Saccharomyces cerevisiae for improving flavor of lucid ganoderma and preparation and application thereof

Abstract

The invention provides saccharomyces cerevisiae capable of improving flavor of lucid ganoderma and preparation and application of the saccharomyces cerevisiae, the strain is saccharomyces cerevisiae INM3120, the strain is preserved in the Guangdong Microbial Culture Collection Center on October 21, 2024, the preservation number is GDMCC N0: 65310, and the preservation address is the fifth floor, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City, Guangdong Province. The method has the advantages that the saccharomyces cerevisiae has substances capable of reducing bitter taste of the lucid ganoderma, and products applying the fermented lucid ganoderma do not have peculiar smell and can be mixed with other products for use in the later period, so that nutrition and effects of the lucid ganoderma are reserved, and safety risks are avoided.

Description

Technical Field

[0001] The invention relates to a brewer's yeast for improving the flavor of ganoderma lucidum and its preparation and application. Background Art

[0002] Ganoderic acids include A, B, C, D, E, and F. Some international scholars believe that the content of ganoderic acids in Ganoderma lucidum fruiting bodies increases with maturity and is concentrated in the periphery. In Japan, the ganoderic acid content of Ganoderma lucidum products is highly valued, particularly the levels of ganoderic acids A, B, C, and D. Ganoderic acids are mostly tetracyclic triterpenes, highly oxidized lanosteranes. Ganoderic acids can inhibit the release of histamine in cells, enhance the function of various organs in the digestive system, and also have lipid-lowering and blood pressure-lowering properties, as well as liver-protecting effects. A 2019 study by Geng et al. showed that the highest content of ganoderic acid A reached 16.1%, followed by ganoderic acid B at 10.6% and ganoderic acid C at 5.4%. Furthermore, ganoderic acid A is the primary component of Ganoderma lucidum's bitterness and astringency; higher ganoderic acid A content indicates a stronger bitterness, a major bottleneck in the application of Ganoderma lucidum in conventional foods. Among the many types of ganoderic acid, ganoderic acid D and ganoderic acid B are non-bitter. Ganoderic acid A and ganoderic acid D share the same structural formula, differing primarily in that the terminal ganoderic acid A undergoes dehydrogenation to produce ganoderic acid D. This suggests that oxidizing ganoderic acid A to produce ganoderic acid D can effectively reduce the bitterness associated with ganoderic acid.

[0003] Saccharomyces cerevisiae, also known as baker's yeast or budding yeast, is the yeast most commonly associated with humans. It is used to make foods such as bread and steamed buns, as well as to make wine. Saccharomyces cerevisiae cells are spherical or ovoid, and the strains commonly used in the liquor industry typically have a diameter of 4 to 6 μm. They reproduce by budding. Saccharomyces cerevisiae shares many structural features with animal and plant cells, which are also eukaryotic organisms. Due to its ease of cultivation, yeast is used as a model organism for eukaryotic research.

[0004] Currently, there are many studies on the production of ganoderic acid using engineered strains of Saccharomyces cerevisiae, but these studies remain at the experimental stage, and genetically modified strains cannot be used in food. Furthermore, there is relatively little research on the debittering of ganoderic acid A.

[0005] Patent: A method for debittering Ganoderma lucidum and preparing Ganoderma lucidum beverage - 201010246739.2;

[0006] Patent: Ganoderma lucidum tea and compound Ganoderma lucidum tea and preparation method thereof - 201410085380.3;

[0007] Patent: A debittering system for Ganoderma lucidum processing - CN202210335898.2. The three invention patents involve methods that primarily use alcohol as a debittering agent to soak Ganoderma lucidum, combined with a later method for removing the raw alcohol. They do not involve debittering using microbial conversion methods. Furthermore, two patents involve complex processes and pose the risk of residual alcohol in the raw Ganoderma lucidum. Since only three of the above patents mention debittering Ganoderma lucidum, it can be seen that the process for debittering Ganoderma lucidum while retaining its relevant functionality is currently unseen in China. Therefore, developing a safe and effective strain that converts ganoderic acid A to reduce bitterness in Ganoderma lucidum has broad application prospects. Summary of the Invention

[0008] In view of the above problems, the present invention provides a brewer's yeast for improving the flavor of Ganoderma lucidum and its preparation and application.

[0009] The invention aims to achieve the following objectives: a brewer's yeast for improving the flavor of Ganoderma lucidum,

[0010] The strain is Saccharomyces cerevisiae INM3120, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on October 21, 2024, with the deposit number: GDMCC N0: 65310, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0011] A method for preparing brewer's yeast for improving the flavor of Ganoderma lucidum is as follows:

[0012] (1) Obtaining Saccharomyces cerevisiae from sourdough samples;

[0013] (2) Screening of Saccharomyces cerevisiae: The obtained different Saccharomyces cerevisiae strains were cultured to the logarithmic growth phase, and then inoculated with 1% of the strain at a final concentration of 1×10 6 cfu / mL, inoculated into the screening culture medium solution, placed in 30℃ static culture for 3 days to obtain the fermentation liquid, and measured the content of ganoderic acid A and ganoderic acid D, and screened according to the content of ganoderic acid A and ganoderic acid D;

[0014] (3) Select strains with low ganoderic acid A content and high ganoderic acid D content.

[0015] Furthermore, the screening medium is YNB medium prepared according to requirements, sterilized at 0.1 MPa and 121° C. for 15 min, and 0.01% ganoderic acid A (w / w) is added when used.

[0016] Application of Saccharomyces cerevisiae to improve the flavor of Ganoderma lucidum.

[0017] Application of brewer's yeast for improving the flavor of Ganoderma lucidum to reduce the content of ganoderic acid A in Ganoderma lucidum products.

[0018] Application of brewer's yeast in fermenting Ganoderma lucidum fermentation liquid to improve Ganoderma lucidum flavor.

[0019] Application of Saccharomyces cerevisiae as a starter culture to improve the flavor of Ganoderma lucidum.

[0020] The advantages of the present invention are as follows: (1) Saccharomyces cerevisiae has the ability to reduce the bitterness of Ganoderma lucidum, and the products using fermented Ganoderma lucidum will not have any peculiar smell and can be mixed with other products in the later stage, thus retaining the nutrition and efficacy of Ganoderma lucidum without any safety risks;

[0021] (2) The strain screening method is universal and can be widely used to screen strains that can reduce the content of ganoderic acid A in Ganoderma lucidum powder. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the liquid chromatography spectrum of the ganoderic acid A standard product in Example 1.

[0023] Figure 2 This is the liquid chromatography spectrum of the ganoderic acid D standard product in Example 1.

[0024] Figure 3 This is the liquid phase spectrum of Ganoderic acid A in the fermented Zhiling fermented liquid of the control group in Example 3.

[0025] Figure 4 This is the liquid phase spectrum of Ganoderic acid D in the fermented Zhiling fermented liquid of the experimental group in Example 3. DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to specific embodiments:

[0027] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0028] Example 1, with reference to Figure 1-2 A brewer's yeast that improves the flavor of Ganoderma lucidum,

[0029] The strain is Saccharomyces cerevisiae INM3120, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on October 21, 2024, with the deposit number: GDMCC N0: 65310, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0030] A method for preparing brewer's yeast for improving the flavor of Ganoderma lucidum is as follows:

[0031] (1) Obtaining Saccharomyces cerevisiae from sourdough samples;

[0032] (2) Screening of Saccharomyces cerevisiae: The obtained different Saccharomyces cerevisiae strains were cultured to the logarithmic growth phase, and then inoculated with 1% of the strain at a final concentration of 1×10 6 cfu / mL, inoculated into the screening culture medium solution, placed in 30℃ static culture for 3 days to obtain the fermentation liquid, and measured the content of ganoderic acid A and ganoderic acid D, and screened according to the content of ganoderic acid A and ganoderic acid D;

[0033] (3) Select strains with low ganoderic acid A content and high ganoderic acid D content.

[0034] The invention discloses a preparation method of brewer's yeast for improving the flavor of ganoderma lucidum. The screening culture medium is YNB culture medium prepared according to requirements, sterilized at 0.1 MPa and 121 DEG C for 15 minutes, and 0.01% (w / w) ganoderic acid A is added during use.

[0035] A method for preparing brewer's yeast for improving the flavor of Ganoderma lucidum is as follows:

[0036] 1. Preliminary screening of bacterial strains

[0037] The 9 strains stored in the laboratory were inoculated into malt juice liquid culture medium at 1% inoculation volume, and cultured at 30℃ and 220rpm / min on a shaker for 24h. 6 cfu / mL) were inoculated into screening culture medium and incubated at 30°C in a shaker at 220 rpm / min for 24 h. Samples were taken from each tube and centrifuged at 10,000 rpm / min for 10 min. The supernatant was used as the sample. The ganoderic acid A and D content was determined, and the results are shown in Table 1.

[0038] Ganoderic acid detection method: refer to NY_T 2278-2012 Determination of Ganoderic acid content in Ganoderma lucidum products

[0039] Table 1 Results of screening different yeasts for the production of ganoderic acid D

[0040]

[0041]

[0042] The three strains S-4, S-7 and S-10 with the highest ganoderic acid D degradation rates were selected for rescreening.

[0043] 2. Strain rescreening

[0044] The three yeast strains S-4, S-7 and S-10 selected in the initial screening were reactivated and cultured to ferment and concentrate the Ganoderma lucidum liquid. The bacterial concentration was 10 6 cfu / mL, fermentation time 24-48h, fermentation temperature 30℃, make fermented Ganoderma lucidum liquid enzyme for sensory evaluation, the results are shown in Table 2

[0045] Table 2 Sensory analysis of fermented Ganoderma lucidum enzyme

[0046] Strain name bitterness Flavor Average score S-4 5.0 5.0 5.0 S-7 5.0 4.5 4.75 S-10 4.5 4.5 4.5

[0047] Note: The maximum score for each indicator is 5 points, and the higher the score, the better the result.

[0048] As can be seen from the results in Table 2, S-4 has a moderate taste, no odor, and the sensory evaluation results are the best. S-7 has a strong sour taste, and S-10 has a strong bitter taste but is different from the bitterness of Zhiling. Therefore, the S-4 strain was screened and obtained as the application strain. According to ITS identification, S-4 is a cerevisiae yeast. The strain was deposited in the Guangdong Provincial Microbial Culture Collection on October 21, 2024, with the deposit number: GDMCCN0: 65310, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province. Therefore, INM3120 and S-4 in this application refer to the same strain.

[0049] The ITS gene sequence of Saccharomyces cerevisiae INM3120 is:

[0050] TTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACC

[0051] TAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAAACCTCTCTTTGGAAAAAAAAC

[0052] ATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGA

[0053] ATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCTGGAATACCAAGGGGCGCAATGT

[0054] GCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGC

[0055] GTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTC

[0056] CAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGT

[0057] TACCTCTGGGCCCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCAC

[0058] AGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTT

[0059] TGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCT

[0060] GGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAATCCAT.

[0061] Example 2 Genetic Stability Detection of Saccharomyces cerevisiae INM3120

[0062] The Saccharomyces cerevisiae INM3120 from Example 1 was propagated for 10 generations on a malt wort liquid medium. The first, fifth, and tenth generation samples were inoculated onto the screening medium at a 1% inoculum concentration and fermented at 220 rpm / min and 30°C for 24-48 hours. The supernatant obtained was used as the sample and tested for ganoderic acid D content using the same method as in Example 1 to determine its stability through propagation. Specific data are shown in Table 3.

[0063] Table 3 Results of passage stability test

[0064] name Ganoderic acid D (mg / kg) Sensory score INM3120 first generation 52.56±1.18 5.0 INM3120 fifth generation 49.13±2.56 5.0 INM3120 10th Generation 50.45±1.76 5.0

[0065] The results in Table 3 show that the fermentation performance of different generations of Saccharomyces cerevisiae INM3120 strains are normal, the production rate and content of ganoderic acid D vary within 10%, the strains have good genetic stability and meet the requirements for production and use.

[0066] Example 3, reference Figure 1-4 Application of Saccharomyces cerevisiae INM3120 in the production of fermented Ganoderma lucidum fermentation liquid

[0067] Saccharomyces cerevisiae INM3120 was inoculated into the concentrated Ganoderma lucidum liquid, and the concentration of the inoculated fermentation bacteria was 10 4 -10 8 CFU / mL, 220rpm / min, 30℃ fermentation for 24-48h, and make different fermented Ganoderma lucidum fermentation liquids, with yeast S-2 as the control group.

[0068] The extraction and detection methods of ganoderic acid were as shown in Example 1. The results are shown in Table 4.

[0069] Table 4 Results of ganoderic acid content at different bacterial strain concentrations

[0070]

[0071]

[0072] Table 5 Sensory evaluation results of fermented Ganoderma lucidum fermented liquid

[0073] Grouping Inoculum size cfu / mL sour taste bitterness Taste Overall score Control group 1 <![CDATA[1.0×10 4 ]]> 6.5 6.5 7.5 20.5 Experimental Group 1 <![CDATA[1.0×10 4 ]]> 7.5 7 8 22.5 Control group 2 <![CDATA[1.0×10 5 ]]> 6.6 6.4 7.6 20.6 Experimental Group 2 <![CDATA[1.0×10 5 ]]> 8 8.5 8 24.5 Control group 3 <![CDATA[1.0×10 6 ]]> 7.5 8 7.5 23 Experimental Group 3 <![CDATA[1.0×10 6 ]]> 8.5 8.5 9 26 Control group 4 <![CDATA[1.0×10 7 ]]> 7.5 8.5 8 24 Experimental Group 4 <![CDATA[1.0×10 7 ]]> 9 9 9 27 Control group 5 <![CDATA[1.0×10 8 ]]> 6 7.5 7.4 20.9 Experimental Group 5 <![CDATA[1.0×10 8 ]]> 7 7 8 22

[0074] Note: Each assessment has a maximum score of 10 points, with a scoring interval of 0.1. The comprehensive score is the sum of all the items. The higher the score, the better the result.

[0075] The results in Table 4 and Table 5 show that the cerevisiae yeast INM3120 can significantly reduce the ganoderic acid A content in the fermented Ganoderma lucidum liquid, and the higher the inoculation amount, the lower the ganoderic acid A content, while the ganoderic acid D content is higher. However, too high an inoculation concentration of cerevisiae yeast INM3120 affects the flavor of the Ganoderma lucidum liquid. This is because the metabolism of cerevisiae yeast has a significant effect on the sourness, bitterness and taste of the fermented Ganoderma lucidum liquid. Therefore, the most suitable inoculation concentration is 1.0×10 7 CFU / mL, the concentration of this strain can effectively increase the content of Ganoderic acid D (test results such as Figure 4 ), and can improve the flavor and taste of fermented Ganoderma lucidum fermented liquid.

[0076] Example 4: Making Toast with Saccharomyces cerevisiae INM3120

[0077] The final concentration of Saccharomyces cerevisiae INM3120 was 10 7 The fermented Ganoderma lucidum fermentation liquid was prepared with a dosage of 100 CFU / mL to replace the water for making toast, and then toast was made according to the national standard GB / T14612-2008 method. The experimental strain S-2 was used as the control group. After the fermentation was completed, the hardness of the toast was tested and the ganoderic acid D content was measured according to the method in Example 1. At the same time, professional tasters were asked to conduct a sensory evaluation of the toast flavor. The results are recorded in Table 6.

[0078] Hardness testing: A flat-bottomed cylindrical probe, P / 36R, was used. Test conditions were as follows: pre-test speed: 1 mm / s; test speed: 1 mm / s; post-test speed: 3 mm / s; compression level: 50%; dwell interval: 5 seconds; trigger value: 5 g. Each test was repeated five times.

[0079] Table 6 Toast detection and sensory evaluation results

[0080]

[0081]

[0082] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0083] From the results in Table 6, we can see that 10 7 The fermentation of Ganoderma lucidum fermented liquid with CFU / mL of brewer's yeast INM3120 can significantly increase the content of Ganoderma lucidum acid D in toast; in addition, it can also improve the sensory evaluation of toast, increase the aroma of toast, enhance the flavor and taste of toast, and make the toast fragrant, sweet and sour.

[0084] Example 5: Fermentation of Ganoderma lucidum fermented liquid with Saccharomyces cerevisiae INM3120 to produce beverages

[0085] The final concentration of Saccharomyces cerevisiae INM3120 was 10 7 The fermented Ganoderma lucidum fermented liquid was prepared with a dosage of 100 CFU / mL, and then prepared into a ready-to-eat beverage according to a certain ratio. The fermented Ganoderma lucidum fermented liquid was prepared with the experimental strain S-2 as a control group. After the fermentation was completed, the content of ganoderic acid D in the prepared beverage was detected according to the method in Experimental Example 1. Professional tasters were asked to perform sensory evaluation on the flavor of the beverage. The results are recorded in Table 7.

[0086] Table 7 Detection and sensory evaluation results of ganoderic acid D in current edible beverages

[0087]

[0088]

[0089] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0090] From the results in Table 7, we can see that 10 7 CFU / mL of brewer's yeast INM3120 can be used to make ready-to-eat beverages, which can significantly increase the content of ganoderic acid D in the beverages; in addition, it can also improve the sensory evaluation of ganoderic beverages, increase the aroma of the beverages, enhance the flavor and taste of the beverages, and make the beverages sweet and sour.

[0091] Example 6: Fermentation of Ganoderma lucidum fermentation liquid with Saccharomyces cerevisiae INM3120 to produce flavored yogurt

[0092] The final concentration of Saccharomyces cerevisiae INM3120 was 10 7CFU / mL was used to prepare fermented Ganoderma lucidum fermentation liquid, and then flavored fermented yogurt was prepared according to the national standard GB / T19302-2025 method. The fermented Ganoderma lucidum fermentation liquid prepared with the experimental strain S-2 was used as a control group. After the fermentation was completed, the content of ganoderic acid D in the flavored fermented milk was detected according to the method in Experimental Example 1, and the acidity of the flavored fermented yogurt was detected according to the GB / T19302-2025 standard. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavored fermented yogurt, and the results are recorded in Table 8.

[0093] Table 8 Detection and sensory evaluation results of ganoderic acid D in yogurt

[0094]

[0095]

[0096] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0097] From the results in Table 8, we can see that 10 7 The fermentation of Ganoderma lucidum fermentation liquid with CFU / mL of brewer's yeast INM3120 can significantly improve the bitterness of yogurt caused by directly adding Ganoderma lucidum, while increasing the content of Ganoderma acid D; in addition, it can also improve the sensory evaluation of yogurt, increase the Ganoderma lucidum aroma of yogurt, and enhance the flavor and taste of yogurt.

[0098] Based on the results of the above examples, the brewer's yeast (Saccharomyces cerevisiae) INM3120 provided by the present invention, when applied to the fermentation of Ganoderma lucidum fermentation liquid, can significantly improve the bitterness of ganoderic acid A and increase the content of ganoderic acid D in the relevant Ganoderma lucidum without changing the existing process, while also improving the flavor and taste of the product, significantly improving the product quality.

[0099] Application of Saccharomyces cerevisiae to improve the flavor of Ganoderma lucidum.

[0100] Application of brewer's yeast for improving the flavor of Ganoderma lucidum to reduce the content of ganoderic acid A in Ganoderma lucidum products.

[0101] Application of brewer's yeast in fermenting Ganoderma lucidum fermentation liquid to improve Ganoderma lucidum flavor.

[0102] Application of Saccharomyces cerevisiae as a starter culture to improve the flavor of Ganoderma lucidum.

[0103] The above-described embodiments merely represent several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous modifications and improvements without departing from the scope of the present invention. Therefore, the scope of protection of the patent for this invention shall be subject to the appended claims.

Claims

1. A brewer's yeast for improving the flavor of Ganoderma lucidum, characterized by: The strain is Saccharomyces cerevisiae INM3120, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on October 21, 2024, with the deposit number: GDMCC N0: 65310, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

2. A method for preparing a brewer's yeast for improving the flavor of Ganoderma lucidum according to claim 1, characterized in that: as follows: (1) Obtaining Saccharomyces cerevisiae from sourdough samples; (2) Screening of Saccharomyces cerevisiae: The obtained different Saccharomyces cerevisiae strains were cultured to the logarithmic growth phase, and then inoculated with 1% of the strain at a final concentration of 1×10 6 cfu / mL, inoculated into the screening culture medium solution, placed in 30℃ static culture for 3 days to obtain the fermentation liquid, and measured the content of ganoderic acid A and ganoderic acid D, and screened according to the content of ganoderic acid A and ganoderic acid D; (3) Select strains with low ganoderic acid A content and high ganoderic acid D content.

3. The method for preparing a brewer's yeast for improving the flavor of Ganoderma lucidum according to claim 1, characterized in that: The screening culture medium is YNB culture medium prepared according to requirements, sterilized at 0.1 MPa and 121° C. for 15 min, and 0.01% (w / w) ganoderic acid A is added when used.

4. Use of the saccharomyces cerevisiae for improving the flavor of Ganoderma lucidum as claimed in claim 1.

5. Use of the Saccharomyces cerevisiae for improving the flavor of Ganoderma lucidum as claimed in claim 1 for reducing the content of ganoderic acid A in Ganoderma lucidum products.

6. Application of brewer's yeast to ferment Ganoderma lucidum fermentation liquid to improve the flavor of Ganoderma lucidum.

7. Application of brewer's yeast as a starter to improve the flavor of Ganoderma lucidum.

Images