Coriolus versicolor, microbial inoculum containing Coriolus versicolor, and culture method and application of microbial inoculum

Abstract

The invention relates to a microbial fermentation technology, and discloses coriolus versicolor, a microbial agent containing the coriolus versicolor, and a culture method and application of the coriolus versicolor. The preservation number of the trametes versicolor is CCTCC (China Center for Type Culture Collection) NO: M2025762, and the preservation number of the trametes versicolor is CCTCC NO: M2025762. The invention provides application of the coriolus versicolor in fermentation production of active ingredients and / or preparation of functional products, and the active ingredients comprise flavonoid compounds and / or terpenoids. The coriolus versicolor is stable in fermentation performance, low in cost, high in biomass and hypha content and rich in various flavonoid and terpene active ingredients.

Description

Technical Field

[0001] The present invention relates to microbial fermentation technology, in particular to a versicolor fungus, a bacterial agent containing the fungus, and a cultivation method and application thereof. Background Art

[0002] Versicolor versicolor ( Trametes versicolor ) belongs to the phylum Basidiomycota, class Agaricomycetes, orders Polyporales, family Polyporaceae. Its mycelium and fruiting bodies are rich in active ingredients such as polysaccharides, flavonoids, triterpenoids, and laccases. It has anti-tumor, immunomodulatory, and antioxidant properties, and is widely used in medicine, food, and cosmetics. Currently, over-exploitation of wild Yunzhi resources has led to severe degradation of its natural habitat. In addition, traditional solid cultivation has a long cycle (3-6 months) and low fruiting body yield (<5g / kg substrate), making it difficult to meet the needs of industrial production. There is an urgent need to achieve sustainable resource utilization through artificial cultivation technology.

[0003] Although submerged fermentation technology can shorten the culture cycle of Coriolus versicolor, the biomass of existing strains of Coriolus versicolor during fermentation is generally less than 20g / L, and the content of active ingredients such as flavonoids and triterpenoids is extremely low, often failing to achieve the same efficacy as wild Coriolus versicolor. Furthermore, traditional Coriolus versicolor culture media rely on high-cost raw materials such as glucose and yeast extract, which restricts its large-scale production. The parameters of the submerged fermentation process (such as dissolved oxygen content and agitation rate) lack systematic optimization, resulting in low efficiency and high volatility in the synthesis of active ingredients (fluctuation rate of approximately ±15%), making it difficult to provide a stable supply of high-purity product.

[0004] Therefore, developing new strains of Coriolus versicolor that are suitable for low-cost, high-stability fermentation processes and have high content of active ingredients and low volatility is of great value in promoting the application of Coriolus versicolor in the fields of functional foods and medicines. Summary of the Invention

[0005] The purpose of the present invention is to overcome the problems of low fermentation biomass, low active ingredient content, high fermentation process cost and poor stability of Coriolus versicolor in the prior art, and to provide Coriolus versicolor, a bacterial agent containing the fungus, and a cultivation method and application thereof. The Coriolus versicolor has stable fermentation performance, low cost, high biomass and mycelium content, and is rich in various flavonoid and terpenoid active ingredients.

[0006] In order to achieve the above object, the present invention provides a first aspect of a versicolor fungus, the versicolor fungus ( Trametes versicolor ) is deposited in the form of CCTCC NO: M2025762.

[0007] A second aspect of the present invention provides a bacterial agent, which contains the above-mentioned Versicolor versicolor.

[0008] Preferably, the bacterial agent contains at least one of living cells, dead cells and fermentation products of the versicolor fungus.

[0009] Preferably, the bacterial agent is a liquid bacterial agent or a solid bacterial agent.

[0010] A third aspect of the present invention provides a method for culturing Coriolus versicolor, comprising the following steps: sequentially subjecting the Coriolus versicolor or the bacterial agent as described above to seed culture and fermentation culture.

[0011] Preferably, the seed culture medium used in the seed culture contains corn meal, peanut meal, potassium dihydrogen phosphate, magnesium sulfate and trace element solution.

[0012] Preferably, the trace element solution in the seed culture medium contains: 0.05-0.1 g / L of iron sulfate heptahydrate, 0.02-0.05 g / L of zinc sulfate heptahydrate, and 0.02-0.05 g / L of copper sulfate pentahydrate.

[0013] Preferably, the seed culture medium contains: 30-50 g / L corn meal, 25-30 g / L peanut meal, 1.2-2 g / L potassium dihydrogen phosphate, 1.5-2.5 g / L magnesium sulfate heptahydrate and 0.5-1.5 mL / L trace element solution.

[0014] Preferably, the fermentation culture medium used in the fermentation culture contains corn cake powder, peanut cake powder, yeast extract, corn steep liquor powder, potassium dihydrogen phosphate, magnesium sulfate and trace element solution.

[0015] Preferably, the trace element solution in the fermentation medium contains: 0.05-0.1 g / L of ferric sulfate heptahydrate, 0.02-0.05 g / L of zinc sulfate heptahydrate, and 0.02-0.05 g / L of copper sulfate pentahydrate.

[0016] Preferably, the fermentation medium contains: 30-50 g / L corn meal, 15-25 g / L peanut meal, 3-8 g / L yeast extract, 2-5 g / L corn steep liquor powder, 1-2 g / L potassium dihydrogen phosphate, 0.3-0.5 g / L magnesium sulfate heptahydrate and 0.5-1.5 mL / L trace element solution.

[0017] Preferably, the seed culture includes primary seed culture and secondary seed culture performed sequentially.

[0018] Preferably, the conditions for the primary seed culture include: an inoculum size of 1×10 5 -1×10 6CFU / mL, initial pH 5.5-6.5, temperature 25-30℃, rotation speed 150-250rpm, time 3-5 days.

[0019] Preferably, the conditions of the secondary seed culture include: inoculation amount 1×10 7 -5×10 7 CFU / mL, initial pH 5.5-6.5, temperature 25-30℃, rotation speed 150-250rpm, time 6-8 days.

[0020] Preferably, the conditions of the fermentation culture include: inoculation amount 10-20% of volume, temperature 25-30℃, pH 5.5-6.5, dissolved oxygen less than 20%, time 5-7 days.

[0021] The fourth aspect of the present application provides the use of the Trametes versicolor, the microbial agent or the method as described above in the fermentation production of active ingredients and / or the preparation of functional products, wherein the active ingredients include flavonoids and / or terpenoids.

[0022] Preferably, the flavonoids are selected from at least one of gallic acid, ginkgo biloba, 2'-hydroxychalcone and protocatechuic acid, preferably gallic acid and ginkgo biloba; and the terpenoids are myrcene.

[0023] Preferably, the functional products are anti-tumor drugs and / or immunomodulatory drugs.

[0024] Through the above technical solutions, the present application has the following beneficial effects: the Trametes versicolor provided by the present application has stable fermentation culture performance, high biomass and mycelium content, and high synthesis efficiency and small fluctuation of active ingredients, and the Trametes versicolor obtained by culture is rich in various flavonoids and terpenoids, especially gallic acid, ginkgo biloba and myrcene, and has higher medicinal value. At the same time, the Trametes versicolor uses low-cost corn cake powder and peanut cake powder as the main carbon and nitrogen source, and has low fermentation production cost and short production cycle, which is suitable for large-scale production of functional food and drug raw materials.

[0025] Biological preservation The Trametes versicolor HW-119 provided by the present application (HW-119) was preserved in the China Center for Type Culture Collection (CCTCC) on April 11, 2025 (address: Wuhan University, Wuchang District, Wuhan City, Hubei Province, China, postal code: 430072, abbreviation of the preservation unit: CCTCC), and the preservation number is CCTCC NO: M2025762. Trametes versicolor HW-119), was preserved in the China Center for Type Culture Collection (CCTCC) on April 11, 2025 (address: Wuhan University, Wuchang District, Wuhan City, Hubei Province, China, postal code: 430072, abbreviation of the preservation unit: CCTCC), and the preservation number is CCTCC NO: M2025762. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 is a colony morphology diagram of the Trametes versicolor in Example 1; Figure 2 This is a diagram of the bacterial state of the versicolor fungus in Example 1; Figure 3 This is the NCBI sequence comparison diagram of the versicolor fungus in Example 1; Figure 4 This is a phylogenetic analysis diagram of the versicolor fungus in Example 1; Figure 5 is a graph showing the content of flavonoids in the versicolor obtained by fermentation in Example 2; Figure 6 is a graph showing the content of terpenoid compounds in the versicolor obtained by fermentation in Example 2; Figure 7 Graph showing the active ingredient content of Example 3 and Comparative Example 1 repeated 10 times. DETAILED DESCRIPTION

[0027] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0028] The first aspect of the present invention provides a versicolor fungus, wherein the versicolor fungus ( Trametes versicolor ) is Yunzhi HW-119 ( Trametes versicolor HW-119), the deposit number is CCTCC NO: M2025762.

[0029] The versicolor fungus provided by the invention has a white colony, covers the entire plate, has a flat surface, a filamentous texture, a light yellow reverse side, produces no exudate, and produces no soluble pigment; the hyphae are entangled and branched, separated, have smooth walls, are 1.5-6 μm in diameter, and produce a large number of lock-shaped unions.

[0030] A second aspect of the present invention provides a bacterial agent, which contains the above-mentioned Versicolor versicolor.

[0031] In the present invention, there is no particular limitation on the concentration of Coriolus versicolor in the bacterial agent, and the concentration can be selected according to specific circumstances.

[0032] According to the present invention, the bacterial agent preferably contains at least one of live, dead, and fermentation products of the fungus, more preferably live fungus. In the present invention, the term "fermentation product" refers to metabolites produced by the fungus during fermentation or cultivation (e.g., products containing flavonoids and / or terpenoids isolated from the mycelium and / or fruiting bodies of the fungus).

[0033] According to the present invention, there are no particular limitations on the formulation of the bacterial agent. Depending on the intended use, the agent can be prepared into different formulations and contain corresponding excipients and other ingredients. For example, the agent can be a liquid agent (e.g., a bacterial liquid of Coriolus versicolor) and / or a solid agent (e.g., a powder prepared by drying Coriolus versicolor or a high-purity preparation prepared through separation and purification steps). The addition of specific excipients to specific formulations is well known to those skilled in the art and will not be detailed here.

[0034] A third aspect of the present invention provides a method for culturing Coriolus versicolor, comprising the following steps: sequentially subjecting the Coriolus versicolor or the bacterial agent as described above to seed culture and fermentation culture.

[0035] In the present invention, there is no particular limitation on the seed culture and fermentation culture methods, as long as a large amount of viable cells of Versicolor versicolor and / or fermentation products can be produced through the seed culture and fermentation culture.

[0036] According to the present invention, the seed culture medium preferably contains corn starch, peanut meal, potassium dihydrogen phosphate, magnesium sulfate, and a trace element solution. The versicolor fungus provided by the present invention can effectively use corn starch and peanut meal as carbon and nitrogen sources, promote the growth of the fungus, and improve the synthesis efficiency of biomass and active substances, while reducing production costs.

[0037] In the present invention, the trace elements include iron, zinc and copper. Preferably, the trace element solution in the seed culture medium contains: 0.05-0.1 g / L of iron sulfate heptahydrate, 0.02-0.05 g / L of zinc sulfate heptahydrate, and 0.02-0.05 g / L of copper sulfate pentahydrate.

[0038] More preferably, the seed culture medium contains: 30-50 g / L corn meal, 25-30 g / L peanut meal, 1.2-2 g / L potassium dihydrogen phosphate, 1.5-2.5 g / L magnesium sulfate heptahydrate, and 0.5-1.5 mL / L trace element solution. This preferred embodiment can further enhance the viability of the versicolor fungus, thereby increasing the biomass and active substance synthesis efficiency during the fermentation stage.

[0039] According to the present invention, preferably, the fermentation culture medium used in the fermentation culture contains corn starch, peanut powder, yeast extract, corn steep liquor powder, potassium dihydrogen phosphate, magnesium sulfate and trace element solution. The versicolor fungus provided by the present invention can effectively use corn starch and peanut powder as the main carbon and nitrogen sources, avoid the use of high-cost raw materials such as large amounts of glucose and yeast extract, and reduce production costs. Moreover, under the fermentation culture medium formula, the versicolor fungus has a fast growth rate, high biomass, and high efficiency in synthesizing active substances.

[0040] In the present invention, the trace elements include iron, zinc and copper. Preferably, the trace element solution in the fermentation medium contains: 0.05-0.1 g / L of ferric sulfate heptahydrate, 0.02-0.05 g / L of zinc sulfate heptahydrate, and 0.02-0.05 g / L of copper sulfate pentahydrate.

[0041] More preferably, the fermentation medium contains: 30-50 g / L corn meal, 15-25 g / L peanut meal, 3-8 g / L yeast extract, 2-5 g / L corn steep liquor, 1-2 g / L potassium dihydrogen phosphate, 0.3-0.5 g / L magnesium sulfate heptahydrate, and 0.5-1.5 mL / L trace element solution. This preferred embodiment can better promote the growth of Coriolus versicolor and increase the efficiency of biomass and active substance synthesis.

[0042] In the present invention, the Versicolor fungus is generally frozen, and when culture is required, it is preferably activated before the seed culture. For example, after the frozen Versicolor fungus is taken out, it is streaked and inoculated onto a plate of solid activation culture medium for activation culture; preferably, the solid activation culture medium adopts PDA culture medium, and the conditions for activation culture include: temperature of 25-30°C, time of 3-5 days. After the activation culture, the Versicolor fungus on the plate is inoculated for the seed culture. Under this preferred embodiment, the activity of Versicolor fungus can be better improved, thereby improving the biomass and the synthesis efficiency of active substances in the fermentation culture stage.

[0043] According to the present invention, preferably, the seed culture comprises a primary seed culture and a secondary seed culture performed sequentially. The two-stage seed culture can effectively improve the fermentation performance of the versicolor fungus, promote the growth rate of the versicolor fungus during the fermentation culture stage, increase the biomass and mycelium content, and increase the synthesis efficiency of active substances.

[0044] According to the present invention, preferably, the conditions for the primary seed culture include: an inoculum size of 1×10 5 -1×10 6 CFU / mL, initial pH 5.5-6.5, temperature 25-30°C, rotation speed 150-250 rpm, time 3-5 days. Further preferably, the conditions for the secondary seed culture include: inoculation size 1×10 7 -5×10 7 CFU / mL, initial pH 5.5-6.5, temperature 25-30°C, rotation speed 150-250 rpm, time 6-8 days. Under this preferred embodiment, the activity of Versicolor versicolor can be better improved, thereby improving the biomass and active substance synthesis efficiency during the fermentation culture stage.

[0045] The initial pH of the primary seed culture and the secondary seed culture is adjusted to the desired pH by adding hydrochloric acid or sodium hydroxide solution.

[0046] According to the present invention, preferably, the fermentation conditions include: an inoculum size of 10-20% by volume, a temperature of 25-30°C, a pH of 5.5-6.5, a dissolved oxygen content of less than 20%, and a duration of 5-7 days. In this preferred embodiment, optimizing dissolved oxygen control in conjunction with the composition of the fermentation medium can further increase the biomass and active ingredient yield of Coriolus versicolor.

[0047] In this application, "dissolved oxygen below 20%" means the dissolved oxygen concentration (DO) in the fermentation broth is less than 20% of the saturated DO concentration, where the saturated value is 100% when air is aerated through pure water at 25°C and 101.3 kPa. Conventional methods in the art can be used to control the DO below 20% during fermentation. For example, the DO is controlled by maintaining the agitation rate of the stirred fermenter at 200-300 rpm and the aeration rate at 1-2 vvm to maintain the DO below 20%. The pH of the fermentation broth is maintained at 5.5-6.5 by adding hydrochloric acid or sodium hydroxide solution.

[0048] As a relatively preferred embodiment of the method for culturing the versicolor fungus of the present invention, the method comprises: (1) Inoculate the frozen versicolor fungus onto a PDA culture medium plate and culture at a temperature of 25-30°C for 3-5 days; (2) The versicolor fungus on the PDA culture medium plate was inoculated with 1×10 5 -1×10 6 CFU / mL was inoculated into the seed culture medium, and cultured with shaking at an initial pH of 5.5-6.5, a temperature of 25-30°C, and a rotation speed of 150-250 rpm for 3-5 days to obtain the first-level seed solution; (3) The first-level seed liquid was inoculated with an inoculum of 1×10 7 -5×10 7 CFU / mL was transferred to seed culture medium and cultured with shaking at an initial pH of 5.5-6.5, a temperature of 25-30°C, and a rotation speed of 150-250 rpm for 6-8 days to obtain a secondary seed solution; (4) inoculating the secondary seed solution into the fermentation medium at an inoculum amount of 10-20% by volume, and culturing for 5-7 days at a temperature of 25-30° C., a pH of 5.5-6.5, and controlling the dissolved oxygen value to be less than 20%; The seed culture medium contains: corn cake powder 30-50 g / L, peanut cake powder 25-30 g / L, potassium dihydrogen phosphate 1.2-2 g / L, magnesium sulfate heptahydrate 1.5-2.5 g / L, and trace element solution 0.5-1.5 mL / L; the fermentation culture medium contains: corn cake powder 30-50 g / L, peanut cake powder 15-25 g / L, yeast extract 3-8 g / L, corn syrup dry powder 2-5 g / L, potassium dihydrogen phosphate 1-2 g / L, magnesium sulfate heptahydrate 0.3-0.5 g / L, and trace element solution 0.5-1.5 mL / L. The trace element solution contains: iron sulfate heptahydrate 0.05-0.1 g / L, zinc sulfate heptahydrate 0.02-0.05 g / L, and copper sulfate pentahydrate 0.02-0.05 g / L.

[0049] Based on the culture method provided above, the Coriolus versicolor can better use the liquid deep fermentation culture scheme compared to the existing strains, has better fermentation performance, higher biomass and mycelium content, and higher yields of flavonoids and terpenoids.

[0050] The fourth aspect of the present application provides the use of the Coriolus versicolor as described above, the microbial agent as described above, or the method as described above in fermentation production of active ingredients and / or preparation of functional products, wherein the active ingredients include flavonoids and / or terpenoids.

[0051] According to the present application, the total flavonoid content and the total terpenoid content of the Coriolus versicolor are increased after fermentation. Preferably, the flavonoids are at least one selected from gallic acid, ginkgetin, 2'-hydroxychalcone, and protocatechuic acid, preferably gallic acid and ginkgetin; and the terpenoids are myrcene.

[0052] According to the present application, preferably, the functional products are anti-tumor drugs and / or immunomodulatory drugs. The mycelium and / or fruiting body of the Coriolus versicolor can be directly used for preparing the functional products, or the part of the Coriolus versicolor containing the required active ingredients (for example, gallic acid, ginkgetin, or myrcene, etc.) extracted or separated therefrom can be used for preparing the functional products.

[0053] The present application will be described in detail below through examples.

[0054] In the following examples, the preparation process of the PDA culture medium is as follows: 200 g of potatoes is weighed and cut into small pieces, and then boiled until it is mashed (boiled for 25 min, which can be poked by a glass rod), filtered with eight layers of gauze, heated, and then 15 g of agar is added, and heated and stirred to mix uniformly, after the agar is dissolved, 20 g of glucose is added, stirred uniformly, slightly cooled, and then water is added to make up to 1000 mL, and sterilized at 115℃ for 20 min; The raw materials or reagents used are commercially available unless otherwise specified.

[0055] Example 1 1.1 The present application provides a Trametes versicolor (L. Trametes versicolor ) obtaining process The natural decaying deadwood was collected from the virgin forest system area of Changbai Mountain in Jilin City, Jilin Province. The internal tissue block of the deadwood was taken under sterile conditions, and after surface disinfection, it was placed in PDA medium for culture, and pure culture strain HW-119 was obtained by repeated picking of mycelium tips.

[0056] 1.2 Physiological characteristics and molecular biology identification of the strain The colony of strain HW-119 obtained in 1.1 on PDA plate is shown in Figure 1 , the colony is white, covers the whole plate, the surface is flat, the texture is filamentous, the reverse is light yellow, no exudate is produced, no soluble pigment is produced. The mycelium of strain HW-119 is observed under microscope as shown in Figure 2 , the mycelium is intertwined and branched, the septum is smooth, the diameter is 1.5-6 μm, and a large number of lock-like unions are produced.

[0057] The DNA of strain HW-119 was extracted by using kit (TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0), ITS1+ITS4 was used as amplification primer for PCR amplification, the PCR amplification product was detected by electrophoresis, and the sequencing was entrusted to Kecheng (Nanjing) Biological Company, the ITS sequence is shown as SEQ ID NO. 1. The obtained ITS sequence was subjected to BLAST analysis with the existing sequences in NCBI database, and the strains with similar homology were selected, and the phylogenetic tree was constructed by using MEGA 7.0 software.

[0058] ITS sequence (SEQ ID NO. 1): CTGCGGAAGGATCATTAACGAGTTTTGAAACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTAGCGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTATAAATCCTTGTGATCTATAAGCTTGGACTTGGAGGCTTGCTGGCCCTTGTTGGTCGGCTCCTCTTGAATGCATTAGCTCGATTCCGTACGGATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGTGTTTTGGCGAGCTTCTAACCGTCCATTAGGACAACTTTTTAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT.

[0059] The ITS sequence alignment result on the NCBI database shows that the strain HW-119 is highly similar to the ITS sequence of Trametes versicolor (also known as Inonotus versicolor, Trametes versicolor ), and is relatively close in evolutionary distance. The NCBI sequence comparison diagram of the isolated strain is shown in Figure 3 , the phylogenetic tree is shown in Figure 4 , and the strain is preliminarily identified as Trametes versicolor Trametes versicolor ) in combination with the physiological and biochemical characteristics of the strain.

[0060] The domestication culture process of the strain HW-119: inoculate the strain HW-119 into the domestication culture medium for 10-15 times of subculture, wherein the formula of the domestication culture medium is: glucose 20 g / L, corn flour 10 g / L, bran 5 g / L, peptone 3 g / L, potassium dihydrogen phosphate 1.5 g / L, magnesium sulfate 0.2 g / L, zinc sulfate 0.05 g / L; the subculture conditions are that the temperature is 26°C, the shaking table rotation speed is 120 rpm, and the time of each subculture is 6 days.

[0061] After the strain HW-119 was acclimated and cultured as described above, the strain HW-119 ( Trametes versicolor HW-119) was classified and named, and was deposited in the China Center for Type Culture Collection (Address: Room 211, China Center for Type Culture Collection, Wuhan University, Wuchang District, Wuhan City, Hubei Province, Postal Code: 430072, the abbreviation of the depository is CCTCC) on April 11, 2025, with the deposit number CCTCC NO: M2025762; and will be used for subsequent experimental research.

[0062] Example 2 The formula of the trace element solution is: 0.08 g / L iron sulfate heptahydrate, 0.03 g / L zinc sulfate heptahydrate, 0.03 g / L copper sulfate pentahydrate; The formula of seed culture medium is: corn meal 40g / L, peanut meal 28g / L, potassium dihydrogen phosphate 1.5g / L, magnesium sulfate heptahydrate 2g / L and trace element solution 1mL / L; The fermentation medium formula is: corn meal 40g / L, peanut meal 20g / L, yeast extract 5g / L, corn steep liquor 3g / L, potassium dihydrogen phosphate 1.5g / L, magnesium sulfate heptahydrate 0.4g / L and trace element solution 1mL / L; (1) The frozen strain HW-119 obtained in Example 1 was inoculated onto a PDA medium plate and cultured at 26°C for 4 days; (2) The versicolor fungus on the PDA culture medium plate was inoculated with 5×10 5 CFU / mL was inoculated into the seed culture medium and cultured with shaking at an initial pH of 6, a temperature of 26°C, and a rotation speed of 200 rpm for 3-5 days to obtain the first-level seed solution; (3) The first-level seed liquid was inoculated with 3×10 7 CFU / mL was transferred to seed culture medium and cultured with shaking at an initial pH of 6, a temperature of 26°C, and a rotation speed of 200 rpm for 6-8 days to obtain a secondary seed solution; (4) The secondary seed liquid was inoculated into the fermentation medium at an inoculum rate of 15% (v / v) and cultured for 6 days at a temperature of 26°C, a pH of 6, and a dissolved oxygen value of approximately 18% (controlled by a stirring rate of 250 rpm and a ventilation volume of 1.5 vvm).

[0063] Example 3 The formula of the trace element solution is: 0.1 g / L iron sulfate heptahydrate, 0.02 g / L zinc sulfate heptahydrate, 0.02 g / L copper sulfate pentahydrate; The formula of seed culture medium is: corn meal 30g / L, peanut meal 30g / L, potassium dihydrogen phosphate 2g / L, magnesium sulfate heptahydrate 2.5g / L and trace element solution 1mL / L; The fermentation medium formula is: corn meal 30g / L, peanut meal 25g / L, yeast extract 8g / L, corn steep liquor 5g / L, potassium dihydrogen phosphate 2g / L, magnesium sulfate heptahydrate 1.5g / L and trace element solution 1mL / L; (1) The frozen strain HW-119 obtained in Example 1 was inoculated onto a PDA medium plate and cultured at 25°C for 5 days; (2) The versicolor fungus on the PDA culture medium plate was inoculated with 1×10 5 CFU / mL was inoculated into the seed culture medium and cultured with shaking at an initial pH of 5.5, a temperature of 25°C, and a rotation speed of 250 rpm for 3 days to obtain the first-level seed solution; (3) The first-level seed liquid was inoculated with an inoculum of 1×10 7 CFU / mL was transferred to seed culture medium and cultured under shaking conditions of initial pH 5.5, temperature 25°C, and rotation speed 250 rpm for 6 days to obtain secondary seed solution; (4) The secondary seed liquid was inoculated into the fermentation medium at an inoculum rate of 10% (v / v) and cultured for 5 days at a temperature of 25°C, a pH of 5.5, and a dissolved oxygen value of approximately 17% (controlled by a stirring rate of 300 rpm and a ventilation volume of 2 vvm).

[0064] Example 4 The formula of the trace element solution is: 0.05 g / L iron sulfate heptahydrate, 0.05 g / L zinc sulfate heptahydrate, 0.05 g / L copper sulfate pentahydrate; The formula of seed culture medium is: corn meal 50g / L, peanut meal 25g / L, potassium dihydrogen phosphate 1.2g / L, magnesium sulfate heptahydrate 1.5g / L and trace element solution 1mL / L; The fermentation medium formula is: corn meal 50g / L, peanut meal 15g / L, yeast extract 3g / L, corn steep liquor 2g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate heptahydrate 0.3g / L and trace element solution 1mL / L; (1) The frozen strain HW-119 obtained in Example 1 was inoculated onto a PDA medium plate and cultured at 30°C for 3 days; (2) The versicolor fungus on the PDA culture medium plate was inoculated with 1×10 6 CFU / mL was inoculated into the seed culture medium and cultured with shaking at an initial pH of 6.5, a temperature of 30°C, and a rotation speed of 150 rpm for 5 days to obtain the first-level seed solution; (3) The first seed liquid was inoculated into the seed medium at an inoculation amount of 5 x 10 7 CFU / mL, and was cultured under the conditions of an initial pH of 6.5, a temperature of 30°C, and a rotation speed of 150 rpm for 8 days to obtain a second seed liquid; (4) The second seed liquid was inoculated into the fermentation medium at an inoculation amount of 20% (v / v), and was cultured under the conditions of a temperature of 30°C, a pH of 6.5, and a dissolved oxygen value of about 19% (controlled by a stirring rate of 200 rpm and a ventilation amount of 1 vvm) for 7 days.

[0065] Example 5 The trametes versicolor was cultured according to the method of Example 3, except that the dissolved oxygen in step (4) was controlled at about 25% (controlled by a stirring rate of 100 rpm and a ventilation amount of 1 vvm).

[0066] Example 6 The trametes versicolor was cultured according to the method of Example 3, except that the pH of 6 in step (4) was replaced by a pH of 5.

[0067] Example 7 The trametes versicolor was cultured according to the method of Example 3, except that the glucose was 50 g / L, the peanut cake powder was 15 g / L, the yeast extract was 3 g / L, the corn syrup dry powder was 2 g / L, the potassium dihydrogen phosphate was 1 g / L, the magnesium sulfate was 0.1 g / L, and the trace element solution was 1 mL / L.

[0068] Example 8 The trametes versicolor was cultured according to the method of Example 3, except that the formula of the seed medium was replaced by: glucose 50 g / L, yeast extract 25 g / L, potassium dihydrogen phosphate 1.2 g / L, magnesium sulfate 0.5 g / L, and trace element solution 1 mL / L.

[0069] Comparative Example 1 The trametes versicolor was cultured according to the method of Example 3, except that the strain HW-119 obtained in Example 1 was replaced by Trametes versicolor (L.) Lloyd Trametes versicolor (purchased from Beina Biological, with the number BNCC123332).

[0070] Test Example 1 The biomass of the trametes versicolor in the fermentation liquids obtained in Examples 2-8 and Comparative Example 1 was obtained by the following method: 50 mL of the fermentation liquid was vacuum filtered, rinsed with distilled water, and freeze-dried to a constant weight. The results are shown in Table 2.

[0071] The flavonoid component content of the trametes versicolor obtained by fermentation in Examples 2-8 and Comparative Example 1 was detected by the following method: 1) The fermentation broth was filtered to separate the mycelium. The fruiting bodies of Coriolus versicolor were freeze-dried in a freeze dryer at -80°C for 48 hours, removed, crushed, dried, and then passed through a 60-mesh sieve. The lipids were removed using 95% (v / v) ethanol to obtain a uniform powder. 2) Mobile phase configuration Organic phase: 0.3% formic acid-acetonitrile solution, prepared by adding 900 mL of chromatographically pure acetonitrile to a 1 L volumetric flask, adding 3 mL of formic acid, and then diluting to 1 L with chromatographically pure acetonitrile, and mixing by inversion; Inorganic phase: 0.3% formic acid-water solution, prepared by taking 900 mL of ultrapure water and adding it to a 1 L volumetric flask, adding 3 mL of formic acid, and then making up to 1 L with ultrapure water, and mixing by inversion; 3) Weigh 5 mg of the powder sample obtained in step 1) and add 5 mL of 1% hydrochloric acid-methanol solution. Vortex for 1 min and sonicate in an ice-water bath for 30 min. 4) Centrifuge at 11,000 rpm for 5 minutes and collect the supernatant; 5) After thorough mixing, filter through a 0.22 μm organic phase filter and place in a -20°C refrigerator for testing. 6) Liquid phase conditions Chromatographic column: Agilent ZORBAX Eclipse Plus C18 (3.5µm, 2.1*150mm); Flow rate: 0.3 mL / min; autosampler temperature: 4°C; run time: 10 min; column temperature: 35°C; injection volume: 3 μL; 7) Mobile phase: Phase A was the 0.3% formic acid-water solution prepared in step 2), and phase B was the 0.3% formic acid-acetonitrile solution prepared in step 2). The gradient elution program is shown in Table 1.

[0072] The results of the flavonoid content test of the versicolor fungus obtained in each embodiment and comparative example are shown in Table 2 and Table 3, wherein the flavonoid content of the versicolor fungus obtained in Example 2 is shown in Table 3. Figure 5 .

[0073] Table 1

[0074] The terpenoid content of the versicolor fungi obtained by fermentation in Examples 2 to 8 and Comparative Example 1 was detected by the following method: 1) After fermentation, the fermentation broth was filtered to separate the mycelium. The fruiting bodies of Trametes versicolor were taken out after freeze-drying at -80℃ for 48h, crushed, dried, and ground. 5g of the powder sample was added to 5mL of methanol solution, vortexed for 1min, and ultrasonicated in an ice water bath for 30min. It was centrifuged at 11000rpm for 5min, and the supernatant was taken. 5mL of petroleum ether solution was added to the residue, vortexed for 1min, and ultrasonicated in an ice water bath for 30min. It was centrifuged at 11000rpm for 5min, and the supernatant was taken; 2) The two supernatants were combined, dried, filtered through a 0.22μm organic phase filter membrane, and placed in a -20℃ refrigerator for machine detection; 3) The gas chromatography conditions for GC-MS analysis: the chromatographic column was a TG-5MS (30m x 0.25mm x 0.25μm) elastic quartz capillary column; the carrier gas was high-purity helium (purity 99.999%); the carrier gas flow rate was 1.0mL / min; non-split sampling was used; the injection port temperature was 280℃; the programmed temperature was: the initial temperature was 40℃ for 1min, then increased to 300℃ at 10℃ / min, and maintained for 6min; 4) The mass spectrometry conditions for GC-MS analysis: the ion source was EI source, the transfer line temperature was 280℃; the ion source temperature was 300℃; the electron energy was 70eV; the scan range (m / z) was 33-300amu, and the full scan acquisition mode was used; 5) The standard curve was drawn with the measured characteristic ion mass chromatographic peak external standard as the vertical coordinate and the corresponding standard solution concentration as the horizontal coordinate, and the regression equation and correlation coefficient were calculated.

[0075] The content detection results of the terpenoid components in the Trametes versicolor fermentation broth obtained in each example and comparative example are shown in Tables 2 and 3, wherein the terpenoid components and their content results in the Trametes versicolor obtained in Example 2 are shown in Figure 6 .

[0076] Table 2

[0077] Table 3

[0078] Test Example 2 In order to observe the stability of the active ingredient production process of strain HW-119, the process of cultivating Trametes versicolor in Example 3 was repeated for 10 batches, and the contents of the active ingredients (gallic acid, ginkgetin, 2'-hydroxychalcone, and myrcene) in the Trametes versicolor obtained by fermentation in the 10 batches were determined, and the average value was calculated. Comparative Example 1 was repeated for 10 batches as a control. The results are shown in Figure 7 .

[0079] As can be seen, the strain HW-119 provided by the present application not only has good active ingredient production capacity, but also, as shown by the error bars of the 10 batches of data, has a smaller fluctuation in active ingredient content compared to the comparative example 1. Trametes versicolor (L.) Lloyd The fluctuation of the active ingredient content of the Trametes versicolor, strain HW-119 is smaller, indicating that it has better stability in active ingredient production.

[0080] The preferred embodiments of the present application are described in detail above, but the present application is not limited thereto. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be considered as disclosed by the present application and fall within the protection scope of the present application.

Claims

1. A versicolor fungus, characterized in that The versicolor fungus ( Trametes versicolor )'s deposit number is CCTCCNO: M2025762.

2. A bacterial agent, characterized in that The bacterial agent contains the versicolor fungus according to claim 1.

3. The microbial agent according to claim 2, characterized in that The bacterial agent contains at least one of the living bacteria, dead bacteria and fermentation products of the versicolor fungus; Preferably, the bacterial agent is a liquid bacterial agent or a solid bacterial agent.

4. A method for cultivating Coriolus versicolor, characterized in that: The method comprises the following steps: sequentially performing seed culture and fermentation culture on the versicolor fungus described in claim 1 or the bacterial agent described in claim 2 or 3.

5. The method according to claim 4, characterized in that The seed culture medium used in the seed culture contains corn meal, peanut meal, potassium dihydrogen phosphate, magnesium sulfate and trace element solution; Preferably, the trace element solution in the seed culture medium contains: 0.05-0.1 g / L of iron sulfate heptahydrate, 0.02-0.05 g / L of zinc sulfate heptahydrate, and 0.02-0.05 g / L of copper sulfate pentahydrate; Preferably, the seed culture medium contains: 30-50 g / L corn meal, 25-30 g / L peanut meal, 1.2-2 g / L potassium dihydrogen phosphate, 1.5-2.5 g / L magnesium sulfate heptahydrate and 0.5-1.5 mL / L trace element solution.

6. The method according to claim 5, characterized in that The fermentation culture medium used in the fermentation culture contains corn cake powder, peanut cake powder, yeast extract, corn steep liquor powder, potassium dihydrogen phosphate, magnesium sulfate and trace element solution; Preferably, the trace element solution in the fermentation medium contains: 0.05-0.1 g / L of iron sulfate heptahydrate, 0.02-0.05 g / L of zinc sulfate heptahydrate, and 0.02-0.05 g / L of copper sulfate pentahydrate; Preferably, the fermentation medium contains: 30-50 g / L corn meal, 15-25 g / L peanut meal, 3-8 g / L yeast extract, 2-5 g / L corn steep liquor powder, 1-2 g / L potassium dihydrogen phosphate, 0.3-0.5 g / L magnesium sulfate heptahydrate and 0.5-1.5 mL / L trace element solution.

7. The method according to any one of claims 4 to 6, characterized in that The seed culture includes a primary seed culture and a secondary seed culture carried out in sequence; Preferably, the conditions for the primary seed culture include: an inoculum size of 1×10 5 -1×10 6 CFU / mL, initial pH 5.5-6.5, temperature 25-30°C, rotation speed 150-250 rpm, time 3-5 days; Preferably, the conditions for the secondary seed culture include: an inoculum size of 1×10 7 -5×10 7 CFU / mL, initial pH 5.5-6.5, temperature 25-30°C, rotation speed 150-250 rpm, time 6-8 days.

8. The method according to any one of claims 4 to 6, characterized in that The fermentation culture conditions include: an inoculum amount of 10-20% by volume, a temperature of 25-30° C., a pH of 5.5-6.5, dissolved oxygen below 20%, and a fermentation time of 5-7 days.

9. Use of the versicolor fungus according to claim 1, the bacterial agent according to claim 2 or 3, or the method according to any one of claims 4 to 8 in fermentation production of active ingredients and / or preparation of functional products; wherein, The active ingredients include flavonoids and / or terpenoids.

10. The use according to claim 9, characterized in that The flavonoid compound is selected from at least one of gallic acid, ginkgo biloba flavonoids, 2'-hydroxychalcone and protocatechuic acid, preferably gallic acid and ginkgo biloba flavonoids; the terpene compound is myrcene; Preferably, the functional product is an anti-tumor drug and / or an immunomodulatory drug.

Images