Application of petroleum ether extract of depinatin in treatment of liver cancer

Abstract

The invention discloses an application of a petroleum ether extract of depinatin in treatment of liver cancer, and belongs to the field of prevention and treatment of liver cancer. The invention provides application of GC-PE (Gas Chromatography-Poly Ethylene) in treating or preventing liver cancer, and reveals that the GC-PE treatment can obviously reduce the cell viability of human liver cancer cells Hep-G2, and the action mechanism of the GC-PE treatment is possibly related to the promotion of Hep-G2 cell cycle arrest and apoptosis. Compared with a positive drug paclitaxel (PTX), the GC-PE has a more remarkable effect of inhibiting proliferation and invasion of liver cancer cells. A network pharmacological analysis result shows that the depinatin can promote cycle arrest and apoptosis of liver cancer cells through a PI3K / AKT signal channel, and combination of active ingredients in the depinatin and key target protein PIK3CA in the PI3K / AKT signal channel is predicted through molecular docking, so that the anti-tumor effect of the depinatin is achieved.

Description

Technical Field

[0001] The invention belongs to the field of liver cancer prevention and treatment, and particularly relates to application of a petroleum ether extract of Jiejinabao in treating liver cancer. Background Art

[0002] Jiejinabao, also known as coarse gentian, is one of the four original plants of the Tibetan medicinal herb Gentiana macrophylla. Its large rhizome and abundant yield yield a high level of extractable active ingredients. It is expected to replace Gentiana macrophylla as the primary source of Gentiana macrophylla, alleviating the current supply pressure. Jiejinabao is a perennial herbaceous plant of the Gentianaceae family and a commonly used ingredient in Traditional Chinese Medicine. Its root is typically used for its rheumatic, pain-relieving, damp-heat-clearing, blood-tonifying, and diuretic properties. It is used to treat rheumatic pain, muscle and bone cramps, hot flashes due to bone steaming, damp-heat jaundice, and bloody stools.

[0003] In recent years, due to its crucial role in tumor development and its potential therapeutic implications, research on apoptosis has become a hot topic in the international life sciences. Currently, most scholars believe that tumor development and progression is not solely the result of uncontrolled cell proliferation, but can also be due to blocked apoptosis, or the failure of cells that should undergo apoptosis to do so. Modern medical research confirms that Traditional Chinese Medicine (TCM) can induce apoptosis in tumor cells by interfering with processes such as tumor growth and metabolic proliferation. Numerous clinical trials have demonstrated the efficacy of TCM alone or in combination with Western medicine in treating tumors, with inducing apoptosis as one of the primary pathways. Furthermore, the molecular mechanisms of TCM in treating tumors may involve two approaches: specifically inducing apoptosis in tumor cells while sparing normal cells. These mechanisms enhance the body's own defenses, such as immune function, and ultimately allow the body to kill tumor cells or induce apoptosis. This may contribute to its low toxicity and high efficacy.

[0004] Current research mainly focuses on the effects of Jiejinabao decoction on liver cancer. The anti-tumor effect is weak, the duration is short, and the mechanism of action is still unclear. Therefore, it is necessary to explore new methods for extracting Jiejinabao and to further study the mechanism of action in treating liver cancer. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the present invention aims to provide an application of a petroleum ether extract of Jiejinabao in the treatment of liver cancer, thereby solving the problems in the prior art.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The preparation method of the petroleum ether extract of Jiejinabao comprises the following steps:

[0008] S1, after washing and drying, cut into small pieces, dry and grind into powder and sieve to obtain; then the sieved powder is soaked in ethanol, and multiple heating and boiling refluxing and filtering are performed; then the ethanol is removed by rotary evaporation to obtain the ethanol extract of Jujuboside B;

[0009] S2, the ethanol extract of Jujuboside B is dissolved and suspended in distilled water, and the suspension is extracted with petroleum ether multiple times until the supernatant is colorless and transparent; the extract is concentrated by rotary evaporation to obtain the petroleum ether extract phase.

[0010] S3, the petroleum ether extract phase is freeze-dried to obtain the petroleum ether extract of Jujuboside B.

[0011] Further, the Jujuboside B powder is sieved with an 80-mesh sieve.

[0012] Further, in S1, the temperature of the rotary evaporation is 58°C, and the rotation speed is 63 r / min; in S2, the temperature of the rotary evaporation is 38°C, and the rotation speed is 45 r / min.

[0013] The petroleum ether extract of Jujuboside B is prepared by the above preparation method.

[0014] The petroleum ether extract of Jujuboside B is prepared by the above preparation method.

[0015] Further, the treatment or prevention includes that the petroleum ether extract of Jujuboside B binds with PIK3CA to inhibit the expression of PIK3CA.

[0016] A medicine includes: the petroleum ether extract of Jujuboside B.

[0017] Further, the medicine further includes a nanoparticle carrier for wrapping the petroleum ether extract of Jujuboside B.

[0018] Further, the nanoparticle carrier is a liposome or a polymer-based nanoparticle.

[0019] The application of the PIK3CA inhibitor in the preparation of a medicine for treating or preventing liver cancer.

[0020] The beneficial effects of the application are as follows:

[0021] 1. The petroleum ether extract of Jujuboside B provides a new effective way for the treatment of liver cancer.

[0022] 2. By constructing a cell model and an experimental method, the influence data of GC-PE on the apoptosis of Hep-G2 cells are obtained, which provides a new research direction for the effect and mechanism of GC-PE on liver cancer. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0024] Figure 1 This is an analysis diagram of the effect of the present invention on the viability of normal human liver cells L-02 and human liver cancer cells Hep-G2;

[0025] Figure 2 Schematic diagram of apoptosis of Hep-G2 cells in each group of the present invention;

[0026] Figure 3 Schematic diagram of the Hep-G2 cell cycle in each group of the present invention;

[0027] Figure 4 Schematic diagram of the invasion ability of Hep-G2 cells in each group of the present invention;

[0028] Figure 5 Schematic diagram of the expression of apoptosis and cell cycle related genes in each group of Hep-G2 cells of the present invention;

[0029] Figure 6 Schematic diagram of the expression of Cleaved Caspase3 / Caspase3, Bcl-2, BAX, CDK4, and CD1 proteins in each group of Hep-G2 cells of the present invention;

[0030] Figure 7 It is the intersection gene Venn diagram between the petroleum ether extract of Jiejinabao and hepatocellular carcinoma of the present invention;

[0031] Figure 8 This is a drug-ingredient-target network diagram between the petroleum ether extract of Jiejinabao and hepatocellular carcinoma of the present invention;

[0032] Figure 9 This is a core target protein interaction network diagram between the petroleum ether extract of Jiejinabao and hepatocellular carcinoma;

[0033] Figure 10 This is a biological function enrichment analysis diagram of the intersection genes between the petroleum ether extract of Jiejinabao and hepatocellular carcinoma;

[0034] Figure 11 This is a molecular docking analysis diagram of the active ingredients and key targets between the petroleum ether extract of Jiejinabao and hepatocellular carcinoma;

[0035] Figure 12 It is the cell experiment technology roadmap of the present invention. DETAILED DESCRIPTION

[0036] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0037] Example 1

[0038] like Figure 12 As shown, the preparation method of GC-PE comprises the following steps:

[0039] S1, the plant Jie Jina Bao (provided by the Medical College of Tibet University for Nationalities and identified by Professor Zhao Qin of Tibet University for Nationalities) was washed with clean water, dried and chopped, placed in an electric constant temperature blast drying oven, dried to constant weight at 80°C, and ground into powder using a Chinese medicine grinder (brand: Red Sun Electromechanical Co., Ltd., model: 800C) and passed through an 80-mesh sieve; according to the mass volume ratio of the sample to 95% ethanol (brand: Aladdin, specification: AR) (1:3) (g / ml), 200 g of Jie Jina Bao was weighed and placed in a 1 L beaker, 600 ml of 95% ethanol was added, the beaker was sealed with plastic film, and the beaker was soaked at room temperature for more than 12 h, and then the material liquid was heated to boil and reflux for 1 h by heating reflux method, filtered, and the material residue was added with 200 ml of 95% ethanol solvent according to the material-liquid volume ratio (1:1), heated and refluxed for 1 h, filtered, and the above operation was repeated. The filtrates were combined three times and the filtrates were evaporated using a rotary evaporator (brand: German Heidolf Instrument Co., Ltd., model: Hei-CHILL 350) was extracted by rotation at 58 ° C (speed 63 r / min) and concentrated until there was no alcohol, thereby obtaining the ethanol extract of Jiejinabao.

[0040] S2. The obtained Jiejinabao ethanol extract was dissolved and suspended in 500 ml of distilled water, and the suspension was extracted 4-5 times with 500 ml of petroleum ether (brand: Aladdin, specification: 60-90 type) until the supernatant was colorless and transparent. The extracts were combined and concentrated using a rotary evaporator at 38°C (speed 45 r / min) to remove ether, and the petroleum ether extract phase was obtained. The extract was then freeze-dried in a vacuum freeze dryer (brand: Qingdao Yonghe Chuangxin Electronic Technology Co., Ltd., model: CTFD-10S-U) for 24 hours until the solution was viscous and granular, thereby obtaining the Jiejinabao petroleum ether extract, which was stored in a 4°C refrigerator for later use.

[0041] The following examples are used to analyze the therapeutic uses of GC-PE. Figure 12 As shown;

[0042] In the following examples, human hepatocellular carcinoma cells Hep-G2 were purchased from Wuhan Punuosai Life Science Co., Ltd. (Cat. No. CL-0103); normal human hepatocytes L-02 were purchased from Shanghai Jinyuan Biotechnology Co., Ltd. (Cat. No. JY034). HepG2 cells were cultured in MEM medium containing 10% FBS, and L-02 cells were cultured in 1640 medium containing 10% FBS in a 37°C, 5% CO2 incubator. The medium was changed every 1-2 days. When the cell density reached 80%, the cells were subcultured at a ratio of 1:2. In the in vitro tumor cell inhibition experiment, Hep-G2 cells were treated with various concentrations of the petroleum ether extract of Degeneres for 24 hours, and 100 nM PTX was used as a positive control.

[0043] In addition, for detailed information about PTX used in the examples, please refer to the literature: The Sineoculis Homeobox Homolog 1 (SIX1) Gene Regulates Paclitaxel Resistance by Affecting Reactive Oxygen Species and Autophagy in Human Hepatocellular Carcinoma Cell Line HepG2, DOI: 10.12659 / msm.906361.

[0044] Example 2

[0045] In this example, it is used to demonstrate that GC-PE (prepared in Example 1) treatment can significantly reduce the cell viability of Hep-G2 cells, but does not affect the cell viability of normal human liver cells L-02;

[0046] The experimental process is:

[0047] Human hepatoma cells Hep-G2 and normal human liver cells L-02 in logarithmic growth phase were cultured at 5×10 3 Cells were seeded at a density of 100 μg / ml in 96-well plates and cultured overnight at 37°C. After 24 hours of treatment with fresh culture medium containing different concentrations of the petroleum ether extract of Ginabo (100, 200, 300, 400, 500, 600, 700, 800, 900, and 1000 μg / ml), cells were collected. 100 nM PTX was used as a positive control, and five replicate wells were set up for each group. After treatment, the supernatant was discarded, and 10 μl of CCK-8 solution was added to each well and incubated at 37°C in the dark for 2 hours. Optical density (D) at 540 nm was measured using a microplate reader to calculate cell viability.

[0048] The experimental results are as follows Figure 1 As shown, Figure 1a in the figure represents the results of CCK-8 assay on L-02 cells; Figure 1 b in the figure represents the results of CCK-8 assay on Hep-G2 cells; among them, the GC-PE groups at various concentrations were compared with the 0-dose group without GC-PE treatment, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; the GC-PE group was compared with the positive control PTX group, # P < 0.05;

[0049] Specifically, if Figure 1 As shown in Figure a, the experimental results of CCK-8 show that for L-02 cells, the cell viability does not change with the increase of GC-PH concentration. However, in Hep-G2 cells, Figure 1 As shown in Figure (b), GC-PH affects cell viability at concentrations as low as 400 μg / ml, and cell viability gradually decreases with increasing concentration. Compared to the positive drug PTX group, GC-PH at concentrations of 900 and 1000 μg / ml exhibited a stronger inhibitory effect on Hep-G2 cell viability. It is also important to note that PTX can affect the viability of normal human hepatocyte L-02 cells.

[0050] Example 3

[0051] This example is used to demonstrate that GC-PE (prepared in Example 1) treatment can promote apoptosis of Hep-G2 cells.

[0052] Flow cytometry was used to detect the effect of petroleum ether extract of Jiejinabao on the apoptosis rate of Hep-G2 cells; according to the experimental results of CCK-8, three concentrations of GC-PE (200μg / ml, 400μg / ml and 600μg / ml) were selected to treat the cells.

[0053] The experimental results are as follows Figure 2 The specific statistics are shown in Table 1 below:

[0054] Table 1 Apoptosis rate of each group

[0055]

[0056] Note: By comparing different concentrations of GC-PE group with Ctrl (control) group, ***P < 0.001, ****P < 0.0001; by comparing GC-PE group with PTX group, ## P < 0.01;

[0057] from Figure 2As can be seen from Table 1, compared with the control group, the three concentrations of GC-PE significantly increased the apoptosis rate of Hep-G2 cells, and the apoptosis-promoting effect of high-dose GC-PE was stronger than that of PTX.

[0058] Example 4

[0059] In this example, it is used to demonstrate that GC-PE treatment leads to cell cycle arrest and inhibits the proliferation of Hep-G2 cells.

[0060] Flow cytometry results Figure 3 As shown in Table 2 below:

[0061] Table 2 Cell percentages in each group at different stages

[0062]

[0063]

[0064] Note: **P<0.01, ***P<0.001 compared with Ctrl group; **P<0.01, ***P<0.001 compared with PTX group; ## P<0.01.

[0065] From Table 2 and Figure 3 As can be seen in the results, compared with the control group, GC-PE treatment resulted in a significant increase in the number of cells in the G0 / G1 phase and a significant decrease in the number of cells in the S phase. Compared with the PTX group, GC-PE showed a more pronounced effect in increasing the number of cells in the G0 / G1 phase and decreasing the number of cells in the S phase.

[0066] Example 5

[0067] In this example, it was used to demonstrate that GC-PE treatment inhibited the invasion of Hep-G2 cells.

[0068] The experimental procedure involved laying Matrigel at the bottom of a Transwell chamber to form a barrier. The cells to be tested were seeded into the upper chamber and treated with GC-PE before culturing for 24 hours. The cells were fixed with paraformaldehyde, stained with crystal violet, and observed under an inverted microscope to count the number of penetrating cells.

[0069] Flow cytometry results Figure 4 As shown in the figure (the scale bar is 100 μm), the details are shown in Table 3 below:

[0070] Table 3 The number of penetrating cells in each group

[0071]

[0072] Note: **P<0.01, ***P<0.001 compared with Ctrl group; **P<0.01, ***P<0.001 compared with PTX group; ## P<0.01.

[0073] from Figure 4 As shown in Table 3, compared with the Ctrl group, GC-PE treatment weakened the invasion ability of Hep-G2 cells. Compared with the PTX group, the GC-PE / H group had a more significant inhibitory effect on cell invasion.

[0074] Example 6

[0075] In this example, it is used to demonstrate the expression of apoptosis and cell cycle-related genes in Hep-G2 cells.

[0076] The experimental procedure was as follows: Cellular RNA was extracted using the Tissue / Cell RNA Rapid Extraction Kit (MF036-01, Polymer) according to the manufacturer's instructions. Equal amounts of mRNA were reverse transcribed into cDNA using the One-Tube One-Step Genomic DNA Removal and Reverse Transcription Kit (G3337-50, Sevier). Quantitative real-time PCR was performed using 2× Universal BlueSYBR Green qPCR Master Mix (G3328-15, Sevier) on a Viia 7 quantitative real-time PCR instrument. The following primers were used:

[0077] CD1F (SEQ ID NO. 1): CAATGACCCCGCACGATTTC;

[0078] CD1R (SEQ ID NO.2): CATGGAGGGCGGATTGGAA;

[0079] CDK4F (SEQ ID NO.3): ATGGCTACCTCTCGATATGAGC;

[0080] CDK4R (SEQ ID NO.4): CATTGGGGACTCTCACACTCT;

[0081] BCL2F (SEQ ID NO.5): GGTGGGGTCATGTGTGTGG;

[0082] BCL2R (SEQ ID NO.6): CGGTTCAGGTACTCAGTCATCC;

[0083] BAXF(SEQ ID NO.7):CCCGAGAGGTCTTTTTCCGAG;

[0084] BAXR(SEQ ID NO.8): CCAGCCCATGATGGTTCTGAT;

[0085] GAPDHF(SEQ ID NO.9):CTGGGCTACACTGAGCACC;

[0086] GAPDHR (SEQ ID NO. 10): AAGTGGTCGTTGAGGGCAATG.

[0087] qRT-PCR quantification was performed by the 2-ΔCt method.

[0088] The experimental results are as follows Figure 5 As shown, Figure 5 a in the figure shows the expression level of CD1 gene; Figure 5 b shows the CDK4 gene expression level; Figure 5 c in the figure shows the expression level of Bcl-2 gene; Figure 5 The expression levels of BAX genes are shown in Table 4.

[0089] Table 4 Expression levels of apoptosis and cell cycle related genes in each group

[0090]

[0091] Note: *: Compared with the Ctrl group, the difference was statistically significant (P < 0.05); #: Compared with the PTX group, the difference was statistically significant (P < 0.05).

[0092] from Figure 5 As shown in Table 4, compared with the Ctrl group, the expression of the anti-apoptotic gene Bcl-2 was decreased and the expression of the pro-apoptotic gene BAX was increased in the GC-PE / M group (P < 0.05). The expression of CD1, CDK4, and Bcl-2 was decreased and BAX expression was increased in the GC-PE / H group (P < 0.05). Compared with the PTX group, the GC-PE / H group had a more significant effect in decreasing the expression of CD1 and Bcl-2 and increasing the expression of BAX (P < 0.05).

[0093] Example 7

[0094] In this example, it is used to demonstrate the expression of Cleaved Caspase3 / Caspase3, Bcl-2, BAX, CDK4, and CD1 proteins in Hep-G2 cells;

[0095] The experimental process is as follows: HepG2 cells were lysed using RIPA lysis buffer containing 1x protease and phosphatase inhibitors, and the protein supernatant was collected after centrifugation at 13,000 rpm at 4°C. Protein concentration was quantified using a BCA kit (PQ003, Zhonghui Hecai). A small portion of the extracted protein solution was extracted and diluted 40 times with PBS. A standard solution was prepared, and a standard curve was drawn based on the measured OD value. The protein concentration of the sample was determined by the OD value of each sample (the sample amount was determined based on the protein concentration). The protein samples were separated on a 12% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was then blocked with 5% skim milk powder for 1-2 hours. The primary antibody was incubated with the membrane overnight. After washing with TBST buffer, the membrane was incubated with the correspondingly diluted secondary antibody at room temperature. Chemiluminescence was used to visualize protein bands using an ECL kit.

[0096] The experimental results are as follows Figure 6 As shown, Figure 6 Panel a shows the expression level of Cleaved Caspase3 / Caspase3 protein; Figure 6 b in the figure shows the expression level of Bcl-2 protein; Figure 6 c in the figure shows the expression level of BAX protein; Figure 6 d in the figure shows the expression level of CDK4 protein; Figure 6 e in the figure shows the expression level of CD1 protein;

[0097] from Figure 6 As can be seen from the results, compared with the Ctrl group, the expression of Cleaved Caspase3 / Caspase3 increased, and the expression of Bcl-2, CDK4, and CD1 decreased in the GC-PE / M group (P < 0.05). In the GC-PE / H group, the expression of CD1, CDK4, and Bcl-2 decreased, and the expression of BAX and Cleaved Caspase3 / Caspase3 increased (P < 0.05). Compared with the PTX group, the GC-PE / H group had a more significant effect in reducing CDK4 expression and increasing BAX expression.

[0098] Example 8

[0099] In this case, by collecting chemical components and target predictions of Jiejinabao and obtaining hepatocellular carcinoma-related targets, we conducted PPI detection and biological analysis on the core targets between the two. Molecular docking analysis was also used to explore the key signaling pathways and target proteins that Jiejinabao uses to exert its anti-tumor effects.

[0100] 1. Collection of chemical components and target prediction of Jiejinabao;

[0101] All targets of all components of Jiejinabao were retrieved by SwissTargetprediction (http: / / www.swisstargetprediction.ch / ), and the obtained targets were sorted by Uniprot

[0102] After data calibration (https: / / www.uniprot.org / ), invalid duplicate targets were deleted to obtain standardized gene names. A total of 450 component targets were obtained after deduplication using Probability > 0 as the criterion for inclusion of targets in SwissTargetprediction.

[0103] 2. Acquisition of hepatocellular carcinoma-related targets;

[0104] The GeneCards (https: / / www.genecards.org / ) and OMIM (https: / / www.omim.org / ) databases were searched for the keyword "Hepatocellular carcinoma" to identify disease-related targets. All targets from the two databases were integrated into Excel, duplicate genes were removed, and the target genes were corrected using the Uniprot database to obtain disease target gene information. Using a Relevance score >5 as the criterion for inclusion in the GeneCards database, 3435 and 194 targets for hepatocellular carcinoma were obtained from the GeneCards and OMIM databases, respectively. A total of 3579 targets related to hepatocellular carcinoma were obtained after union, and the resulting genes were corrected using the Uniprot database.

[0105] 3. Drug-ingredient-target prediction results;

[0106] The target of the drug and the intersection target genes of hepatocellular carcinoma were drawn into a Venn diagram, and 254 intersection target genes of hepatocellular carcinoma and drugs were obtained, which were the interactive target genes of the drug Jiejinabao in treating hepatocellular carcinoma (such as Figure 7 As shown). Using the drug-ingredient-target data, the "network.xlsx" file and the "type.xlsx" file were constructed and imported into Cytoscape 3.7.2 for plotting. The graph includes 281 nodes and 540 edges. The top five core components in terms of degree are: Rutaecarpine, Hydroxyevodiamine, Diosgenin, Oleanolic Acid, Evodiamine (as shown). Figure 8 As shown, the V-shape represents the drug, the circle represents the ingredient, and the rectangle represents the target).

[0107] 4. Core targets and network interactions;

[0108] The 254 intersection target genes obtained above were imported into the String (https: / / string-db.org / ) database for protein-protein interaction prediction. The species was set to Homo Sapiens and the confidence was set to 0.9. The network file was saved in TSV format and imported into Cytoscape 3.8.2 software to draw the protein interaction network. Targets with Degree values ​​> 4 were selected. The graph included 100 nodes and 968 edges. The network was topologically analyzed, with the degree value reflecting the size and color of the target and the combined score value reflecting the thickness of the edge, thereby constructing a protein-protein interaction network, as shown in Figure 2. Figure 9 Among them, STAT3, SRC, PIK3CA, HSP90AA1, ESR1, AKT1, MAPK1, EGFR, MAPK3, and HRAS are core targets.

[0109] 5. GO enrichment analysis;

[0110] The drug-disease intersection genes were selected and GO gene function enrichment analysis was performed using the DAVID database. A total of 685 GO entries were screened out. With P < 0.01 as the standard, 464 major biological process (BP) entries that were significantly enriched in the treatment of hepatocellular carcinoma with Jiejinabao were screened, mainly involving chromatin remodeling, signal transduction, protein phosphorylation, positive regulation of gene expression, negative regulation of apoptosis, response to external stimuli, cell differentiation, inflammatory response, apoptosis, and insulin receptor signaling pathway; 60 entries were related to cell components (CC), involving cytoplasm, cytoplasm, plasma membrane, nucleus, membrane, nuclear protoplasm, extracellular exosomes, extracellular region, extracellular space, and mitochondria; 152 entries were related to molecular functions (MF), involving protein binding, ATP binding, identical protein binding, zinc ion binding, enzyme binding, protein kinase activity, protein isomerization activity, histone H2AXY142 kinase activity, histone H3Y41 kinase activity, and protein tyrosine kinase activity, such as Figure 10 As shown in a in .

[0111] 6. KEGG pathway enrichment analysis;

[0112] Pathway enrichment analysis was performed using the DAVID database, and a total of 172 pathways related to the treatment of hepatocellular carcinoma with Jiejinabao were enriched. According to P < 0.01, 151 pathways for the treatment of hepatocellular carcinoma with Jiejinabao were screened out, and the pathways related to hepatocellular carcinoma were lipid and atherosclerosis, PI3K-Akt signaling pathway, EGFR tyrosine kinase inhibitor resistance, HIF-1 signaling pathway, insulin resistance, endocrine resistance, cell apoptosis, MAPK signaling pathway, Th17 cell differentiation, ErbB signaling pathway, RAS signaling pathway, neurotrophic factor signaling pathway, IL-17 signaling pathway, T cell receptor signaling pathway, cell senescence, FOXO signaling pathway, tumor necrosis factor signaling pathway, RAP1 signaling pathway, vascular endothelial growth factor signaling pathway, growth hormone synthesis, secretion and action pathways, etc. Figure 10 As shown in b.

[0113] 8. Molecular docking analysis;

[0114] AutoDock Vina (1.1.2) was used to perform molecular docking of the active ingredients and key targets to verify their interaction activity. Based on the previous analysis, the top five important targets were selected for semi-flexible docking with compounds with high affinity values. The binding energy (affinity) is used to indicate the binding quality of the small molecule to the target protein. A binding energy less than 0 indicates that the small molecule and the target protein can bind freely, and the smaller the value, the higher the possibility of binding.

[0115] The docking results are as follows Figure 11 As shown, Figure 11 a in the figure indicates the interaction pattern analysis between Rutaecarpine and ESR1 protein; Figure 11 b in the figure indicates the interaction pattern analysis between Hydroxyevodiamine and HSP90AA1 protein; Figure 11 c in the figure indicates the interaction pattern analysis between Rutaecarpine and PIK3CA protein; Figure 11 d in the figure indicates the interaction pattern analysis between Oleanolic Acid and SRC protein;

[0116] Figure 11 The docking results show that all small molecules can enter the active center of the target protein. The small molecules with the best docking with each protein are selected for display; Rutaecarpine forms hydrogen bonds with TYR-459 and SER-512 of ESR1, and the length of the hydrogen bond is Hydroxyevodiamine forms a hydrogen bond with ASP-93 of HSP90AA1, and the length of the hydrogen bond is Rutaecarpine forms a hydrogen bond with VAL-851 of PIK3CA, and the length of the hydrogen bond is Oleanolic Acid forms hydrogen bonds with ARG-156 and PRO-361 of SRC, and the lengths of the hydrogen bonds are The docking results are detailed in Table 5 below:

[0117] Table 5 Docking results of core small molecules and core target proteins

[0118]

[0119] Molecular docking analysis and KEGG analysis results showed that Jiejinabao may promote liver cancer cell cycle arrest and cell apoptosis through the PI3K / AKT signaling pathway, and the active ingredients in Jiejinabao bind to the key target protein PIK3CA in the PI3K / AKT signaling pathway, inhibiting the expression of PIK3CA and exerting its anti-tumor effect.

[0120] Throughout this specification, references to terms such as "one embodiment," "example," or "specific example" indicate that the specific features, structures, materials, or characteristics described in conjunction with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, schematic representations of these terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0121] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention, and such changes and modifications fall within the scope of the invention as claimed.

Claims

1. A method for preparing a petroleum ether extract of the herb, characterized in that: The following steps are involved: S1, washing, drying and chopping Jiejinabao, grinding into powder after drying and screening to obtain; then soaking the screened Jiejinabao powder in ethanol, heating, boiling, refluxing and filtering multiple times; then removing ethanol by rotary evaporation to obtain Jiejinabao ethanol extract; S2, dissolving and suspending the ethanol extract of Jiejinabao in distilled water, extracting the suspension with petroleum ether several times until the supernatant becomes colorless and transparent, combining the extracts, and then concentrating the extracts by rotary evaporation to obtain a petroleum ether extract phase; S3, freeze-drying the petroleum ether extract to obtain the petroleum ether extract of Ginabo.

2. The method for preparing the petroleum ether extract of Jiejinabao according to claim 1, characterized in that: Screen the ginab powder using an 80-mesh sieve.

3. The method for preparing the petroleum ether extract of Jiejinabao according to claim 1, characterized in that: In S1, the temperature of the rotary evaporation is 58° C. and the rotation speed is 63 r / min; in S2, the temperature of the rotary evaporation is 38° C. and the rotation speed is 45 r / min.

4. The petroleum ether extract of Jiejinabao is characterized in that It is prepared using the preparation method according to any one of claims 1 to 3.

5. Use of the petroleum ether extract of the Herba Gynurae according to claim 4 in the preparation of a medicament for treating or preventing liver cancer.

6. The use according to claim 5, characterized in that The treatment or prevention comprises: the petroleum ether extract of Jiejinabao combines with PIK3CA to inhibit the expression of PIK3CA.

7. A drug, characterized in that include: Degumming petroleum ether extract.

8. The drug according to claim 7, characterized in that The medicine further comprises a nanoparticle carrier for encapsulating the degumming petroleum ether extract.

9. The drug according to claim 8, characterized in that The nanoparticle carrier is a liposome or a polymer-based nanoparticle.

10. Use of PIK3CA inhibitors in the preparation of drugs for treating or preventing liver cancer.

Images