Corn gene ZmC3H38, overexpression vector and application thereof

Abstract

The invention discloses a corn gene ZmC3H38, an overexpression vector and application of the corn gene ZmC3H38, and relates to the technical field of plant genetic transformation. The corn gene ZmC3H38 with the nucleotide sequence as shown in SEQ ID NO.1 is subjected to codon optimization, and an optimized gene with the nucleotide sequence as shown in SEQ ID NO.2 is obtained. An overexpression vector of the optimized gene is constructed, and by transferring the overexpression vector into arabidopsis thaliana, the drought stress resistance of the obtained overexpression strain is obviously improved. Therefore, the corn gene ZmC3H38 and the overexpression vector can be used for preparing drought-resistant strains and have remarkable potential in plant breeding and drought stress resistance.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic transformation, and in particular to a corn gene ZmC3H38, an overexpression vector and applications thereof. Background Art

[0002] corn( Zea mays L. Corn is the largest grain crop in my country and is also an important feed crop and industrial raw material. Corn is cultivated across a wide range of regions in China, primarily in Northeast China, North China, and Southwest China. However, with the ongoing global climate change, drought poses a serious challenge to corn growth and yield. In recent years, global warming has been evident, with frequent extreme weather events, particularly drought, posing a significant challenge to corn growth and yield. Although Southwest China enjoys relatively abundant rainfall, seasonal droughts also pose a threat to corn growth and yield. To address the challenges posed by drought to corn production, increasing investment in agricultural water infrastructure and improving irrigation conditions can improve water resource efficiency. However, to fundamentally address the drought problem, promoting the cultivation of drought-tolerant corn varieties and improving their adaptability to drought through breeding and dissemination of drought-resistant corn varieties is the most effective approach.

[0003] CCCH (C3H) type zinc finger proteins are an important class of transcriptional regulatory factors in plants. They usually regulate gene expression by binding to mRNA or DNA, and play a key role in the process of plant resistance to drought. When plants encounter drought stress, these proteins can activate or inhibit downstream genes to help maintain cell homeostasis and reduce oxidative damage. The poplar C3H type zinc finger protein PuC3H35 gene has been shown to be crucial for the root system to cope with drought. Studies have found that under drought conditions, PuC3H35 can directly bind to the promoters of genes related to proanthocyanidin (PA) and lignin biosynthesis, thereby upregulating the expression of these genes, which enhances the antioxidant capacity and mechanical support capacity of plant roots. The sweet potato IbC3H18 gene also exhibits important drought resistance functions. Its overexpression can regulate cell membrane stability and antioxidant enzyme activity, thereby improving the plant's tolerance to drought stress. In the model plant Arabidopsis, AtTZF1、AtTZF2 and AtTZF3 Genes that respond to salt and ABA induction, AtTZF1 ( AtC3H23 ) 、AtTZF2 ( AtC3H20 )and AtTZF3 ( AtC3H49 ) gene overexpression can enhance the tolerance of plants to drought, oxidative and salt stress. ZmC3H54 Genes were heterologously expressed in rice and found ZmC3H54Overexpression of the gene in rice can improve the drought tolerance of transgenic rice, and transgenic rice seedlings are more sensitive to exogenous ABA. ZmC3H54 This gene may regulate plant drought tolerance through the ABA signaling pathway. More genes encoding C3H-type zinc finger proteins are yet to be discovered and their functions characterized, contributing to the comprehensive research on C3H-type zinc finger proteins.

[0004] It should be noted that the information disclosed in the above background technology section is only used to enhance the understanding of the background of the present disclosure, and therefore may include information that does not constitute prior art known to ordinary technicians in the field. Summary of the Invention

[0005] The purpose of the present invention is to provide a corn gene with drought resistance potential, which can be applied in crop drought resistance breeding to effectively improve the drought resistance of crops.

[0006] To achieve the above objectives, the present invention provides a use of the maize gene ZmC3H38 in plant breeding, including use in producing drought-resistant strains, reducing damage caused by drought stress, and improving plant drought tolerance. The nucleotide sequence of the gene encoding the maize gene ZmC3H38 is shown in SEQ ID NO. 1 or 2.

[0007] The maize gene ZmC3H38 provided by the present invention can be particularly used in plants such as maize and Arabidopsis thaliana to improve the drought tolerance of the plants.

[0008] The present invention also provides an overexpression vector that can be used to improve the drought tolerance of plants. The overexpression vector comprises a nucleotide sequence such as that shown in SEQ ID NO. 1 or 2.

[0009] The overexpression vector provided by the present invention is selected from a eukaryotic plasmid or a shuttle plasmid, and plasmid pFGC5941 is particularly preferred.

[0010] The present invention also provides an Agrobacterium that can be used to improve plant drought tolerance. The Agrobacterium comprises a nucleotide sequence such as that shown in SEQ ID NO. 1 or 2, or comprises the above-mentioned overexpression vector.

[0011] The Agrobacterium provided by the present invention is preferably selected from Agrobacterium GV3101.

[0012] The present invention also provides a method for improving plant drought tolerance, wherein the drought tolerance of the plant can be improved by overexpressing the coding gene of the nucleotide sequence shown in SEQ ID NO. 1 or 2, or the above-mentioned overexpression vector, or the above-mentioned Agrobacterium in the plant. The method is particularly useful for improving the drought tolerance of plants such as Arabidopsis thaliana.

[0013] The present invention has the following advantages: The present invention discloses a maize gene ZmC3H38. After codon optimization, the gene is heterologously expressed in Arabidopsis thaliana. Under drought conditions, compared with wild plants, the overexpression can significantly reduce the accumulation of malondialdehyde in the plant, effectively reducing plant damage. At the same time, the soluble sugar, proline and enzyme activity of the overexpressed transgenic plants are significantly higher than those of the wild type, indicating that the overexpression of the ZmC3H38 gene can increase the accumulation of osmotic substances such as soluble sugar and proline and increase enzyme activity to cope with the damage caused by drought stress to the plant and improve the drought resistance of the plant. The invention has broad application prospects in crop drought resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 For amplification ZmC3H38 Electrophoresis results of gene fragments.

[0015] Figure 2 for ZmC3H38 Diagram of the construction pattern of gene overexpression recombinant plasmid.

[0016] Figure 3 for ZmC3H38 Growth phenotypes of gene overexpressing plants.

[0017] Figure 4 for ZmC3H38 PCR identification results of transgenic plants expressing the gene.

[0018] Figure 5 The growth phenotypes of wild plant WT and transgenic plant OE-ZmC3H38 after drought stress.

[0019] Figure 6 WT and OE- before and after drought stress treatment ZmC3H38 Results of malondialdehyde, soluble sugar, and proline content determination in transgenic Arabidopsis plants.

[0020] Figure 7 WT and OE- before and after drought stress treatment ZmC3H38 Determination results of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX) contents in transgenic Arabidopsis plants. DETAILED DESCRIPTION

[0021] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0022] Note: Unless otherwise noted, the experimental methods in the following examples are conventional methods, performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples, unless otherwise noted, are commercially available.

[0023] Experimental Example 1: Acquisition of ZmC3H38 gene fragment and construction of expression vector The CDS sequence of the ZmC3H38 (Zm00001d037769) gene was downloaded from the maize genome https: / / alpha.maizegdb.org / . The sequence length is 1182bp, and the specific nucleotide sequence is shown in SEQ ID NO.1. Specific primers ZmC3H38-F and ZmC3H38-R before the ZmC3H38 gene sequence was optimized, as well as specific primers ZmC3H38-F (same as before optimization) and ZmC3H38-2R after the ZmC3H38 gene sequence was optimized (the specific sequence is as follows, the underlined part is the homology arm). The TCC of the 389th serine of the coding gene can be optimized to AGC. The nucleotide sequence of the optimized sequence is shown in SEQ ID NO.2. After sequence optimization, its amplification effect is significantly improved. RNA of maize B73 material was extracted and reverse transcribed into cDNA. The cDNA was used as a template to amplify the ZmC3H38 gene fragment. The electrophoresis results of the amplified product are shown in Figure 1 As shown, lane 1 is the amplification result before sequence optimization, lanes 2 and 3 are the amplification results after sequence optimization, and lane 4 is a negative control in which the template is water.

[0024] ZmC3H38 before optimization (SEQ ID NO.1): After optimization of ZmC3H38 (SEQ ID NO. 2): ZmC3H38-F (SEQ ID NO. 3), restriction site XhoI: TCATTTGGAGAGGACACGCTCGAG ATGATGATGATGGGAGAGAGAG; ZmC3H38-R (SEQ ID NO. 4), restriction site XbaI: CCGGGTCTTAATTAACTCTCTAGA TCAGTTGATGAGGTCGGAGAC; ZmC3H38-2R (SEQ ID NO.5), restriction site XbaI: CCGGGTCTTAATTAACTCTCTAGA TCAGTTGATGAGGTCGCTGAC.

[0025] The target band was recovered by conventional construction method and connected to the pFGC5941 overexpression vector containing CaMV35S promoter to construct the overexpression recombinant plasmid CaMV35S:: ZmC3H38 , the construction model is as follows Figure 2 The vector confers resistance to kanamycin in prokaryotes and to glufosinate-ammonium (Basta) in eukaryotes.

[0026] Experimental Example 2 Plant genetic transformation and transgenic identification The constructed overexpression recombinant plasmid was introduced into Agrobacterium GV3101 and transformed into the model plant Arabidopsis thaliana using the floral dipping method. T0 generation Arabidopsis seeds were then harvested. The harvested T0 generation seeds were then sown in pots filled with nutrient soil and vermiculite at a ratio of 1:1. Based on the resistance of the pFGC5941 overexpression vector in eukaryotic organisms (plants), when the Arabidopsis thaliana had two true leaves, they were sprayed with 50mg / L glufosinate-ammonium solution for resistance screening. Arabidopsis plants that had successfully been introduced with the CaMV35S::ZmC3H38 recombinant plasmid grew normally, while the leaves of non-resistant seedlings gradually turned yellow and eventually died. The growth phenotype of the overexpression plants was shown in Figure 2. Figure 3 shown.

[0027] DNA was extracted from five resistant Arabidopsis plants and PCR amplified using primers 35S-F (specific sequence as follows) and ZmC3H38-2R to detect whether the ZmC3H38 gene was successfully introduced into Arabidopsis. Transgenic plants OE- ZmC3H38 The transgenic plants that tested positive were self-fertilized to obtain transgenic plants that could be stably inherited. The PCR identification results of each line are shown in Figure 4 As shown, lanes 1-5 are the extracted DNAs of the five strains, and lane 6 is the negative control in which the template is water.

[0028] 35S-F (SEQ ID NO.6): ATCCCACTATCCTTCGCAAGACCCTT Experimental Example 3 Phenotypic Identification of Transgenic Plants Wild-type Arabidopsis thaliana (WT) and OE-ZmC3H38 (OE-ZmC3H38) were sown simultaneously in small pots with a 1:1 ratio of nutrient soil and vermiculite. After 48 hours of low-temperature treatment at 4°C, they were placed in a light incubator at 24°C with a photoperiod of 16 hours of light and 8 hours of darkness for 3 weeks. The WT and OE-ZmC3H38 materials were then divided into two groups: one group was cultured normally, and the other group was subjected to natural drought treatment. The growth of the two groups was observed after 1 week. Under normal growth conditions, there was no significant difference in the growth of the WT and OE-ZmC3H38 materials. After 7 days of natural drought treatment, both WT and OE-ZmC3H38 plants were affected by drought stress, especially the WT plants, whose leaves lost green color and were severely damaged. Compared with the OE-ZmC3H38 plants, the damage was more severe. The specific growth phenotypes are shown in Figure 2. Figure 5 shown.

[0029] Experimental Example 4 Physiological indicators and enzyme activity detection 1. Physiological index detection: Under drought stress, plant lipids readily form lipid peroxides, which are gradually broken down into malondialdehyde (MDA). Therefore, MDA levels can represent the level of lipid oxidation, or the extent of plant damage. Carbohydrates are an important component of plants and serve as a primary metabolic raw material and storage medium. Proline is widely present in plants and animals, and its accumulation significantly increases under adverse conditions. Increases in soluble sugars and proline can, to a certain extent, reflect a plant's stress tolerance and serve as physiological indicators for resistance breeding.

[0030] Detection of WT and OE- ZmC3H38 Malondialdehyde, soluble sugar, and proline contents in transgenic Arabidopsis plants.

[0031] (1) Determination of malondialdehyde content: Malondialdehyde can condense with thiobarbituric acid to form a red product with a maximum absorption peak at 532 nm. The absorbance at 600 nm is measured simultaneously, and the MDA content is calculated using the difference between the absorbance at 532 nm and 600 nm. Weigh approximately 0.1 g of tissue, add 1 mL of extract (V3), grind on ice to form a homogenate, take the supernatant (i.e., the crude sample extract), transfer it to a 2 mL centrifuge tube, and place it on ice until used. Take 0.1 mL of sample (V2) + 0.3 mL of thiobarbituric acid (V1 = 0.1 + 0.3 mL), seal with plastic wrap, pierce the air hole, and mix thoroughly; incubate in a 95°C water bath for 30 min, cool to room temperature, and centrifuge at 10,000 rpm at 25°C for 10 min. 200 μL of supernatant was pipetted into a 96-well plate, and the absorbance at 532 nm and 600 nm was measured, recorded as A532 and A600, respectively. ΔA was calculated as A532-A600. MDA content (nmol / g fresh weight) = [ΔA × V1 ÷ (ε × d) × 109] ÷ (W × V2 ÷ V3); where V1 is the total volume of the reaction system, 0.4 mL; ε is the molar extinction coefficient of malondialdehyde, 155 × 103 L / mol / cm; d is the optical path of the 96-well plate, 0.5 cm; V2 is the volume of sample added, 0.1 mL; V3 is the volume of extract added, 1 mL; and W is the sample mass, 0.1 g. Under normal growth conditions, WT and OE- ZmC3H38 There was no significant difference in the malondialdehyde content between transgenic Arabidopsis plants. After drought treatment, the malondialdehyde content between WT and OE- ZmC3H38 The MDA content in overexpressed Arabidopsis was increased, but OE- ZmC3H38 The accumulation of MDA in overexpressed Arabidopsis was significantly lower than that in WT material, indicating that OE- ZmC3H38 The level of lipid oxidation in the overexpression material was lower than that in the WT, and the degree of damage was lower. The results of malondialdehyde content determination under different treatment conditions are shown in Figure 6 As shown in A.

[0032] (2) Determination of soluble sugar content: The soluble sugar content was determined using the anthrone colorimetric method. Approximately 0.1 g of sample was weighed, 1 mL of distilled water (V2) was added, and the mixture was ground into a homogenate. The mixture was transferred to a 2 mL centrifuge tube, sealed with plastic wrap, and pierced with air holes. The tube was placed in a boiling water bath for 10 min. After cooling, the tube was centrifuged at 8000 rpm for 10 min at room temperature. 1 mL of supernatant (i.e., the crude sample extract) was transferred to a new 2 mL centrifuge tube for later use. 200 μL of sample solution (V1) (200 μL of distilled water was added to the blank tube) + 200 μL of distilled water + 100 μL of anthrone solution + 1000 μL of concentrated sulfuric acid, and the mixture was mixed. The tube was placed in a 95°C water bath for 10 min. After cooling to room temperature, the absorbance of the blank tube and the absorbance of the test tube were measured at 620 nm. The sample absorbance value ΔA = A test tube - A blank tube. Based on the standard curve: absorbance value y = 0.225x + 0.0423 (R² = 0.916), calculate the sample concentration x (mg / mL). Soluble sugar content (mg / g fresh weight) = (x × V1) ÷ (W × V1 ÷ V2), where V1 is the sample volume added, 0.2 mL; V2 is the extract volume, 1 mL; and W is the sample fresh weight, g. Under normal growth conditions, WT and OE- ZmC3H38 There was no significant difference in the soluble sugar content of transgenic Arabidopsis plants. After drought treatment, the MDA content in both WT and OE-ZmC3H38 overexpressing Arabidopsis increased, but the accumulation of soluble sugar in OE-ZmC3H38 overexpressing Arabidopsis was significantly higher than that in WT materials, indicating that OE-ZmC3H38 overexpressing materials can accumulate more soluble sugar, maintain cell morphology, regulate water absorption and loss, and ensure normal physiological functions of cells and their ability to survive in adversity. The results of soluble sugar content determination under different treatment conditions are shown in Figure 6 As shown in B.

[0033] (3) Determination of proline content: Proline was extracted with sulfosalicylic acid (SA). After heating, Proline reacted with an acidic ninhydrin solution to produce a red color. After extraction with toluene, the absorbance was measured at 520 nm. Weigh 0.1 g of tissue, add 1 mL of extraction solution (V2), grind on ice to form a homogenate, remove the supernatant, transfer to a 2 mL centrifuge tube, seal with plastic wrap, pierce the air hole, and place in a boiling water bath for 10 min. After cooling, centrifuge at 8000 rpm for 10 min at room temperature. Remove 1 mL of the supernatant (i.e., the crude sample extract) and transfer to a new 2 mL centrifuge tube for later use. Prepare a 0.25 mL sample (V1) solution, add 0.25 mL glacial acetic acid, and react with 0.25 mL ninhydrin solution in a 95°C water bath for 30 min. After cooling, add 0.5 mL toluene, shake for 30 s, and let stand for 2 min to allow the pigment to transfer to the toluene. Pipette 0.2 mL of the upper layer solution into a micro quartz cuvette or a 96-well plate, compare the color at a wavelength of 520 nm using the toluene solution as a reference, and record the absorbance. According to the standard curve y = 0.02605x - 0.0021 (x is the proline content, μg / mL; y is the absorbance value A), the Pro content (μg / g fresh weight) was calculated as [(x+0.0021) ÷0.02605×V1]÷(W×V1÷V2), where V1 is the volume of sample added to the reaction system, 0.25 mL; V2 is the volume of extract added, 1 mL; and W is the sample weight, 0.1 g. Under normal growth conditions, WT and OE- ZmC3H38 There was no significant difference in the proline content of transgenic Arabidopsis plants. After drought treatment, the proline content in both WT and OE-ZmC3H38 overexpressing Arabidopsis increased, but the proline content in OE- ZmC3H38 The accumulation of proline in overexpressed Arabidopsis was significantly higher than that in WT material, indicating that OE- ZmC3H38 Overexpression materials can accumulate more proline, maintain the balance of water inside and outside the cells, regulate the osmotic pressure inside and outside the cells, and maintain normal cell expansion and physiological functions under drought stress conditions. The results of proline content determination under different treatment conditions are shown in Figure 6 As shown in C.

[0034] 2. Enzyme activity detection Under drought stress, the activities of protective enzymes in plants, such as superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX), change. Studies have shown that the activities of these protective enzymes gradually increase with increasing drought stress. Drought-tolerant materials exhibit greater stability in the activities of these enzymes, with less activity decline even under severe drought stress. The activities of SOD (Cat#BC0170), POD (Cat#BC0090), CAT (Cat#BC0200), and APX (Cat#BC0220) were measured in WT and OE-ZmC3H38 transgenic plants before and after drought stress using kits from Beijing Solarbio Science & Technology Co., Ltd. Under normal growth conditions, there was no significant difference in the activities of SOD, POD, CAT and APX between WT and OE-ZmC3H38 transgenic Arabidopsis plants. After drought treatment, the activities of SOD and POD increased, but the increase in the activities of SOD and POD in OE-ZmC3H38 material was significantly higher than that in WT material. The results are shown in Figure 2. Figure 7 A and B in the figure; after drought treatment, APX activity in WT material decreased significantly, while APX activity in OE-ZmC3H38 material increased significantly, while CAT activity showed a decreasing trend in both WT and OE-ZmC3H38 materials. The decrease in CAT activity in OE-ZmC3H38 material was smaller, and CAT activity was significantly higher than that in WT plants. The results are shown in Figure 1. Figure 7 C and D in Figure 3. These results indicate that the enzyme activity of OE-ZmC3H38 material is relatively more stable, and heterologous expression of ZmC3H38 can significantly improve the drought tolerance of Arabidopsis.

[0035] The present invention cloned a CCCH-type zinc finger protein encoding the ZmC3H38 gene from the maize genome. To improve cloning efficiency, the codon degeneracy was exploited to optimize the TCC bases 1165-1167 of the ZmC3H38 gene sequence to AGC leucine without altering the protein sequence. An overexpression vector for the ZmC3H38 gene was then constructed and transformed into Arabidopsis thaliana for heterologous expression. The phenotype of the ZmC3H38 gene-overexpressing plants was identified under natural drought conditions. Soluble sugar, proline, and malondialdehyde content, as well as enzyme activity, were measured using colorimetry in both WT and ZmC3H38 gene-overexpressing transgenic plants under drought conditions. Compared with WT, the accumulation of malondialdehyde in transgenic plants overexpressing the ZmC3H38 gene was significantly lower than that in WT plants, indicating that under drought stress, WT plants suffered more severe damage and accumulated more malondialdehyde; the soluble sugar, proline and enzyme activity of transgenic plants overexpressing the ZmC3H38 gene were significantly higher than those of WT, indicating that overexpression of the ZmC3H38 gene can increase the accumulation of osmotic substances such as soluble sugar and proline and increase enzyme activity to cope with the damage caused by drought stress to plants and improve the drought tolerance of plants. It has broad application prospects in crop drought resistance breeding.

[0036] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. Application of maize gene ZmC3H38 in plant breeding, characterized in that: The nucleotide sequence of the maize gene ZmC3H38 encoding gene is shown in SEQ ID NO. 1 or 2.

2. The use according to claim 2, characterized in that The application includes: Preparation of drought-resistant strains; Reduce damage caused by drought stress; Improve the drought tolerance of plants.

3. The use according to claim 1 or 2, characterized in that The plant comprises Arabidopsis thaliana.

4. An overexpression vector that can be used to improve plant drought tolerance, characterized in that: The overexpression vector comprises a nucleotide sequence as shown in SEQ ID NO. 1 or 2.

5. The overexpression vector according to claim 4, characterized in that The overexpression vector is selected from pFGC5941.

6. An Agrobacterium that can be used to improve plant drought tolerance, characterized in that: The Agrobacterium comprises a nucleotide sequence as shown in SEQ ID NO. 1 or 2, or comprises the overexpression vector according to any one of claims 4-5.

7. The Agrobacterium according to claim 6, characterized in that The Agrobacterium was selected from GV3101.

8. A method for improving drought tolerance of plants, characterized in that: By overexpressing the coding gene of the nucleotide sequence as shown in SEQ ID NO. 1 or 2, the overexpression vector according to any one of claims 4-5, or the Agrobacterium according to any one of claims 6-7 in a plant, the drought tolerance of the plant can be improved.

9. The method according to claim 8, characterized in that The plant comprises Arabidopsis thaliana.

Images