ADC drug targeting PVR and application

By preparing ADC drugs of NTX-1088 antibody and MMAE, the problems of insufficient targeting and endocytosis activity were solved, and efficient treatment of PVR-positive tumors was achieved.

CN120754271APending Publication Date: 2025-10-10THE SECOND AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511097124.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-06
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Existing PVR-targeted antibody drugs have problems with insufficient targeting and endocytosis activity when treating PVR-positive tumors, resulting in poor therapeutic effects.

Method used

The ADC drug was prepared by alkylating the NTX-1088 antibody with maleimide. By reducing the interchain disulfide bonds of the antibody, combining it with MMAE solution, and purifying it using ceramic hydroxyapatite resin, the drug-antibody coupling ratio (DAR) was controlled at 4.1 to maintain the stability and targeting of the antibody.

Benefits of technology

It improves the targeting and endocytic activity of ADC drugs on PVR-positive tumors, significantly enhances the killing effect on PVR-positive tumor cells, and has better therapeutic effects than known ADC drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120754271A_ABST
    Figure CN120754271A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a PVR-targeted ADC drug and application. The advantages of the NTX-1088 antibody are utilized, disulfide bonds between antibody chains are reduced through TCEP, then alkylation reaction of maleimide is carried out to obtain the novel antibody coupling drug, the average drug-antibody coupling ratio (DAR) is 4.1, the naked antibody component is 3%, the monomer content reaches 99.6%, the quality is stable and controllable, repeatability is good, the yield is considerable, and the novel antibody coupling drug is suitable for industrial production. Compared with the prior art, the antibody coupling drug has the advantages that the stability, the affinity, the endocytosis activity and the targeting property of the antibody are not influenced, the biological function of the antibody is well reserved, the antibody coupling drug shows a better solid tumor resisting effect in vivo and in vitro compared with the known ADC, the activity is obviously improved compared with the NTX-1088, and the good application prospect is shown.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to ADC drugs targeting PVR and applications thereof. Background Art

[0002] The advent of antibody-drug conjugates (ADCs) has revolutionized cancer treatment. ADCs attach a bioactive small molecule drug to a monoclonal antibody (mAb) via a linker. The mAb then acts as a carrier for the targeted delivery of the small molecule drug to target cells. This not only enhances the mAb's anticancer efficacy but also reduces the drug's toxicity.

[0003] The poliovirus receptor (PVR) is a transmembrane glycoprotein involved in regulating the adhesion of cells to extracellular matrix molecules. PVR is upregulated in neuroectodermal cancers (including glioblastoma multiforme, medulloblastoma, colorectal cancer, and pancreatic cancer). PVR can also enhance serum-induced Ras-Raf-MEK-ERK activation signals, upregulate cyclins D2 and E, and downregulate p27Kipl, ultimately shortening the G0 / G1 phase of the cell cycle. Blocking PVR on tumor cells is expected to reduce their viability. PVR also plays an important role in angiogenesis, regulating the interaction of vascular endothelial growth factor to induce angiogenesis with integrin a(V)β(3) receptor 2 and its mediated RAPL-Akt signal transduction pathway. Therefore, PVR is a very important target in tumor treatment.

[0004] NTX-1088 is an antibody targeting PVR that is used alone or in combination with one or more additional therapeutic agents to treat PVR-related cancers (Patent Publication Nos.: CN114502595 A; WO2021 / 070181). The NTX-1088 antibody exhibits strong affinity for human PVR and improved immunoreactivity, demonstrating high efficacy in cytotoxic T and NK cell stimulation and in treating cancer in humanized mouse models, including in vivo models of pancreatic and lung cancer.

[0005] This invention leverages the targeting advantages of antibodies to effectively reduce the toxic side effects of toxin drugs, achieving better therapeutic effects and occupying a commanding position in preclinical research and clinical safety evaluation. Therefore, the development of new antibody-drug conjugates provides a novel clinical medication solution for tumor treatment systems. Summary of the Invention

[0006] One of the purposes of the present invention is to provide an ADC drug targeting PVR and its application, which has high targeting, endocytic activity and affinity activity to PVR-positive tumor tissues.

[0007] A second object of the present invention is to provide an anti-tumor drug having an ADC drug, a pharmaceutically acceptable salt, a solvate or a solvate of the salt as an active ingredient and its use.

[0008] In order to achieve the above object, the present invention adopts the following technical means: In a first aspect, the present invention provides a method for preparing an ADC drug targeting PVR, comprising the following steps: S1. Reduce the antibody using a reducing agent; S2. The reduced antibody is reacted with an MMAE solution to obtain a crude drug; S3. Purify the crude drug to obtain the antibody-drug conjugate.

[0009] The term "antibody" herein is used in its broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired biological activity. Antibodies can be murine, human, humanized, chimeric, or derived from other species. Antibodies are proteins produced by the immune system that are capable of recognizing and binding to specific antigens. Target antigens generally have a large number of binding sites, also known as epitopes, that are recognized by the CDRs of multiple antibodies. Each antibody that specifically binds to a different epitope has a different structure. Thus, an antigen may have more than one corresponding antibody. Antibodies include full-length immunoglobulin molecules or immunologically active portions of full-length immunoglobulin molecules, i.e., molecules that contain an antigen or portion thereof that specifically binds to a target of interest, such targets including, but not limited to, cancer cells or cells that produce autoimmune antibodies associated with autoimmune diseases. The immunoglobulins disclosed herein can be of any type (e.g., IgG, IgE, IgM, IgD, and IgA), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA, IgA2), or subclass of immunoglobulin molecules. The immunoglobulins can be derived from any species. However, in one aspect, the immunoglobulins are derived from humans, mice, or rabbits.

[0010] The monoclonal antibodies herein particularly include "chimeric" antibodies, in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in an antibody derived from a particular species or belonging to a particular antibody class or subtype, while the remainder of the chain is identical or homologous to the corresponding sequence in an antibody derived from another species or belonging to another antibody class or subtype, and fragments of chimeric antibodies are also included herein, as long as they exhibit the desired biological activity. Chimeric antibodies of interest herein include "primatized" antibodies, which comprise variable region antigen-binding sequences derived from non-human primates (e.g., Old World Monkey, Ape, etc.) and human constant region sequences.

[0011] Furthermore, in S1, the reducing agent is TCEP, and during mixing, the molar ratio of the reducing agent to the antibody is 2-4 based on the molar amount of the antibody.

[0012] Furthermore, in S1, the antibody is the anti-PVR monoclonal antibody NTX-1088.

[0013] The light chain amino acid sequence of the antibody NTX-1088 is shown in SEQ ID NO. 2, and the heavy chain amino acid sequence is shown in SEQ ID NO. 3.

[0014] Furthermore, in said S1, the reaction temperature is 35-40°C; and / or, in S1, the reaction pH is 5-7; And / or, in S1, the stirring reaction time is 1-2 hours.

[0015] Furthermore, in S2, the concentration of the MMAE solution is 1-20 g / L, or 3-15 g / L, or 5-10 g / L.

[0016] Furthermore, in said S2, the reaction temperature is 20-30°C; And / or, in S2, the stirring reaction time is 1-2 hours.

[0017] Furthermore, in S3, the purification is specifically as follows: using ceramic hydroxyapatite resin as the stationary phase for adsorption, using a mobile phase for gradient elution, and collecting the desired antibody-drug conjugate component peak; In S3, the particle size of the ceramic hydroxyapatite resin is 40 mesh; And / or, in S3, when gradient elution is performed using a mobile phase, when mobile phase A has a pH of 7 and a concentration of 5 mM sodium phosphate, and mobile phase B has a pH of 7 and a concentration of 200 mM sodium phosphate, the volume ratio of mobile phase A to mobile phase B is (9:1) to (7:3).

[0018] Furthermore, the crude drug product in S3 is filtered through a 0.2-1-μm filter before purification.

[0019] In a second aspect, the present invention provides an ADC drug prepared by the above method.

[0020] Furthermore, the present invention provides an ADC drug targeting PVR, a pharmaceutically acceptable salt, a solvate, or a solvate of the salt thereof, wherein the ADC drug is obtained by coupling the NTX-1088 antibody and the dolastatin derivative MMAE; The DAR value of the ADC drug is 3-5.

[0021] Furthermore, the ADC drug, its pharmaceutically acceptable salt, solvate or solvate of the salt, wherein the light chain amino acid sequence of the antibody NTX-1088 is shown as SEQ ID NO. 2, and the heavy chain amino acid sequence is shown as SEQ ID NO. 3.

[0022] In a third aspect, the present invention provides use of an ADC drug, a pharmaceutically acceptable salt, a solvate thereof, or a solvate of the salt in the preparation of a drug for preventing and / or treating anti-tumor.

[0023] Furthermore, the tumor is a PVR-positive solid tumor, including esophageal cancer, squamous cell carcinoma, lung cancer, breast cancer, pancreatic cancer, head and neck cancer, colon cancer, prostate cancer, osteosarcoma cancer, and bladder cancer; further preferably, the tumor is bladder cancer.

[0024] Furthermore, the present invention also provides a pharmaceutical composition for tumor targeted therapy, which contains a pharmaceutically effective amount of the antibody-drug conjugate of the present invention and a pharmaceutically acceptable carrier.

[0025] The term "pharmaceutically acceptable" is intended to include any carrier that does not interfere with the effectiveness of the biological activity of the active ingredient and is nontoxic to the host to which it is administered. For example, for parenteral administration, the active protein can be formulated into an injectable unit dosage form with carriers such as saline, dextrose solution, serum albumin, and Ringer's solution. The active ingredients of the pharmaceutical compositions of the present invention can be administered to a subject via a variety of routes.

[0026] It is well understood by those skilled in the art that excipients (e.g., pharmaceutical excipients) include solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesive agents, integrities, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoaming agents, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculating agents, filter aids, and release retardants.

[0027] Routes of administration include intradermal, transdermal (e.g., sustained-release formulations), intramuscular, intraperitoneal, intravenous, subcutaneous, oral, intracranial, epidural, topical, rectal, and intranasal. Any other therapeutically effective route of administration may be used, such as absorption through epithelial or endothelial tissues, or gene therapy, in which administration of a DNA molecule encoding an active drug (e.g., via a vector) to a patient results in expression and secretion of the active drug in vivo.

[0028] In addition, the antibody-drug conjugates of the present invention can be administered together with other biologically active pharmaceutical ingredients, such as pharmaceutically acceptable surfactants, excipients, carriers, diluents, etc. For parenteral administration (e.g., intravenous, subcutaneous, intramuscular), the antibody-drug conjugates can be formulated into solutions, suspensions, emulsions, or lyophilized powders in combination with pharmaceutically acceptable parenteral carriers (e.g., water, saline, glucose solution) and additives to maintain isotonicity (e.g., mannitol) or chemical stability (e.g., preservatives and buffers). The formulations are sterilized by conventional techniques.

[0029] The present invention leverages the advantages of the NTX-1088 antibody, first reducing the antibody's interchain disulfide bonds with TCEP, and then using maleimide alkylation to obtain a novel antibody-drug conjugate. The average drug-antibody conjugate ratio (DAR) is 4.1, the naked antibody component is 3%, and the monomer content reaches 99.6%. It also features stable and controllable quality, good reproducibility, and a considerable yield. Compared to NTX-1088 itself, the antibody's stability, affinity, endocytosis activity, and targeting are not affected, and its biological function is well preserved. The antibody-drug conjugate of the present invention has demonstrated stronger anti-solid tumor effects than known ADCs both in vitro and in vivo, and its activity is significantly improved compared to NTX-1088, demonstrating promising application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is the HIC-HPLC spectrum of PVR-MMAE of the present invention; Figure 2 SEC-HPLC spectrum of PVR-MMAE of the present invention; Figure 3 Analysis of PVR expression characteristics in various tumor cells; 3A shows the expression level of PVR in bladder epithelial tissue; 3B shows the comparison of the expression patterns of PVR and other drug targets; Figure 4 This is the flow cytometry screening diagram of PVR-positive cells; Figure 5 The results of the analysis of the binding between PVR-MMAE and various tumor cells are shown; Figure 6The results are for the in vitro activity of PVR-MMAE on various tumor cells; Figure 7 To study the efficacy of PVR-MMAE in a mouse bladder cancer model; Figure 8 To study the efficacy of PVR monoclonal antibody conjugated with MMAE, SN-38 and DM1 in mouse bladder cancer models; Figure 9 The results show the endocytosis of PVR-MMAE in various tumor cells. DETAILED DESCRIPTION

[0031] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention is described in detail below in conjunction with specific embodiments. The experimental methods for which specific conditions are not specified in the following examples are usually based on conventional conditions or the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar to or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described in the text are only for demonstration purposes.

[0032] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0033] Example 1 Preparation of ADC Drug (PVR-MMAE) 1.1 Prepare MMAE solution: Dissolve 7.7 mg of MMAE in 1 mL of DMSO to obtain a 7.7 mg / mL MMAE solution. 1.2 Preparation of Anti-PVR Monoclonal Antibody (NTX-1088) Solution: RNA was extracted from mouse spleen tissue and reverse transcribed into cDNA. Using the cDNA (SEQ ID NO. 1) as a template, heavy chain primer pairs and light chain primer pairs were added for PCR amplification. The cDNA was synthesized and cloned into a production vector according to standard molecular biology methods. After amplification in Escherichia coli, positive clone plasmids were extracted and transformed with Agrobacterium tumefaciens to obtain the anti-PVR monoclonal antibody NTX-1088. The light chain amino acid sequence of the antibody NTX-1088 is shown in SEQ ID NO. 2, and the heavy chain amino acid sequence is shown in SEQ ID NO. 3. The anti-PVR monoclonal antibody solution was prepared by dissolving the antibody NTX-1088 in 20 mM histidine-acetate buffer at pH 5.5. Heavy chain primer pair: F1: AGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGCTCTGTTGCCT F2: GGACCGATCCAGCCTCCGGACGCGGCCGCAAACTACAAGACAGACTTGCAAAAG R1: AGACCGATGGGCCCTTGGTGCTAGCGGAGGACACGGTCACCAGGGTGC Light chain primer pair: F1: AGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGCTCTGTTGCCT F2: GGACCGATCCAGCCTCCGGACGCGGCCGCAAACTACAAGACAGACTTGCAAAAG R2: AAGACAGATGGTGCAGCCACCGTACGTTTGATTTCGAGCTTGGTACCCT 1.3 Antibody reduction: Add anti-PVR monoclonal antibody solution (1 equivalent) to the reactor, adjust the pH to 6.5–7, and heat to 37°C with stirring. Add TCEP hydrochloride aqueous solution (2.2 equivalents) to the antibody solution, and stir at 37°C for 90 minutes. 1.4 Antibody-MMAE Coupling: Cool the solution prepared in 1.3 to 25°C and slowly add 7.7 mg / mL MMAE solution dropwise over 10–15 minutes. After the addition is complete, stir the reaction for 1 hour. Then, add L-cysteine ​​(4 equivalents) to quench the reaction and stir at 25°C for 30 minutes. After the reaction is complete, filter the reactant through a 0.2 μm filter. 1.5 Purification: The ADC mixture was purified using a 7.5 mL column chromatography on a ceramic hydroxyapatite resin (40 μm). The protein loading was 15 mg / mL, the flow rate was 1 mL / min, and the column bed height was 22 cm. Mobile phase A consisted of 5 mM sodium phosphate (pH 7) and mobile phase B consisted of 200 mM sodium phosphate (pH 7). The buffer gradient increased from 10% to 70% mobile phase B over 20 column volumes. The first fraction was collected starting from the main peak and continued for the next 6.9 column volumes. Thereafter, fractions were collected every 1 / 3 column volume for a total of four fractions. The first fraction, the ADC product, was collected with a protein yield of 85–88%.

[0034] Example 2 Determination of Antibody Ratio and Drug Distribution of ADC Drug (PVR-MMAE) Reference material (25 μL) and test samples were diluted to 2 mg / mL with diluent (half the concentration of mobile phase A) and injected onto a Thermo Propac HIC-10 column (4.6 mm × 10 cm, 5 μm). Chromatographic conditions were: mobile phase A: 1.5 M ammonium sulfate, 50 mM dipotassium phosphate (pH 7); mobile phase B: 10% isopropanol, 50 mM dipotassium phosphate (pH 7). Samples were eluted at a flow rate of 0.8 mL / min and a column temperature of 30°C. Components with different DARs were separated using a salt gradient and detected by UV absorption at 280 nm. The average DAR and distribution profile were calculated based on the peak area percentage of each component.

[0035] like Figure 1 As shown in the HIC-HPLC spectrum, the peaks correspond to naked antibody, DAR2, DAR4, and DAR6 in order, among which naked antibody, DAR2, DAR4, and DAR6 account for 3%, 11.6%, 62.2%, and 23.2%, respectively, and the average DAR value is 4.1; Figure 2 As can be seen in the figure, the multimer (HMW) corresponds to the peak at 8.672 min in the spectrum, accounting for 0.4209% of the total area, and the main peak accounts for 99.5791%, which meets the quality standards.

[0036] Example 3 Analysis of PVR expression characteristics 3.1 Tumor samples from 347 bladder cancer patients were collected, fixed in formalin, and embedded in paraffin to prepare FFPE samples for analysis. The specific steps are as follows: Dewax the paraffin sections to water: sequentially place the sections in xylene I for 15 min, xylene II for 15 min, xylene III for 15 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 85% alcohol for 5 min, 75% alcohol for 5 min, and then wash with distilled water; Antigen retrieval: Place the tissue sections in a microwave oven filled with antigen retrieval buffer in a microwave oven over medium heat for 8 minutes until boiling, then reduce heat to keep warm for 8 minutes and then reduce heat to medium-low for 7 minutes. During this process, prevent excessive evaporation of the buffer and do not allow the slides to dry out. After cooling naturally, wash the slides three times in PBS (pH 7.4) on a decolorizing shaker for 5 minutes each time. Incubate at 37°C for 30 minutes. Block endogenous peroxidase: Place the sections in 3% hydrogen peroxide solution and incubate at room temperature in the dark for 25 minutes. Place the slides in PBS (pH 7.4) and wash them three times on a decolorizing shaker for 5 minutes each time.

[0037] Circle serum blocking: After the slices are slightly dried, use a histochemical pen to draw a circle around the tissue (to prevent the antibody from flowing away), add 3% BSA in the circle to evenly cover the tissue, and block at room temperature for 30 minutes; Add primary antibodies: Gently shake off the blocking solution and add primary antibodies anti-PVR (Abcam, ab267788), anti-nectin4 (ab317268), anti-HER2 (ab134182), and anti-trop2 (ab214488) prepared in PBS at a ratio of 1:500 to the sections. Place the sections flat in a humidified chamber and incubate overnight at 4°C. Add secondary antibody: Wash slides three times in PBS (pH 7.4) on a decolorizing shaker for 5 minutes each. After drying the sections slightly, add a secondary antibody (HRP-labeled) of the same species as the primary antibody to the circle, covering the tissue and incubating at room temperature for 50 minutes. DAB staining: Wash slides three times in PBS (pH 7.4) on a decolorizing shaker for 5 minutes each time. After the sections are slightly dried, add freshly prepared DAB staining solution to the circle. Monitor the color development time under a microscope. A positive color will appear brownish-yellow. Rinse the sections with tap water to terminate the color development. Counterstaining of cell nuclei: counterstain with hematoxylin for about 3 minutes, wash with tap water, differentiate with hematoxylin differentiation solution for a few seconds, and rinse with tap water to return to blue; Dehydration and sealing: Dehydrate the sections in 75% alcohol for 5 minutes, 85% alcohol for 5 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and xylene I for 5 minutes to make them transparent. Take the sections out of the xylene and let them dry slightly, then seal them with neutral gum. Microscopic examination and image acquisition and analysis were performed. The urothelial region was the only area for image acquisition and evaluation; the interstitial region was not evaluated. Hematoxylin stains nuclei blue, while DAB stains positive nuclei brownish-yellow. Evaluation criteria were negative, weakly positive, positive, and strongly positive.

[0038] Figure 3 As shown in A, PVR is mainly expressed in the epithelial tissue layer of the bladder and is highly expressed in bladder cancer. The higher the malignancy, the higher the expression of PVR. Figure 3 As shown in Figure B, the positive expression rate of PVR in bladder cancer is 86%, and the high expression rate is 54%. The expression pattern of PVR is comparable to the drug targets of other marketed antibody-drug conjugates (HER2, TROP2, Nectin4, EGFR), indicating that PVR is a drug target with druggable potential for bladder cancer.

[0039] 3.2 Screening and detection of PVR-positive cells by flow cytometry 105 RT4 cells or isolated tumor cells were resuspended in 200 μL of HBSS containing 2% FBS and stained with anti-PVR antibody (#ab267788, Abcam). Single cells were gated by plotting SSC-A versus FSC-A. Live cells were identified by negative staining with 7-aminoactinomycin D (A9400, Sigma-Aldrich). Subsequently, PVR+ and PVR- populations were detected and sorted using a FACSArilaIII flow cytometry system (BD Biosciences, USA) and collected in cold PBS in 5 mL polypropylene tubes. Flow cytometry data were processed using FlowJo software (version 10.7.1). The sorted PVR+ cell populations were cultured in 6-well plates on Corning low-adhesion surfaces, and images of tumor spheres were taken 10 days later. Figure 4 .

[0040] Figure 4 It can be seen that a single PVR-positive cell can form a tumor, indicating that it has a strong tumorigenic ability and is suitable as an anti-tumor target.

[0041] Example 4 Investigating the Cytotoxic Activity of NTX-1088-MMAE Against Tumor Cells with Different PVR Expressions Bladder cancer cells (T24, J82, SV-HUC-1, HT-1376, HT-1197, 5637, 5637, SW-780, ScaBER, RT4, UMUC3) were selected to evaluate the in vitro cell killing activity of the antibody-drug conjugate NTX-1088-MMAE.

[0042] Antigen-antibody binding experiment of NTX-1088-MMAE and bladder cancer cells: Bladder cancer cells (5637, SW780, T24, J82, HT-1197, HT-1376, TCCSUP, ScaBER) were digested, resuspended, centrifuged at 300g for 5 minutes, resuspended in culture medium, counted by AOPI, and the cell density was adjusted to 2E+6 / mL; the ADC drug was diluted according to 8 concentration gradients and incubated at 4°C for 1 hour; 200μL FACS buffer was added to each well and washed twice, 50μL secondary antibody dilution was added to each well (dilution ratio 1:100), and incubated at 4°C for 30 minutes; 200μL FACS buffer was added to each well and washed three times, resuspended in 200μL FACS buffer, and loaded onto Beckman CytoFLEX for detection using the FITC channel. Figure 5 It can be seen that multiple bladder cancer cell lines (5637, SW780, T24, J82, HT-1197, HT-1376, TCCSUP, ScaBER) can bind to the PVR-MMAE antibody-drug conjugate, among which the binding ability to SW780 is the highest.

[0043] Experimental study on the killing activity of NTX-1088-MMAE against bladder cancer cells: Normal bladder urothelial cells (SV-HUC-1), bladder cancer cells with high PVR expression (SW780), bladder cancer cells with high PVR expression (5637), and bladder cancer cells with high PVR expression (T24) were tested using the Cell Titer-Glo detection kit combined with the Tecan Spark multi-function microplate reader for chemiluminescence detection. Figure 6 It can be seen that compared with the use of small molecule cytotoxic drugs (isotype-MMAE) alone and monoclonal antibodies (PVR-Ab) alone, the antibody-drug conjugate PVR-MMAE can significantly kill bladder cancer cells with high PVR expression, while its killing ability against normal bladder epithelial cells and bladder cancer cells with low PVR expression is weak.

[0044] Example 5 Investigation of the Antitumor Efficacy of NTX-1088-MMAE BBN-induced mouse bladder cancer model: 50 C57 / BL male mice aged 2-3 weeks were purchased and fed with drinking water containing 0.1% BBN. ​​After 20 weeks, the tumor formation of the mice was detected by B-ultrasound, and the tumor formation rate was about 64%. The 32 mice with successful tumor formation were randomly divided into 4 groups, with 8 mice in each group. The interventions were carried out in the following ways: (1) Control blank control group: intravenous injection of normal saline; (2) Isotype-MMAE negative control group, intravenous injection (2 mg / kg); (3) PVR-MMAE treatment group, intravenous injection (2 mg / kg); (4) RC48 positive control group: intravenous injection (5 mg / kg). After treatment twice a week for 4 weeks, bladder tumors were detected by B-ultrasound, and the test results were as follows: Figure 7 shown.

[0045] Figure 7 It can be seen that compared with the use of small molecule cytotoxic drugs (isotype-MMAE) alone and monoclonal antibodies (PVR-Ab) alone, the antibody-drug conjugate PVR-MMAE has a significant therapeutic effect on BBN-induced bladder cancer, and compared with the antibody-drug conjugate HER2-MMAE that has been on the market, PVR-MMAE also has a better anti-tumor effect.

[0046] The PVR monoclonal antibody was conjugated to three different small molecule toxins: MMAE (tubulin inhibitor), SN-38 (topoisomerase inhibitor), and DM1 (tubulin inhibitor). The inhibitory effects of the ADC drugs conjugated to the three different small molecule toxins on cells were tested in five bladder cancer cell lines (5637, SW780, T24, J82, HT-1197) and one lung cancer cell line (A549) that were positive for PVR expression. The drug concentration was 10ug / mL. The test results are as follows: Figure 8 shown.

[0047] Figure 8 It can be seen that MMAE drugs have the best inhibitory effect on 5 types of bladder cancer cells, and the effect is stable in different cell lines.

[0048] Example 6 Investigation of the endocytic ability of NTX-1088-MMAE Before antibody conjugates can exert their activity in tumor cells, they must first be internalized by the cells. Therefore, for antibody-drug conjugates, endocytosis ability is particularly important.

[0049] Determine the cellular internalization of ADC drugs by immunofluorescence. Take 10μg PVR-MMAE and ISO-MMAE, dilute them to 1mg / ml with DPBS, then add 1μL 1M sodium bicarbonate solution and mix well; add 0.33μL 2 mM pHrodo™ iFL labeling reaction solution to the antibody solution and mix well; incubate the reaction mixture at room temperature in the dark for 15 minutes. Take cells in the logarithmic growth phase and adjust the concentration to 5E5 / mL; add the diluted PVR-MMAE and ISO-MMAE to the corresponding wells and incubate for 30 minutes, then replace with complete culture medium; place the incubated 96-well plate in the IncucyteS3 live cell imaging instrument and scan the plate (bright field and red fluorescence) every 1 hour for 24 hours. Then, analyze the cell bright field area and red fluorescence area or overall red fluorescence intensity using the IncucyteS3 instrument. The test results are as follows: Figure 9 shown.

[0050] from Figure 9 As can be seen in the figure, ISO-MMAE has a weak ability to be internalized by bladder cancer cell lines (5637, SW780), while the internalization ability of NTX-1088-MMAE is greatly improved compared with ISO-MMAE. It can be seen that bladder cancer cells have a good internalization effect on PVR-MMAE drugs.

[0051] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make various similar expressions without violating the purpose and claims of the present invention. Such changes fall within the scope of protection of the present invention.

[0052] SEQ ID NO. 1 ATGGCCCGAGCCATGGCCGCCGCGTGGCCGCTGCTGCTGGTGGCGCTACTGG

Claims

1. An ADC drug targeting PVR, a pharmaceutically acceptable salt, solvate or solvate of the salt thereof, characterized in that: The ADC drug is obtained by coupling the NTX-1088 antibody and the dolastatin derivative MMAE; The DAR value of the ADC drug is 3-5.

2. The ADC drug according to claim 1, its pharmaceutically acceptable salt, solvate or solvate of the salt, wherein: The light chain amino acid sequence of the antibody NTX-1088 is shown in SEQ ID NO. 2, and the heavy chain amino acid sequence is shown in SEQ ID NO.

3.

3. Use of the ADC drug according to claim 1 or 2, or a pharmaceutically acceptable salt, solvate or solvate of the salt thereof, in the preparation of a drug for preventing and / or treating antitumor.

4. The use according to claim 3, characterized in that The tumor is a PVR-positive solid tumor, including esophageal cancer, squamous cell carcinoma, lung cancer, breast cancer, pancreatic cancer, head and neck cancer, colon cancer, prostate cancer, osteosarcoma cancer, and bladder cancer.

5. A pharmaceutical composition for tumor targeted therapy, comprising the ADC drug according to claim 1 or 2, a pharmaceutically acceptable salt, solvate or solvate of the salt thereof, and a pharmaceutically acceptable excipient.

6. The pharmaceutical composition according to claim 5, characterized in that The auxiliary materials include one or more of solvents, disintegrants, flavoring agents, preservatives, colorants, binders, lubricants, diluents and drug carriers.

7. The pharmaceutical composition according to claim 5 or 6, characterized in that The ADC drug is prepared by the following method: S1. Add TCEP to the NTX-1088 antibody solution at pH 5-7, 35-40°C, and stir for 1-2 hours. S2. The reduced antibody is reacted with an MMAE solution to obtain a crude drug; S3. Purify the crude drug to obtain the antibody-drug conjugate.

8. The ADC drug according to claim 7, characterized in that In S1, the molar ratio of the reducing agent to the antibody is 2- based on the molar amount of the antibody during mixing.

9. The method according to claim 1, characterized in that In said S2, the concentration of said MMAE solution is 1-20 g / L, or 3-15 g / L, or 5-10 g / L; and / or, In S2, the reaction temperature is 20-30°C; and / or, In S2, the stirring reaction time is 1-2 hours.

10. The method according to claim 1, characterized in that In S3, the purification specifically comprises: using ceramic hydroxyapatite resin as the stationary phase for adsorption, using a mobile phase for gradient elution, and collecting the desired antibody-drug conjugate component peak; In S3, the particle size of the ceramic hydroxyapatite resin is 40 mesh; And / or, in S3, when gradient elution is performed using a mobile phase, when mobile phase A has a pH of 7 and a concentration of 5 mM sodium phosphate, and mobile phase B has a pH of 7 and a concentration of 200 mM sodium phosphate, the volume ratio of mobile phase A to mobile phase B is (9:1) to (7:3).

Citation Information

Patent Citations

  • Antibodies against poliovirus receptor (PVR) and uses thereof

    CN114502595A

  • Antibodies against the poliovirus receptor (PVR) and uses thereof

    WO2021070181A1