Candida tropicalis strain, fungicide, and preparation method and application of candida tropicalis strain and fungicide

Abstract

The invention relates to the technical field of microorganisms, and discloses a candida tropicalis strain. The candida tropicalis strain is a candida tropicalis SDU2 strain, the classification name is Candida tropicalis, the preservation number is CGMCC No.34306, the preservation date is April 23, 2025, the preservation unit is China General Microbiological Culture Collection Center, and the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, Beichen West Road, Chaoyang District, Beijing. The candida tropicalis SDU2 strain has grease production capacity and high-temperature tolerance, and can convert waste biomass into biodiesel. The microbial inoculum prepared from the candida tropicalis SDU2 strain can be synchronously saccharified and fermented with biomass, so that the problem of high cost caused by poor strain adaptability in the traditional biomass high-valued comprehensive utilization process can be solved. The invention further discloses a candida tropicalis agent as well as a preparation method and application thereof.

Description

Technical Field

[0001] The present application relates to the field of microbial technology, and more particularly to a Candida tropicalis strain, a bacterial agent, and a preparation method and application thereof. Background Art

[0002] Driven by the global energy transition and carbon neutrality goals, biodiesel, as a renewable energy source, has become a key alternative to traditional fossil fuels. Third-generation biodiesel technology, based on microbial oils, has become a key breakthrough in promoting green, low-carbon energy development due to its significant advantages, including short production cycles, scalable production, no competition with grain production, no seasonal or climatic impacts, and a wide range of raw material sources. Oleaginous yeast, with its strong environmental adaptability, rapid growth rate, and high cell density, demonstrates great potential for the industrial production of microbial oils.

[0003] Related technology discloses a method for producing microbial oil by fermenting corn straw hydrolyzate. Corn straw is hydrolyzed with dilute sulfuric acid to obtain lignocellulose hydrolyzate, and the lignocellulose hydrolyzate is used as a substrate to prepare a fermentation medium. Rhodosporidium toruloides is used as the fermentation strain to produce microbial oil at 30°C.

[0004] During the implementation of the embodiments of the present disclosure, it was found that at least the following problems exist in the related art:

[0005] In the field of straw bioconversion, the relatively simple simultaneous saccharification and fermentation method is a more ideal fermentation technology. The culture conditions for oil-producing microorganisms in related technologies are 30°C. However, the enzymatic reaction in the simultaneous saccharification and fermentation method must be carried out in the high temperature range of 45°C to 50°C, and the oil-producing microorganisms in related technologies will suffer irreversible damage at this temperature. This incompatibility between the microbial growth temperature and the enzymatic reaction temperature limits the application of microorganisms in simultaneous saccharification and fermentation technology. Therefore, there is an urgent need to develop new microbial strains that are resistant to high temperatures and have excellent metabolic properties.

[0006] It should be noted that the information disclosed in the above background technology section is only used to enhance the understanding of the background of this application, and therefore may include information that does not constitute prior art known to ordinary technicians in this field. Summary of the Invention

[0007] In order to provide a basic understanding of some aspects of the disclosed embodiments, a brief summary is given below. The summary is not an extensive review, nor is it intended to identify key / critical elements or delineate the scope of protection of these embodiments, but rather serves as a prelude to the detailed description that follows.

[0008] The present disclosure provides a preparation method and application of a tropical Candida strain and its bacterial agent to improve the high temperature tolerance of the tropical Candida strain, thereby enhancing the process adaptability of the tropical Candida strain in the simultaneous saccharification and fermentation of biomass.

[0009] In some embodiments, a tropical Candida strain is provided, which is the tropical Candida SDU2 strain, classified as Candida tropicalis, with a deposit number of CGMCC No. 34306, a deposit date of April 23, 2025, and the depository is the General Microbiology Center of the China Culture Collection Administration.

[0010] In some embodiments, the ITS gene sequence of the Candida tropicalis SDU2 strain is shown in SEQ ID NO: 1.

[0011] In some embodiments, the growth environment temperature of the Candida tropicalis SDU2 strain is 25-45°C.

[0012] In some embodiments, the pH value of the growth environment of the Candida tropicalis SDU2 strain is 2-11.

[0013] In some embodiments, the Candida tropicalis SDU2 strain is capable of utilizing one or more of glucose, glycerol, sucrose, mannitol, maltose, fructose, and ethanol as a carbon source.

[0014] In some embodiments, the Candida tropicalis SDU2 strain is capable of utilizing one or more of glycine, glutamate, potassium nitrate, and ammonia as a nitrogen source.

[0015] In some embodiments, the Candida tropicalis SDU2 strain has the ability to produce lipids.

[0016] In some embodiments, a Candida tropicalis agent is provided, which is prepared by fermentation and culturing the Candida tropicalis SDU2 strain described in any one of the above.

[0017] In some embodiments, a method for preparing a Candida tropicalis agent is provided, comprising: inoculating the Candida tropicalis SDU2 strain into a solid culture medium and incubating the strain to obtain a single colony; transferring the single colony into a first liquid culture medium for culturing to obtain a seed solution; and inoculating the seed solution into a second liquid culture medium for culturing to obtain a fermentation solution.

[0018] In some embodiments, the second liquid culture medium comprises: 22-28 g / L glucose, 9-11 g / L yeast powder, 18-22 g / L peptone, and 1.3-1.7 g / L ammonium sulfate.

[0019] In some embodiments, the second liquid culture medium comprises: 25 g / L glucose, 10 g / L yeast powder, 20 g / L peptone, and 1.5 g / L ammonium sulfate.

[0020] In some embodiments, the initial pH of the second liquid culture medium is adjusted to 7-8.5 using aqueous ammonia.

[0021] In some embodiments, the second liquid culture medium is initially adjusted to pH=8 using aqueous ammonia.

[0022] In some embodiments, a use of the Candida tropicalis agent according to any one of the above disclosed embodiments in fermenting biomass to produce biodiesel is provided.

[0023] In some embodiments, provided is a use of a Candida tropicalis agent prepared by the method for preparing a Candida tropicalis agent according to any of the above disclosed embodiments in the production of biodiesel from fermented biomass.

[0024] In some embodiments, a method for producing biodiesel by fermenting biomass with a tropical yeast inoculum is provided, comprising: inoculating the tropical yeast inoculum into an oil-producing culture medium containing biomass, adding cellulase and xylanase, and simultaneously saccharifying and fermenting the culture to obtain an oil-producing yeast cell fermentation broth; wherein the tropical yeast inoculum is the tropical yeast inoculum according to any of the preceding embodiments or the tropical yeast inoculum prepared by the method for preparing the tropical yeast in any of the preceding embodiments; centrifuging the oil-producing yeast cell fermentation broth and discarding the supernatant to obtain cells, drying the cells to obtain dried cells; heating and extracting the dried cells with an organic solvent, evaporating the organic solvent, and drying the remaining material to obtain oil.

[0025] In some embodiments, the temperature of the simultaneous saccharification and fermentation culture is 43-45°C.

[0026] In some embodiments, the oil-producing culture medium includes: K2HPO4 1-5 g / L, Na2HPO4·7H2O 1-5 g / L, MgSO4·7H2O 0.1-0.5 g / L, EDTA 0.1-0.3 g / L, Tween 80 1-5 mL / L, (NH4)2SO4 0.5-1 g / L, CaCl2 0.005-0.02 g / L and CuSO4·5H2O 0.005-0.03 g / L.

[0027] In some embodiments, the oil-producing medium comprises: K2HPO4 2.7 g / L, Na2HPO4·7H2O 2.4 g / L, MgSO4·7H2O 0.2 g / L, EDTA 0.1 g / L, Tween 80 2.0 mL / L, (NH4)2SO4 0.5 g / L, CaCl2 0.01 g / L, and CuSO4·5H2O 0.015 g / L.

[0028] The preparation method and application of the Candida tropicalis strain and its bacterial agent provided in the embodiments of the present disclosure can achieve the following technical effects:

[0029] The tropical Candida SDU2 strain provided in the embodiments of the present disclosure has excellent environmental adaptability, is easy to culture, and grows rapidly, making it a promising candidate for use as an engineered chassis cell. Furthermore, the tropical Candida SDU2 strain possesses oil-producing capacity and high-temperature tolerance, enabling it to convert waste biomass into biodiesel. The inoculum prepared using this tropical Candida SDU2 strain can undergo simultaneous saccharification and fermentation with the biomass, thereby addressing the high cost associated with poor strain adaptability in traditional biomass high-value comprehensive utilization processes.

[0030] The above general description and the following description are exemplary and explanatory only and are not intended to limit the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] One or more embodiments are exemplarily described by corresponding drawings. These exemplary descriptions and drawings do not limit the embodiments. Elements with the same reference numerals in the drawings are shown as similar elements. The drawings do not constitute a scale limitation. In addition,

[0032] Figure 1 This is a flowchart of a method for preparing a Candida tropicalis agent provided in an embodiment of the present disclosure;

[0033] Figure 2 This is a flowchart of a method for producing biodiesel by fermenting biomass with a Candida tropicalis inoculum provided in an embodiment of the present disclosure;

[0034] Figure 3 This is a cell morphology photograph of a Candida tropicalis SDU2 strain provided in an embodiment of the present disclosure;

[0035] Figure 4 1 is a growth curve of a Candida tropicalis SDU2 strain at different temperatures provided in an embodiment of the present disclosure. DETAILED DESCRIPTION

[0036] In order to be able to understand the features and technical content of the embodiments of the present disclosure in more detail, the implementation of the embodiments of the present disclosure is described in detail below in conjunction with the accompanying drawings. The accompanying drawings are for reference only and are not used to limit the embodiments of the present disclosure. In the following technical description, for the sake of convenience of explanation, a full understanding of the disclosed embodiments is provided through a number of details. However, one or more embodiments can still be implemented without these details. In other cases, to simplify the drawings, well-known structures, steps, and devices can be simplified for display.

[0037] In the description and claims of the embodiments of the present disclosure, as well as in the accompanying drawings, the terms "first," "second," and the like are used to distinguish similar items and are not necessarily used to describe a particular order or precedence. It should be understood that the terms used in this manner are interchangeable where appropriate to describe the embodiments of the present disclosure herein. In addition, the terms "including," "having," and any variations thereof are intended to cover non-exclusive inclusions.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application belongs. The term "plurality" means two or more. In the disclosed embodiment, the character " / " indicates that the objects before and after are in an "or" relationship. For example, A / B means: A or B. The term "and / or" is a description of the association relationship between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or, three relationships of A and B.

[0039] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present disclosure can be combined with each other.

[0040] Those skilled in the art will understand that in the methods involved in the specification of this application and other parts, for example, in the methods of each embodiment, example or claim, the writing order of each step does not mean a strict execution order and constitutes any limitation on the implementation process. The detailed execution order of each step should be determined by its function and possible internal logic. Unless otherwise specified, all steps of this application can be performed sequentially or randomly, preferably sequentially. For example, the method includes steps A and B, which means that the method may include steps A and B performed sequentially, or steps B and A performed sequentially. For example, it is mentioned that the method may also include step C, which means that step C can be added to the method in any order. For example, the method may include steps A, B and C, or steps A, C and B, or steps C, A and B, etc.

[0041] In this application, open technical features or technical solutions described with words such as "contain," "include," and "includes" do not exclude additional members beyond the listed members unless otherwise specified, and can be regarded as providing both closed features or solutions consisting of the listed members and open features or solutions that include additional members beyond the listed members. For example, if A includes a1, a2, and a3, it may or may not include other members unless otherwise specified. This can be regarded as providing both the feature or solution of "A consists of a1, a2, and a3" and the feature or solution of "A includes not only a1, a2, and a3, but also other members."

[0042] The "ranges" disclosed in this application can be defined in the form of lower limits and upper limits. A given range is defined by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundaries of the particular range. Ranges defined in this way can be inclusive or exclusive of the end values, any end value can be included or excluded independently, and can be arbitrarily combined, that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 25 to 45 and 43 to 45 are listed for a particular parameter, it is understood that ranges of 25 to 35 and 43 to 55 are also expected. In addition, if the minimum range values ​​1 and 2 are listed, and if the maximum range values ​​3, 4 and 5 are also listed, the following ranges can all be expected: 1 to 3, 1 to 4, 1 to 5, 2 to 3, 2 to 4 and 2 to 5. In this application, unless otherwise specified, the numerical range "a to b" represents an abbreviation for any combination of real numbers between a and b, where a and b are both real numbers. For example, a numerical range of "1-5" indicates that all real numbers between "1-5" are listed herein, and "1-5" is merely an abbreviation for the combination of these values. Furthermore, when a parameter is expressed as an integer ≥ 2, this is equivalent to listing the parameter as, for example, the integers 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and so on. For example, when a parameter is expressed as an integer selected from "2-10," this is equivalent to listing the integers 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0043] In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0044] The present disclosure provides a tropical Candida strain, which is the tropical Candida SDU2 strain, classified and named Candida tropicalis, with a deposit number of CGMCC No. 34306 and a deposit date of April 23, 2025. The depositor is the General Microbiology Center of the China Culture Collection Administration, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0045] The tropical Candida SDU2 strain provided in the embodiments of the present disclosure has excellent environmental adaptability, is easy to culture, and grows rapidly, making it a promising candidate for use as an engineered chassis cell. Furthermore, the tropical Candida SDU2 strain possesses oil-producing capacity and high-temperature tolerance, enabling it to convert waste biomass into biodiesel. The inoculum prepared using this tropical Candida SDU2 strain can undergo simultaneous saccharification and fermentation with the biomass, thereby addressing the high cost associated with poor strain adaptability in traditional biomass high-value comprehensive utilization processes.

[0046] The morphological characteristics of the strains of the present disclosure embodiment on solid YPD medium are as follows:

[0047] Colony characteristics: regular circle, milky white, convex, smooth and shiny surface, sticky, with neat edges.

[0048] Cell morphology: cells are oval (see Figure 3 ).

[0049] The above morphological characteristics are consistent with the typical cell morphological characteristics of Candida.

[0050] Optionally, the ITS gene sequence of the Candida tropicalis SDU2 strain is shown as SEQ ID NO: 1.

[0051] The sequence of SEQ ID NO: 1 is as follows:

[0052] TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACT

[0053] GATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTG

[0054] GTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTT

[0055] TTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAA

[0056] CAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGC

[0057] GATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAAC

[0058] GCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTC

[0059] ATTTCTCCCTCAAACCCGGGTTTGGTGTTGAGCAATACGCTAGGTT

[0060] TGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTA

[0061] TCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACT

[0062] TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA.

[0063] Optionally, the growth environment temperature of the Candida tropicalis SDU2 strain is 25-45°C.

[0064] Optionally, the growth environment temperature of the Candida tropicalis SDU2 strain is 25-40°C.

[0065] Optionally, the growth environment temperature of the Candida tropicalis SDU2 strain is 35°C.

[0066] The Candida tropicalis SDU2 strain can grow over a relatively wide temperature range, particularly maintaining activity at elevated temperatures of 43-45°C, making it suitable for simultaneous saccharification and fermentation. This allows the strain to adapt to the high temperatures of the enzymatic reactions during simultaneous saccharification and fermentation of biomass, mitigating growth restrictions or damage caused by temperature fluctuations. This maintains the continuity and stability of the oil synthesis process, contributing to improved overall biodiesel production efficiency.

[0067] Optionally, the growth environment pH of the Candida tropicalis SDU2 strain is 2-11.

[0068] Optionally, the growth environment pH of the Candida tropicalis SDU2 strain is 5-10.

[0069] Optionally, the growth environment pH of the Candida tropicalis SDU2 strain is 7-9.

[0070] Optionally, the growth environment of the Candida tropicalis SDU2 strain is pH=8.

[0071] The tropical Candida SDU2 strain has a wide pH adaptability of pH = 2 to 11, which enables the strain to show high flexibility in different fermentation environments. Especially in alkaline environments, such as in the range of pH = 7 to 9, the growth activity of the strain is more significant. During the preparation of the inoculum or during the simultaneous saccharification and fermentation process, the pH value of the fermentation system may fluctuate due to factors such as microbial metabolic activity, substrate composition or enzyme type. The tropical Candida SDU2 strain can maintain growth activity in a wide pH range of pH = 2 to 11, which can reduce the frequent and precise adjustment of the pH value, thereby effectively simplifying the control steps of the fermentation process and reducing the complexity of production operations and production costs.

[0072] Alternatively, the Candida tropicalis SDU2 strain is capable of utilizing one or more of glucose, glycerol, sucrose, mannitol, maltose, fructose and ethanol as a carbon source.

[0073] In some embodiments, the Candida tropicalis SDU2 strain utilizes one of glucose, glycerol, sucrose, mannitol, maltose, fructose, and ethanol as a carbon source.

[0074] The tropical yeast SDU2 strain has a broad carbon source utilization spectrum and can utilize one or more of glucose, glycerol, sucrose, mannitol, maltose, fructose, and ethanol as a carbon source. This allows the tropical yeast SDU2 strain to flexibly utilize a variety of carbon sources in different fermentation environments. In actual biomass fermentation processes, substrate composition is complex and the carbon source types are diverse. The ability to utilize multiple carbon sources allows the strain to better adapt to different types of biomass feedstocks, such as various agricultural wastes (corn stalks, sweet sorghum stalks, reeds, etc.), thereby improving substrate utilization.

[0075] Alternatively, the Candida tropicalis SDU2 strain is capable of utilizing one or more of glycine, glutamate, potassium nitrate and ammonia as a nitrogen source.

[0076] In some embodiments, the Candida tropicalis SDU2 strain utilizes one of glycine, glutamate, potassium nitrate, and ammonia as a nitrogen source.

[0077] The type and concentration of nitrogen sources may vary under different fermentation environments. The ability to utilize multiple nitrogen sources allows strains to adapt to different nitrogen source conditions, reduces growth limitations caused by insufficient or single nitrogen sources, and enhances the adaptability of strains in different fermentation systems.

[0078] Optionally, the Candida tropicalis SDU2 strain has the ability to produce oil.

[0079] The Candida tropicalis SDU2 strain has the ability to produce oil and can effectively convert carbon sources and nitrogen sources into oil. In the process of converting biomass into biodiesel, the Candida tropicalis SDU2 strain converts fermentable sugars (such as glucose) and nitrogen sources (such as glycine, glutamic acid, potassium nitrate, and ammonia) from biomass into oil through metabolic pathways, providing key raw materials for the production of biodiesel, thereby enabling effective conversion of biomass to biodiesel.

[0080] The Candida tropicalis SDU2 strain has the ability to produce oil and can effectively convert carbon sources and nitrogen sources into oil. In the process of converting biomass into biodiesel, the Candida tropicalis SDU2 strain converts fermentable sugars (such as glucose) and nitrogen sources (such as glycine, glutamic acid, potassium nitrate, and ammonia) from biomass into oil through metabolic pathways, providing key raw materials for the production of biodiesel, thereby enabling effective conversion of biomass to biodiesel.

[0081] The Candida tropicalis SDU2 strain has the ability to produce oil and can effectively convert carbon sources and nitrogen sources into oil. In the process of converting biomass into biodiesel, the Candida tropicalis SDU2 strain converts fermentable sugars (such as glucose) and nitrogen sources (such as glycine, glutamic acid, potassium nitrate, and ammonia) from biomass into oil through metabolic pathways, providing key raw materials for the production of biodiesel, thereby enabling effective conversion of biomass to biodiesel.

[0082] In combination with Figure 1 The preparation method of the Candida tropicalis SDU2 strain provided by the present disclosure comprises the following steps:

[0083] S101, inoculating the Candida tropicalis SDU2 strain into a solid culture medium for incubation to obtain a single colony.

[0084] S102, transferring the single colony to a first liquid culture medium for culture to obtain a seed liquid.

[0085] S103, inoculating the seed liquid into a second liquid culture medium for culture to obtain a fermentation liquid.

[0086] The preparation method of the Candida tropicalis SDU2 strain provided by the present disclosure comprises the following steps:

[0087] Optionally, the second liquid culture medium comprises: glucose 20 g / L, yeast powder 10 g / L, and peptone 20 g / L.

[0088] In the disclosed embodiment, the second liquid culture medium is a liquid yeast extract peptone dextrose medium (Yeast Peptone Dextrose Medium, YPD medium). In the liquid YPD medium, yeast powder is rich in protein, vitamins and minerals, which can provide rich nutrients for the tropical Candida SDU2 strain and promote the growth and metabolism of the strain. Peptone provides a nitrogen source and amino acids, which helps cell division and proliferation. Glucose, as a carbon source, provides the strain with energy and a carbon skeleton for oil synthesis. This culture medium can provide a good environment for the metabolic activities of the strain, help maintain the normal physiological functions of the cells, and activate the metabolic pathways of the strain.

[0089] Optionally, the second liquid culture medium includes: 22-28 g / L glucose, 9-11 g / L yeast powder, 18-22 g / L peptone and 1.3-1.7 g / L ammonium sulfate.

[0090] In the embodiment of the present disclosure, the second liquid culture medium is a modified liquid YPD culture medium, and glucose, yeast powder, peptone and ammonium sulfate are key nutrients required for microbial growth and reproduction and oil synthesis. Glucose serves as the main carbon source, providing the strain with energy and a carbon skeleton for oil synthesis. Ammonium sulfate serves as an inorganic nitrogen source supplement, and cooperates with other ingredients to ensure nutritional balance. Compared with the liquid YPD culture medium, the modified liquid YPD culture medium provided in the embodiment of the present disclosure increases the concentration of carbon and nitrogen sources, which can increase the concentration of nutrients, thereby increasing the number of strain cells. This culture medium can meet the growth requirements of the tropical Candida SDU2 strain, enabling it to grow and reproduce rapidly under suitable conditions, forming a large number of bacterial cells, thereby increasing the cell density of the seed liquid and providing sufficient strains for the subsequent fermentation process. In the embodiment of the present disclosure, by reasonably setting the concentration range of each component in the second liquid culture medium, the culture medium can not only meet the rapid growth and reproduction requirements of the strain, but also effectively avoid problems such as metabolic disorders caused by insufficient nutrition or product accumulation obstruction caused by excessive nutrition.

[0091] Optionally, the second liquid culture medium includes: 25 g / L glucose, 10 g / L yeast powder, 20 g / L peptone, and 1.5 g / L ammonium sulfate.

[0092] In the disclosed embodiments, the specific concentrations of the components in the second liquid culture medium are further clarified to effectively adapt to the growth and metabolic characteristics of the Candida tropicalis SDU2 strain. At these concentrations, the components in the second liquid culture medium work synergistically, achieving optimal growth rate, cell density, and lipid synthesis capacity. This enables efficient nutrient utilization and conversion, reduces unnecessary nutrient waste, and lowers culture costs.

[0093] Optionally, the second liquid culture medium is initially adjusted to pH 7.0-8.5 using aqueous ammonia.

[0094] Optionally, the second liquid culture medium is initially adjusted to pH=8.0 using aqueous ammonia.

[0095] In some embodiments, the second liquid culture medium comprises: 25 g / L glucose, 10 g / L yeast powder, 20 g / L peptone, and 1.5 g / L ammonium sulfate.

[0096] During the cultivation of a liquid culture medium of Candida tropicalis SDU2, acidic metabolites are produced, causing the pH of the fermentation broth to decrease. In this example, ammonia was used to adjust the initial pH of the second liquid culture medium to an alkaline state. This alkaline environment allows Candida tropicalis SDU2 to grow better, effectively increasing its growth rate and cell density.

[0097] Optionally, in step S101 , inoculating the Candida tropicalis SDU2 strain into a solid culture medium for incubation includes: inoculating the Candida tropicalis SDU2 strain into a solid YPD culture medium and culturing at a culture temperature of 35° C.

[0098] In some embodiments, the solid YPD medium comprises: 20 g / L glucose, 10 g / L yeast powder, 20 g / L peptone, and 12 g / L agar powder.

[0099] When inoculating the Candida tropicalis SDU2 strain in solid culture medium, solid YPD medium is used and cultured at 35°C. Solid YPD medium has a defined composition, is nutrient-rich, and is conducive to the formation of single colonies. The 35°C culture temperature, which is at the mid-to-high end of the strain's optimal growth range, effectively promotes rapid growth and reproduction, enabling the formation of a sufficient number of high-quality single colonies in a relatively short period of time. This provides a sufficient and healthy starting source of bacteria for subsequent transfer to liquid culture and large-scale fermentation.

[0100] Optionally, in step S102, the step of transferring a single colony to a first liquid culture medium for culture includes: transferring multiple single colonies to the first liquid culture medium, and culturing with shaking at a culture temperature of 35°C, wherein the first liquid culture medium is a liquid YPD culture medium.

[0101] In some embodiments, liquid YPD medium includes: 20 g / L glucose, 10 g / L yeast powder, and 20 g / L peptone.

[0102] When selecting multiple single colonies from the incubated colonies and transferring them to a larger culture, use liquid YPD medium and culture them with shaking at 35°C. Liquid YPD medium provides the strain with more nutrients and dissolved oxygen, and shaking culture at 35°C facilitates full contact and mixing between the strain and the medium, promoting material exchange and metabolic activity, accelerating cell division and proliferation, rapidly increasing the bacterial population, and forming a high-quality seed solution.

[0103] Optionally, in step S103, the step of inoculating the seed liquid into the second liquid culture medium for culturing includes: inoculating the seed liquid into a fermentation tank containing the second liquid culture medium, and culturing under the conditions of a culture temperature of 35°C, a ventilation volume of 1.2 to 1.5 vvm, a tank pressure of 0.04 to 0.07 MPa, and a rotation speed of 500 to 750 rpm.

[0104] Among the seed liquid culture conditions provided in the embodiments of the present disclosure, the culture temperature of 35°C can provide a suitable growth and metabolic environment for the tropical Candida SDU2 strain. The ventilation volume of 1.2 to 1.5 vvm can fully meet the oxygen demand of the aerobic metabolism of the strain. The stable tank pressure of 0.04 to 0.07 MPa can prevent external pressure fluctuations from interfering with the fermentation system and maintain the stability of the fermentation environment. The rotation speed of 500 to 750 rpm can promote the full mixing of the strain and the culture medium, while ensuring the efficiency of mass transfer and heat transfer. Under the synergistic effect of temperature, ventilation volume, tank pressure and rotation speed conditions, the strain can efficiently utilize the nutrients in the second liquid culture medium for growth and metabolism, thereby preparing a high-density bacterial agent.

[0105] The tropical Candida SDU2 strain is easy to culture and has a fast growth rate. The number of viable cells of the tropical Candida SDU2 strain in the tropical Candida preparation prepared by the above preparation method is greater than or equal to 10 10 The high concentration of live bacteria (1000 cells / mL) offers excellent initial inoculum advantages. During simultaneous saccharification and fermentation to produce biodiesel, they can quickly assume a dominant position within the microbial ecosystem, rapidly initiating metabolic activity and efficiently utilizing substrates for oil synthesis. A large number of live bacteria accelerates the fermentation process, shortens the production cycle, and improves biodiesel production efficiency. Furthermore, a sufficient number of live bacteria allows for full contact and reaction with the substrate, reducing substrate inhibition and ensuring a more complete and robust fermentation process. This ultimately increases oil yields, and therefore biodiesel output, contributing to improved industrial economic benefits.

[0106] The presently disclosed embodiments provide use of a tropical yeast strain according to any of the preceding embodiments in producing biodiesel from fermented biomass; or use of a tropical yeast strain obtained by the method for preparing the tropical yeast strain according to any of the preceding embodiments in producing biodiesel from fermented biomass.

[0107] The disclosed embodiment applies the Candida tropicalis SDU2 inoculant of any of the aforementioned embodiments to the fermentation of biomass to produce biodiesel. Therefore, this application can utilize all the beneficial effects of the aforementioned Candida tropicalis SDU2 inoculant, which will not be described in detail here.

[0108] Combine Figure 2 As shown, the present disclosure provides a method for producing biodiesel by fermenting biomass with a Candida tropicalis inoculum, comprising:

[0109] S201, inoculating a tropical yeast agent into an oil-producing culture medium containing biomass, adding cellulase and xylanase, and simultaneously saccharifying and fermenting the culture to obtain an oil-producing yeast fermentation broth; wherein the tropical yeast agent is the tropical yeast agent of any of the preceding embodiments or the tropical yeast agent prepared by the preparation method of the tropical yeast agent of any of the preceding embodiments.

[0110] S202, centrifuging the fermentation liquid of the oil-producing yeast cells and discarding the supernatant to obtain the cells, drying them to obtain dried cells.

[0111] S203, heating and extracting the dried bacterial cells with an organic solvent, evaporating the organic solvent, and drying the remaining material to obtain oil.

[0112] The tropical Candida inoculum contains a large number of tropical Candida SDU2 strains, which have the ability to convert biomass into oils. During the simultaneous saccharification and fermentation process, the tropical Candida SDU2 strain utilizes the fermentable sugars in the biomass for growth and metabolism, converting these fermentable sugars into oils through its own metabolic pathways. Biomass is typically rich in components such as cellulose and hemicellulose. Cellulase breaks down cellulose into fermentable carbon sources such as glucose, while xylanase breaks down hemicellulose to release xylose. Furthermore, xylanase can disrupt the fiber structure, thereby enhancing the effectiveness of cellulase. The synergistic action of cellulase and cellulase can maximize the conversion of carbohydrate components in the biomass into fermentable sugars, thereby improving substrate utilization and oil yield throughout the biodiesel production process.

[0113] The method for producing biodiesel by fermenting biomass with tropical yeast agents provided in the embodiments of the present disclosure is carried out by inoculating tropical yeast agents in an oil-producing culture medium containing biomass, and adding cellulase and xylanase to carry out simultaneous saccharification and fermentation. The tropical yeast SDU2 strain in the tropical yeast agents can quickly initiate metabolic reactions under suitable conditions, cooperate with enzymatic reactions, decompose polysaccharide components such as cellulose and hemicellulose in biomass into usable sugars, and further convert them into oils and fats, thereby achieving efficient conversion and utilization of biomass. The simultaneous saccharification and fermentation process reduces the tedious operations and time costs of separate saccharification and fermentation links, and improves production efficiency. Subsequent separation and purification operations such as centrifugation and heated extraction can effectively separate the oils and fats to obtain raw materials for biodiesel production.

[0114] Optionally, in step S201 , the tropical yeast strain is inoculated into the oil-producing culture medium containing biomass, and cellulase and xylanase are added to perform simultaneous saccharification and fermentation culture. The inoculation amount of the tropical yeast strain is 2-10%.

[0115] In some embodiments, the inoculum size of the Candida tropicalis agent is 5%.

[0116] In the disclosed embodiments, the use of an appropriate inoculum amount of the tropical yeast agent ensures that the strain is sufficient in the early stages of fermentation, quickly takes a dominant position in the fermentation system, initiates metabolic reactions, and inhibits the growth of other bacteria. When the inoculum amount of the tropical yeast agent is 2 to 10%, and especially when the inoculum amount is 5%, it can not only enable the bacteria to play an oil-producing role in a timely manner, but also avoid the increased costs and waste of resources caused by excessive inoculum amounts, thereby optimizing the production input-output ratio. At this inoculum amount, the strain can fully contact and synergize with the enzyme and biomass substrate, promote the efficient and stable fermentation process, and is conducive to improving the efficiency and quality of biodiesel production.

[0117] Optionally, in step S201 , the Candida tropicalis agent is inoculated into an oil-producing culture medium containing biomass, and cellulase and xylanase are added to perform simultaneous saccharification and fermentation culture, with the amount of cellulase being 3 to 15 FPU / g biomass.

[0118] Optionally, the amount of cellulase used is 3 to 12 FPU / g biomass.

[0119] In some embodiments, the cellulase is used in an amount of 12 FPU / g biomass.

[0120] Cellulase is a key enzyme that decomposes cellulose in biomass, and its dosage directly affects the saccharification effect and substrate conversion rate. Although a lower enzyme dosage (such as 3FPU / g biomass) can reduce costs to a certain extent, it may cause insufficient cellulose decomposition and limit the supply of raw materials for oil synthesis. Higher enzyme dosages (such as 15FPU / g biomass) can more efficiently decompose cellulose, release more fermentable sugars, provide a rich carbon source for the strain, promote large-scale oil synthesis, and thus increase biodiesel production, but the cost is relatively high. The disclosed embodiment limits the dosage of cellulase to 3 to 15FPU / g biomass, which can achieve a balance between the economy and efficiency of biodiesel production.

[0121] Optionally, in step S201 , the Candida tropicalis agent is inoculated into an oil-producing culture medium containing biomass, and cellulase and xylanase are added to perform simultaneous saccharification and fermentation culture, with the dosage of xylanase being 30-40 U / g biomass.

[0122] In some embodiments, the amount of xylanase used is 40 U / g biomass.

[0123] Xylanase is used to break down the xylan component of biomass. A dosage of 30 to 40 units per gram of biomass effectively breaks down xylan and converts it into usable monosaccharides such as xylose. This broadens the range of carbon sources available to the strain, providing more raw materials for oil synthesis, thereby increasing oil and biodiesel production. Furthermore, the appropriate dosage of xylanase avoids the cost increases and environmental pressures caused by excessive enzyme use.

[0124] Cellulase can break down cellulose into fermentable carbon sources such as glucose. Xylanase can break down hemicellulose, release xylose, and destroy the fiber structure, thereby promoting the effect of cellulase. Cellulase and xylanase have a synergistic effect. Corn stalks and other straw waste are rich in cellulose and hemicellulose. Therefore, the disclosed embodiments of this application improve the efficiency of the enzymatic reaction by controlling the amount of xylanase and increasing the amount of cellulase, thereby improving the effect of simultaneous saccharification and fermentation method for producing oil.

[0125] Optionally, in step S201 , the Candida tropicalis agent is inoculated into an oil-producing medium containing biomass, and cellulase and xylanase are added to perform simultaneous saccharification and fermentation culture, wherein the content of biomass in the oil-producing medium is 5-10%.

[0126] The biomass content in the oil-producing culture medium is 5-10%, which means that the mass percentage of the biomass in the oil-producing culture medium is 5-10%.

[0127] In some embodiments, the biomass content in the oil production medium is 10%.

[0128] The content of the biomass in the oil-producing culture medium is 5-10%, which can ensure sufficient substrate supply in the fermentation system to meet the material demand of strain growth and oil synthesis. The appropriate biomass can provide sufficient carbon source and other nutrients for the fermentation process, thereby supporting the growth and metabolic activity of the strain and promoting the synthesis of oil. The content range of the biomass can avoid the problem of too high substrate concentration leading to too large viscosity of the fermentation system and difficult oxygen mass transfer, and at the same time, can also avoid the problem of too low substrate concentration causing the inability to meet the demand of strain growth and oil synthesis. Therefore, controlling the content of biomass in the oil-producing culture medium to be 5-10% can realize efficient production of oil, thereby improving the yield of oil.

[0129] Optionally, the biomass is corn straw powder.

[0130] The corn straw is mainly composed of cellulose, hemicellulose and lignin. As a widely available and low-cost agricultural waste, using corn straw as biomass can reduce production costs. Using waste biomass to produce biodiesel can realize the resource utilization of waste.

[0131] It can be understood that the biomass can also be corn cob, sweet sorghum stem, reed and other waste biomass.

[0132] Optionally, step S201 inoculates the Candida tropicalis agent into the oil-producing culture medium containing the biomass, and adds cellulase and xylanase for simultaneous saccharification and fermentation culture. The temperature of the simultaneous saccharification and fermentation culture is 43-45°C.

[0133] The temperature range of 43-45°C is a high temperature range suitable for enzymatic reaction, and at the same time, the growth of the Candida tropicalis SDU2 strain can tolerate the high temperature of 43-45°C. At this temperature range, on the one hand, the activity of cellulase and xylanase can be better exerted, which accelerates the saccharification rate of the biomass and improves the efficiency of substrate conversion to fermentable sugar. On the other hand, the Candida tropicalis SDU2 strain has good growth and metabolic capacity in the temperature range of 43-45°C, which can synthesize oil by using the saccharide produced by saccharification, thereby realizing the synergistic effect of simultaneous saccharification and fermentation. Compared with traditional low-temperature fermentation, this temperature setting improves the fermentation rate and substrate utilization rate to a certain extent, shortens the production cycle, and is conducive to improving the production efficiency of biodiesel, making the production process more suitable for the needs of industrial scale production.

[0134] Optionally, in step S201, the tropical yeast inoculum is inoculated into an oil-producing medium containing biomass, and cellulase and xylanase are added to perform simultaneous saccharification and fermentation culture. The oil-producing medium includes: K2HPO4 1-5 g / L, Na2HPO4·7H2O 1-5 g / L, MgSO4·7H2O 0.1-0.5 g / L, EDTA 0.1-0.3 g / L, Tween 80 1-5 mL / L, (NH4)2SO4 0.5-1 g / L, CaCl2 0.005-0.02 g / L, and CuSO4·5H2O 0.005-0.03 g / L.

[0135] Optionally, in step S201, the tropical yeast inoculum is inoculated into an oil-producing medium containing biomass, and cellulase and xylanase are added to simultaneously perform saccharification and fermentation culture. The oil-producing medium includes: K2HPO4 2.7 g / L, Na2HPO4·7H2O 2.4 g / L, MgSO4·7H2O 0.2 g / L, EDTA 0.1 g / L, Tween 80 2.0 mL / L, (NH4)2SO4 0.5 g / L, CaCl2 0.01 g / L, and CuSO4·5H2O 0.015 g / L.

[0136] The disclosed embodiment uses CaCl2 and CuSO4·5H2O as the activating ions of the enzyme, Ca 2+ and Cu 2+ It can significantly improve the catalytic activity of cellulase and xylanase, effectively enhance the catalytic efficiency of enzymes, and thus promote the decomposition of biomass into fermentable sugars.

[0137] The following specific examples are provided to illustrate the Candida tropicalis strains, bacterial agents, preparation methods, and applications of the disclosed embodiments, to more clearly illustrate the technical problems, technical solutions, and beneficial effects addressed by the present application. It should be understood that the described embodiments are merely a portion of the embodiments of the present application, and are not intended to be exhaustive. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present application and its applications.

[0138] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. All reagents or instruments used without specifying the manufacturer are commercially available conventional products.

[0139] Example 1 Breeding of Candida tropicalis SDU2 strain

[0140] The breeding method of the Candida tropicalis SDU2 strain of this Example 1 comprises the following steps:

[0141] 10 mL of sludge from a sewage treatment plant was inoculated into 150 mL of enrichment culture medium, and penicillin was added at a final concentration of 100 mg / L. The culture was carried out in a shake flask at a culture temperature of 40°C and a shaker speed of 180 rpm for 48 hours to obtain an enrichment culture.

[0142] The enrichment culture was transferred to a fresh sterile enrichment medium at a 10% inoculum volume, and the culture was repeated 5 times under the same culture conditions as above to obtain a subcultured bacterial solution.

[0143] Use sterile saline to dilute the culture solution into 10 -3 , 10 -4 , 10 -5 100 μL of each bacterial suspension with gradient concentrations was spread on a commercial solid potato dextrose agar medium (PDA medium) and cultured at 40° C. until colonies appeared.

[0144] Single colonies were purified for five generations using the streak separation method, and the morphology of the colonies and bacteria was observed.

[0145] The enrichment medium includes: (NH4)2SO4 2.5g / L, KCl 0.1g / L, K2HPO4 1.0g / L, MgSO4·7H2O 1.0g / L, Ca(NO3)2 0.2g / L, glucose 1.0g / L and yeast powder 1.0g / L.

[0146] 1.1 Morphological characteristics of the strain

[0147] The morphological characteristics of the purified strain on solid YPD medium are as follows:

[0148] Colony characteristics: regular round, milky white, convex, smooth and shiny surface, sticky, with neat edges;

[0149] Cell morphology: cells are oval (see Figure 3 ).

[0150] The above morphological characteristics are consistent with the typical cell morphological characteristics of Candida.

[0151] The solid YPD culture medium includes 20 g / L glucose, 10 g / L yeast powder, 20 g / L peptone and 12 g / L agar powder.

[0152] 1.2 Molecular biological identification of strains

[0153] The internal transcribed spacer (ITS) gene sequence of a single colony was identified, and amplification and sequencing were completed by Beijing Qingke Biotechnology Co., Ltd. The primers were ITS1F (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4R

[0154] (5'-TCCTCCGCTTATTGATATGC-3').

[0155] The ITS gene sequence was compared and analyzed in the National Center for Biotechnology Information (NCBI) database, and the strain was identified as Candida tropicalis.

[0156] Example 2 Environmental Adaptability of Candida tropicalis SDU2 Strain

[0157] 2.1 Temperature tolerance of Candida tropicalis SDU2 strain

[0158] The method for determining the temperature tolerance of the Candida tropicalis SDU2 strain of this embodiment comprises the following steps:

[0159] Two single colonies were picked from a solid YPD medium coated with the Candida tropicalis SDU2 strain, inoculated into 20 mL of liquid YPD medium, and cultured in a shake flask at 35°C and 180 rpm for 18 h to obtain a bacterial suspension;

[0160] Take 10 mL of the above bacterial solution and centrifuge it at 20°C and 8000 rpm for 5 min. Discard the supernatant, wash the precipitated bacteria twice with sterile saline, and then resuspend the bacteria in 10 mL of sterile saline to serve as the seed solution.

[0161] Inoculate the seed solution into fresh liquid YPD medium at a 1% inoculum volume and place in a constant temperature shaker at 25°C, 30°C, 35°C, 40°C, 45°C, and 50°C, maintaining a shaking culture at 180 rpm. Take the bacterial solution every 3 hours and measure its absorbance. Set up three parallel experiments for each sample. Draw the growth curve of the tropical yeast SDU2 strain at different growth temperatures (see Figure 4 ).

[0162] The liquid YPD culture medium includes: 20 g / L glucose, 10 g / L yeast powder, and 20 g / L peptone.

[0163] The results are as follows Figure 4As shown, the growth of the Candida tropicalis SDU2 strain exhibited similar growth conditions between 25 and 40°C. At 35°C, the bacterial suspension density of the Candida tropicalis SDU2 strain was higher than at other temperatures, with a maximum absorbance at 600 nanometers (OD600) of 5.53. At 45°C, the growth of the Candida tropicalis SDU2 strain was somewhat restricted, with a maximum OD600 of 2.61. At 50°C, the strain barely grew, but was able to survive for a period of time.

[0164] 2.2 Acid and alkali tolerance of Candida tropicalis SDU2 strain

[0165] The method for determining the acid and alkali tolerance of the Candida tropicalis SDU2 strain of this embodiment comprises the following steps:

[0166] Two single colonies were picked from a solid YPD medium coated with the Candida tropicalis SDU2 strain, inoculated into 20 mL of liquid YPD medium, and cultured in a shake flask at 35°C and 180 rpm for 18 h to obtain a bacterial suspension;

[0167] Take 10 mL of the above bacterial solution and centrifuge it at 20°C and 8000 rpm for 5 min. Discard the supernatant, wash the precipitated bacteria twice with sterile saline, and then resuspend the bacteria in 10 mL of sterile saline to serve as the seed solution.

[0168] Adjust the pH of liquid YPD medium to 1-11 using dilute sulfuric acid and sodium hydroxide. Sterilize and inoculate 35 mL of liquid YPD medium into a 100 mL Erlenmeyer flask. Incubate at 35°C, shaking at 180 rpm. Observe the medium for turbidity and measure the absorbance of the culture on days 3 and 5. The maximum incubation time is 5 days. If the medium remains clear after 5 days and the OD600 value is consistent with that of a blank medium without Candida tropicalis SDU2, the strain is considered non-growthable at this pH.

[0169] The results, as shown in Table 1, show that Candida tropicalis SDU2 grew well at pH 5-10. Its growth was somewhat inhibited at pH 2-4 and pH 11. It was unable to grow at pH 1. Therefore, Candida tropicalis SDU2 can tolerate the extremely acidic and alkaline environments of pH 2 and pH 11, respectively.

[0170] Table 1 Growth of Candida tropicalis SDU2 strain under different pH conditions

[0171] pH 1 2 3 4 5 6 7 8 9 10 11 SDU2 - + + + ++ ++ +++ +++ +++ ++ +

[0172] Note: - represents no growth, OD600 < 0.05; + represents growth, + represents OD600 = 0.1 to 0.4, ++ represents OD600 = 0.4 to 0.8, and +++ represents OD600 > 0.8.

[0173] The test results of the acid and alkali tolerance of the Candida tropicalis SDU2 strain can provide a basis for the subsequent optimization of culture conditions.

[0174] 2.3 Determination of substrate utilization ability of Candida tropicalis SDU2 strain

[0175] 2.3.1 Determination of carbon source utilization ability of Candida tropicalis SDU2 strain

[0176] The method for determining the carbon source utilization ability of the Candida tropicalis SDU2 strain of this embodiment comprises the following steps:

[0177] Two single colonies were picked from a solid YPD medium coated with the Candida tropicalis SDU2 strain, inoculated into 20 mL of liquid YPD medium, and cultured in a shake flask at 35°C and 180 rpm for 18 h to obtain a bacterial suspension;

[0178] Take 10 mL of the above bacterial solution and centrifuge it at 20°C and 8000 rpm for 5 min. Discard the supernatant, wash the precipitated bacteria twice with sterile saline, and then resuspend the bacteria in 10 mL of sterile saline to serve as the seed solution.

[0179] The following carbon sources (mass volume concentration, m / v) were added to the carbon source assimilation medium: 2% glucose (i.e., 2 g / 100 mL glucose), 2% glycerol, 2% sucrose, 2% mannitol, 2% lactose, 2% maltose, 2% fructose, 2% ethanol, 2% chitosan, and 0.5% polyethylene glycol, and 1% seed liquid was inoculated. The culture was shaken at a culture temperature of 35°C and a rotation speed of 180 rpm for 36 h, and the culture medium was observed to see whether it was turbid.

[0180] The inoculation of 1% seed liquid refers to the ratio of the volume of the inoculated seed liquid to the volume of the carbon source assimilation culture medium (volume ratio, v / v), that is, 1 mL of seed liquid is inoculated into every 100 mL of culture medium.

[0181] The carbon source assimilation medium includes: (NH4)2SO4 5.0 g / L, KH2PO4 1.0 g / L, MgSO4·7H2O0.5 g / L, CaCl2·2H2O 0.1 g / L and yeast powder 0.2 g / L.

[0182] The results are shown in Table 2. The Candida tropicalis SDU2 strain can utilize most organic matter for heterotrophic growth, but cannot utilize carbon sources such as lactose and some polysaccharides, such as chitosan and polyethylene glycol.

[0183] Table 2 Carbon source utilization of Candida tropicalis SDU2 strain

[0184]

[0185] Note: + represents that the carbon source can be utilized, - represents that the carbon source cannot be utilized.

[0186] 2.3.2 Determination of nitrogen source utilization ability of Candida tropicalis SDU2 strain

[0187] The method for determining the nitrogen source utilization ability of the Candida tropicalis SDU2 strain of this embodiment comprises the following steps:

[0188] Two single colonies were picked from a solid YPD medium coated with the Candida tropicalis SDU2 strain, inoculated into 20 mL of liquid YPD medium, and cultured in a shake flask at 35°C and 180 rpm for 18 h to obtain a bacterial suspension;

[0189] Take 10 mL of the above bacterial solution and centrifuge it at 20°C and 8000 rpm for 5 min. Discard the supernatant, wash the precipitated bacteria twice with sterile saline, and then resuspend the bacteria in 10 mL of sterile saline to serve as the seed solution.

[0190] The following nitrogen sources (mass volume concentration, m / v) were added to the nitrogen assimilation medium: 2% urea (i.e., 2 g / 100 mL urea), 2% glycine, 2% glutamic acid, and 2% potassium nitrate, and 1% seed liquid was inoculated. The culture was shaken at a temperature of 35°C and a rotation speed of 180 rpm for 36 h, and the culture medium was observed to see whether it was turbid.

[0191] The nitrogen assimilation medium includes: glucose 10 g / L, KH2PO4 1.0 g / L, MgSO4·7H2O 0.5 g / L, and yeast powder 0.2 g / L.

[0192] The results are shown in Table 3. The Candida tropicalis SDU2 strain can grow using amino acid nitrogen sources such as glycine and glutamic acid, as well as potassium nitrate and ammonia, but cannot use urea.

[0193] Table 3 Nitrogen source utilization of Candida tropicalis SDU2 strain

[0194] urea Glycine glutamate potassium nitrate ammonium sulfate ammonia SDU2 - + + + + +

[0195] Note: + represents that the nitrogen source can be utilized, - represents that the nitrogen source cannot be utilized.

[0196] Example 3 Preparation of Candida tropicalis SDU2 inoculum using liquid YPD medium

[0197] The preparation method of the Candida tropicalis SDU2 bacterial agent of this embodiment 3 comprises the following steps:

[0198] The preserved strain of Candida tropicalis SDU2 was inoculated on a solid YPD medium, placed in a biochemical incubator, and incubated at a culture temperature of 35° C. for 24 h.

[0199] Under a strictly sterile environment, two single colonies were transferred to liquid YPD medium and cultured with shaking at a culture temperature of 35° C. for 18 h to obtain seed liquid.

[0200] The seed solution was inoculated at a 2% inoculum into a fermenter containing the second liquid culture medium. The culture was maintained at a temperature of 35°C, a ventilation rate of 1.2-1.5 vvm, a tank pressure of 0.04-0.07 MPa, and a rotation speed of 500-750 rpm. The cells were counted after 24 hours of culture. The pH of the culture was not controlled.

[0201] After fermentation, the fermentation broth of Candida tropicalis SDU2 was obtained, and the number of viable bacteria in the fermentation broth was determined using a non-consumable cell counter (Halocounter HD-4, Gaofen (Beijing) Biotechnology Co., Ltd.). The results showed that the number of viable bacteria was 1.14×10 10 pieces / mL.

[0202] The second liquid culture medium is liquid YPD culture medium, comprising: 20 g / L glucose, 10 g / L yeast powder and 20 g / L peptone.

[0203] The 2% inoculation amount refers to the ratio of the volume of the seed liquid to the volume of the second liquid culture medium (volume ratio, v / v), that is, 2 mL of seed liquid is inoculated into every 100 mL of culture medium.

[0204] In Example 3, liquid YPD medium was used, and the pH value of the liquid YPD medium was not adjusted. In Example 3, the viable count of Candida tropicalis SDU2 was 1.98×10 9 pieces / mL.

[0205] Example 4 Preparation of Candida tropicalis SDU2 bacterial agent

[0206] The preparation method of the Candida tropicalis SDU2 bacterial agent of this embodiment 4 comprises the following steps:

[0207] The preserved strain of Candida tropicalis SDU2 was inoculated on a solid YPD medium, placed in a biochemical incubator, and incubated at a culture temperature of 35° C. for 24 h.

[0208] Under a strictly sterile environment, two single colonies were transferred to liquid YPD medium and cultured with shaking at a culture temperature of 35° C. for 18 h to obtain seed liquid.

[0209] The seed solution was inoculated at a 2% inoculum into a fermenter containing the second liquid culture medium. The culture was maintained at a temperature of 35°C, a ventilation rate of 1.2-1.5 vvm, a tank pressure of 0.04-0.07 MPa, and a rotation speed of 500-750 rpm. The cells were counted after 24 hours of culture. The pH of the culture was not controlled.

[0210] After fermentation, the fermentation broth of Candida tropicalis SDU2 was obtained, and the number of viable bacteria in the fermentation broth was determined using a non-consumable cell counter (Halocounter HD-4, Gaofen (Beijing) Biotechnology Co., Ltd.). The results showed that the number of viable bacteria was 1.14×10 10 pieces / mL.

[0211] The second liquid culture medium comprises 25 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, and 1.5 g / L ammonium sulfate, and after sterilization, the pH is adjusted to 8.0 using aqueous ammonia. The second liquid culture medium is a modified liquid YPD medium.

[0212] The 2% inoculation amount refers to the ratio of the volume of the seed liquid to the volume of the second liquid culture medium (volume ratio, v / v), that is, 2 mL of seed liquid is inoculated into every 100 mL of culture medium.

[0213] Compared to the liquid YPD medium in Example 3, the second liquid medium in Example 4 contains increased concentrations of glucose, a carbon source, and ammonium sulfate, a nitrogen source. This increases nutrient concentration and thus the cell count of the strain. Because the preparation process of the Candida tropicalis SDU2 inoculum produces acid, and the Candida tropicalis SDU2 strain grows better in an alkaline environment, the second liquid medium in Example 4 uses aqueous ammonia to adjust the initial medium pH to 8.0.

[0214] It has been determined that the tropical Candida SDU2 strain can reach a stable period after one day of cultivation, and the number of viable tropical Candida SDU2 cells in the liquid inoculum can reach 10 10 / mL, with the advantages of fast growth rate and high density.

[0215] Example 5: Fermentation of corn straw with Candida tropicalis SDU2 to produce biodiesel

[0216] The method for producing biodiesel by fermenting corn straw with the Candida tropicalis SDU2 inoculum of Example 5 comprises the following steps:

[0217] The prepared Candida tropicalis SDU2 liquid inoculum was inoculated into the oil-producing medium containing 10% (w / v, g / L) of commercially available corn stalk powder at a seeding amount of 5% (volume ratio, v / v).

[0218] Three groups of gradient experiments were set up, and 3FPU / g, 9FPU / g and 12FPU / g of cellulase were added to the above oil-producing medium based on the mass of corn stalk powder, while 40U / g of xylanase was fixedly added. The oil-producing yeast cell fermentation liquor was obtained by shaking culture at a culture temperature of 44℃ and a rotation speed of 220rpm for 72h.

[0219] The oil-producing yeast cell fermentation liquor was centrifuged at a rotation speed of 8000rpm for 5min, and the supernatant was discarded. The precipitated cell bodies were placed in a constant temperature drying oven at 105℃ for drying for 24h.

[0220] The dried cell bodies were heated and extracted with chloroform:methanol (1:1, v:v) at 95℃ for 1h, and then were placed on a rotary evaporator to remove the organic solvent. The remaining material was dried at 60℃ for 24h to constant weight, and the oil yield was calculated (see Table 4).

[0221] The oil-producing medium includes K2HPO4 2.7g / L, Na2HPO4·7H2O 2.4g / L, MgSO4·7H2O 0.2g / L, EDTA 0.1g / L, Tween 80 2.0mL / L, (NH4)2SO4 0.5g / L, CaCl2 0.01g / L and CuSO4·5H2O 0.015g / L.

[0222] The results show that when the addition amounts of cellulase and xylanase are 12FPU and 40U respectively, the biodiesel yield of the Candida tropicalis SDU2 inoculum is the highest after 72h of fermentation, and the oil yield is 10.97±0.21g / L.

[0223] Table 4 Influence of cellulase and xylanase addition amounts on lipid yield

[0224] Cellulase ( / g corn straw) Xylanase addition amount ( / g corn straw) Oil yield (g / L) 3FPU 40U 8.85±0.12 9FPU 40U 10.63±0.17 12FPU 40U 10.97±0.21

[0225] Each technical feature of the above-described embodiments can be combined arbitrarily. In order to make the description simple, all possible combinations of each technical feature in the above-described embodiments are not described, however, as long as the combinations of the technical features do not exist contradictory, it should be considered as the scope of the present disclosure.

[0226] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.

Claims

1. A Candida tropicalis strain, characterized in that The tropical Candida strain is the tropical Candida SDU2 strain, classified and named Candida tropicalis, with a preservation number of CGMCC No. 34306 and a preservation date of April 23, 2025. The preservation unit is the General Microbiology Center of the China Culture Collection Administration.

2. The Candida tropicalis strain according to claim 1, characterized in that The ITS gene sequence of Candida tropicalis SDU2 strain is shown in SEQ ID NO:

1.

3. The Candida tropicalis strain according to claim 1, characterized in that The growth environment temperature of the Candida tropicalis SDU2 strain is 25 to 45° C.; and / or, The pH value of the growth environment of Candida tropicalis SDU2 strain is 2 to 11; and / or, The Candida tropicalis SDU2 strain is capable of utilizing one or more of glucose, glycerol, sucrose, mannitol, maltose, fructose and ethanol as a carbon source; and / or, The Candida tropicalis SDU2 strain is capable of utilizing one or more of glycine, glutamate, potassium nitrate and ammonia as a nitrogen source; and / or, The Candida tropicalis SDU2 strain has the ability to produce oil.

4. A tropical Candida agent, characterized in that The tropical Candida agent is prepared by fermenting and culturing the tropical Candida SDU2 strain according to any one of claims 1 to 3.

5. A method for preparing a Candida tropicalis agent, characterized in that: include: inoculating the Candida tropicalis SDU2 strain according to any one of claims 1 to 3 into a solid culture medium and incubating the culture medium to obtain a single colony; Transferring a single colony to the first liquid culture medium for cultivation to obtain a seed solution; The seed liquid is inoculated into the second liquid culture medium for cultivation to obtain a fermentation liquid.

6. The preparation method according to claim 5, characterized in that The second liquid culture medium comprises: 22-28 g / L glucose, 9-11 g / L yeast powder, 18-22 g / L peptone, and 1.3-1.7 g / L ammonium sulfate; Optionally, the second liquid culture medium comprises: 25 g / L glucose, 10 g / L yeast powder, 20 g / L peptone and 1.5 g / L ammonium sulfate; The second liquid culture medium uses ammonia water to adjust the initial pH to 7-8.5; Optionally, the second liquid culture medium is adjusted to an initial pH of 8 using aqueous ammonia.

7. The preparation method according to claim 5, characterized in that The step of inoculating the Candida tropicalis SDU2 strain into a solid culture medium for incubation comprises: inoculating the Candida tropicalis SDU2 strain into a solid YPD culture medium and culturing at a culture temperature of 35° C.; and / or, The step of transferring the single colony to the first liquid culture medium for cultivation comprises: transferring multiple single colonies to the first liquid culture medium, and culturing with shaking at a culture temperature of 35° C., wherein the first liquid culture medium is a liquid YPD culture medium; and / or, The step of inoculating the seed liquid into the second liquid culture medium for cultivation includes: inoculating the seed liquid into a fermentation tank filled with the second liquid culture medium, and cultivating under the conditions of a culture temperature of 35°C, a ventilation volume of 1.2-1.5vvm, a tank pressure of 0.04-0.07Mpa, and a rotation speed of 500-750rpm.

8. Use of the Candida tropicalis agent according to claim 4 in the production of biodiesel from fermented biomass; or use of the Candida tropicalis agent prepared by the method for preparing the Candida tropicalis agent according to any one of claims 5 to 7 in the production of biodiesel from fermented biomass.

9. A method for producing biodiesel by fermenting biomass with Candida tropicalis, characterized in that: include: The method comprises inoculating a tropical Candida agent into an oil-producing culture medium containing biomass, adding cellulase and xylanase, and simultaneously saccharifying and fermenting the culture to obtain an oil-producing yeast fermentation liquid; wherein the tropical Candida agent is the tropical Candida agent according to claim 4 or the tropical Candida agent prepared by the preparation method of any one of claims 5 to 7; Centrifuge the fermentation liquid of the oil-producing yeast to discard the supernatant, obtain the yeast cells, and dry them to obtain dried yeast cells; The dried bacteria are heated and extracted with an organic solvent, the organic solvent is evaporated to remove it, and the remaining material is dried to obtain oil.

10. The method according to claim 9, characterized in that Inoculating a tropical yeast strain into an oil-producing medium containing biomass, and adding cellulase and xylanase, in the step of simultaneous saccharification and fermentation culture, the inoculation amount of the tropical yeast strain is 2-10%; and / or, the amount of the cellulase is 3-15 FPU / g biomass; and / or, the amount of the xylanase is 30-40 U / g biomass; and / or, the content of the biomass in the oil-producing medium is 5-10%; Optionally, the inoculation amount of the Candida tropicalis agent is 5%; and / or the amount of cellulase used is 12 FPU / g biomass; and / or the amount of xylanase used is 40 U / g biomass; and / or the biomass content in the oil-producing culture medium is 10%.

11. The method according to claim 9, characterized in that The temperature of simultaneous saccharification and fermentation culture is 43-45°C.

12. The method according to claim 9, characterized in that The oil-producing culture medium comprises: K2HPO4 1-5 g / L, Na2HPO4·7H2O 1-5 g / L, MgSO4·7H2O 0.1-0.5 g / L, EDTA 0.1-0.3 g / L, Tween 80 1-5 mL / L, (NH4)2SO4 0.5-1 g / L, CaCl2 0.005-0.02 g / L and CuSO4·5H2O 0.005-0.03 g / L; or, The oil-producing medium includes: K2HPO4 2.7 g / L, Na2HPO4·7H2O 2.4 g / L, MgSO4·7H2O 0.2 g / L, EDTA 0.1 g / L, Tween 80 2.0 mL / L, (NH4)2SO4 0.5 g / L, CaCl2 0.01 g / L and CuSO4·5H2O 0.015 g / L.

Images