount of mRNA remained unchanged after tsRNA-3031b knockdown, indicating successful transfection. Subsequent experiments were then conducted based on this result.
[0132] Figure 9A and Figure 9B To detect the mRNA expression of two cell senescence markers in VSMCs after transfection with tsRNA-3031b siRNA, Figure 9A This indicates the expression status of senescence protein markers in P21 cells. Figure 9B The expression of IL-1β is a phenotypic marker related to cellular senescence secretion. It is evident that knocking down tsRNA-3031b reduced the expression of P21 and IL-1β mRNA, indicating that knocking down tsRNA-3031b can slow down cellular senescence, and tsRNA-3031b may serve as a therapeutic target for vascular senescence.
[0133] Figure 10A and Figure 10B To determine the expression levels of galactosidase in tsRNA-3031b knockdown and control VSMCs after D-gal treatment, this study investigated the following: Normal cells cease division after a limited number of divisions, exhibiting irreversible growth arrest, indicating cellular senescence. At this point, senescence-related galactosidases are activated. Galactosidases are lysosomal hydrolases, but their activity is upregulated in senescent cells. Based on this phenomenon and principle, using galactosides as substrates, senescent cell-specific galactosidases catalyze the production of a blue product, manifested as blue deposits in the cytoplasm. Cells or tissues expressing galactosidase that turn blue can be easily observed under a light microscope. In the control group treated with D-gal, the blue substrate staining by galactosidase was increased, indicating more severe cellular senescence. Knockdown of tsRNA-3031b reduced the expression of galactosidase, indicating that the degree of D-gal-induced cellular senescence was alleviated after knockdown of tsRNA-3031b, thus achieving an anti-senescence effect. This suggests that tsRNA-3031b may serve as a therapeutic target for vascular senescence at the cellular level.
[0134] The above results indicate that tsRNA-3031b is significantly associated with vascular aging, making it a novel biomarker for vascular aging. tsRNA-3031b expression was upregulated in vascular cells treated with the aging-inducing agent D-gal; ROC curves showed that tsRNA-3031b possesses good diagnostic capabilities for patients with vascular aging, suggesting that tsRNA-3031b may be involved in the aging-inducing effect of D-gal on vascular cells. In conclusion, tsRNA-3031b holds promise as a novel diagnostic biomarker and therapeutic target for vascular aging.
[0135] Example 4: Composition of the sequence, primers, and reagent kit involved in this invention.
[0136] The nucleotide sequence of the vascular aging biomarker tsRNA-3031b provided by this invention is shown in SEQ ID No. 1, and it is derived from the tRFdb database with the number 3031b.
[0137] SEQ ID No.1:TCGCTGGTTCGAATCCGGCTCGGAGGACCA
[0138] The primer pair specifically recognizing tsRNA-3031b provided by this invention includes the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3:
[0139] SEQ ID No.2:GCTGGTTCGAATCCGGCT
[0140] SEQ ID No. 3:
[0141] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTCCT
[0142] The reagent kit provided by this invention consists of:
[0143] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primers, RNase-free purified water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10μM), ROX Reference dye (50x).
Claims
1. The application of a reagent for detecting tsRNA biomarkers, characterized in that... Including one or more of the following applications: A1) Application in the preparation of diagnostic products for vascular aging; A2) Application in the preparation of products for screening vascular aging; The tsRNA marker is tsRNA-3031b, and its nucleotide sequence is shown in SEQ ID No.
1.
2. The application as described in claim 1, characterized in that: The product is designed to diagnose vascular aging by detecting tsRNA-3031b expression levels using RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms.
3. The application as described in claim 1, characterized in that: The reagent is used to detect the expression level of tsRNA-3031b, or to specifically recognize tsRNA-3031b, or to detect the content of tsRNA-3031b.
4. The application as described in claim 1, characterized in that... The reagent is for detecting tsRNA-3031b, specifically a), b), or c) below. a) Primers used to detect or specifically recognize tsRNA-3031b; b) A reagent group containing the reagents described in a); c) A kit containing either a) or b).
5. The application as described in claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the stem-loop reverse transcription primer shown in SEQ ID No. 3.