Dual ERA-LFD kit and primer combination for visually and rapidly detecting salmonella typhimurium or single-phase variants thereof and application of dual ERA-LFD kit and primer combination

Abstract

The invention relates to a dual ERA-LFD kit for visually and rapidly detecting salmonella typhimurium or a single-phase variant thereof, a primer group and application of the dual ERA-LFD kit and the primer group, and aims at solving the problems that an existing detection method is complex in operation, long in time consumption and depends on professional equipment, and primer cross interference, high false positive rate and incapability of distinguishing the single-phase variant caused by the fact that dual ERA primer design is not standard. Screening to obtain a specific primer probe combination aiming at the fljB gene deletion region and the STM4495 gene; a dual ERA-LFD detection system is constructed, and double targets are synchronously amplified under a constant temperature condition; visual interpretation is realized through a double-detection-line color development mode of the transverse flow test strip. The detection specificity can be remarkably improved, and false positive is effectively avoided; the accurate distinguishing between the salmonella typhimurium and the single-phase variants is realized; the detection process is rapid and simple, does not need professional instruments and personnel, and is suitable for on-site rapid screening; the detection cost is obviously reduced and the basic application feasibility is improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biological detection, in particular to an ERA-LFD kit for visual rapid detection of Salmonella typhimurium or its monophasic variant, a primer combination and application thereof. BACKGROUND

[0002] Salmonella typhimurium is one of the main pathogens of foodborne diseases, and its monophasic variant Salmonella 4, 5, 12:i:- (hereinafter referred to as "monophasic variant") is caused by the deletion of flagellar synthesis gene cluster (such as Salmonella fliC) and leads to the defect of phase II flagellum expression. In recent years, the monophasic variant has become the main serotype of human clinical infection, food animals and pork product contamination, especially in pig populations (such as the infection rate of sick pigs in Henan area is outstanding), which seriously threatens the economic and public health safety of the breeding industry. flj At present, the detection methods of Salmonella typhimurium and its monophasic variant mainly include conventional serological typing detection and molecular biological detection methods such as polymerase chain reaction (PCR method), fluorescent quantitative PCR method and RT-RPA method, but the existing detection technologies also have significant defects: ① Serological typing method: relying on antigen-antibody reaction, the operation is complicated, time-consuming (24-72h), labor cost is high, and multiple valence antisera need to be prepared; ② Molecular detection method (such as PCR, fluorescent quantitative PCR, RT-RPA): although the sensitivity is high, it needs professional technicians, precise instruments (such as thermal cycler) and strict laboratory environment, which cannot meet the needs of on-site rapid screening.

[0003] Recombinase polymerase amplification (RPA) and its improved technology-enzymatic recombinase amplification (ERA) have become an ideal choice for on-site detection because they can complete nucleic acid amplification in 15-30 minutes at room temperature (37-40℃) and tolerate complex sample matrix. However, the core bottleneck of ERA technology is primer design: at present, there is a lack of special primer design software, mature principles or data support for Salmonella typhimurium and monophasic variant, which leads to the difficulty in screening specific primers and restricts the clinical application of the technology.

[0004] The information disclosed in this section is only used to deepen the understanding of the background of the present disclosure, and should not be regarded as acknowledging or implying in any form that this information constitutes prior art known to those skilled in the art.

[0005] SUMMARY

[0006] ​The present invention provides an ERA-LFD kit, primer combination and application thereof for visually and rapidly detecting Salmonella typhimurium or its monophasic variants, aiming to solve the technical problems of primer cross-interference, high false positive rate and inability to perform on-site double detection caused by the lack of a standard basis for the design of dual ERA primers for Salmonella typhimurium or its monophasic variants.

[0007] In view of at least one of the above technical problems, the present disclosure provides a dual ERA-LFD primer set for detecting Salmonella typhimurium or its monophasic variants, which consists of the following primers: against fljB1, 2 genes, H2s-F2:TGACGCAGATAATAACAAGTACTTTGTTAC, H2s-R1: AGCATCTGCTGAAACAACTGCCGGTGTATC; against STM 4495 genes, 4495s-F2:GCCTCAGTACCATATCCAGAAATTGAAGATG, 4495s-R2: GGAGAAGGTTTTCGACTAACTTGATATTTG.

[0008] According to another aspect of the present disclosure, a probe set matching the above-mentioned dual ERA-LFD primer set is provided, comprising: H2s-probe:[5'FAM]-CGATTATGAAGTTAACGTTGCTACTGACGGTA[THF]AGTAACCCTTGCGGCTG-[3'C3spacer]; 4495s-probe: [5'Dig]-GACTGGGACTCTCAAGAGCAATCATGGGAT[THF]ATGTTTGTTC ACCATTG-[3'C3spacer].

[0009] According to a third aspect of the present disclosure, an amplification system for detecting Salmonella typhimurium or a monophasic variant thereof based on ERA-LFD is provided, comprising 1 μL of the upstream primer and the downstream primer at a concentration of 2 μM, 0.3 μL of each probe at a concentration of 2 μM, 5 μL of the template, 20 μL of a dissolving agent derived from a test paper-type nucleic acid amplification kit, 2 μL of an activator, and the balance dd H2O, with a total volume of 50 μL.

[0010] According to a third aspect of the present disclosure, the dual ERA-LFD primer set, the probe set or the amplification system is applied to at least one of the following (1) to (4): (1) non-disease diagnosis and treatment purposes Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - type or identification, or preparation of Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - type or identification reagent; (2) screening Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - food contamination, or preparation of screening Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - food contamination reagent; (3) preparation of foodborne diseases associated with Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - detection reagent; (4) preparation of rapid screening of Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - herd infection source reagent.

[0011] According to the fourth aspect of the present disclosure, an ERA-LFD detection kit is provided, which contains the double ERA-LFD primer set and the probe set.

[0012] According to the fifth aspect of the present disclosure, the ERA-LFD detection kit is applied in at least one of the following (1) ~ (2): (1) non-disease diagnosis and treatment purposes Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - type or identification; (2) screening Salmonella typhimurium or / and Salmonella 4, [5], 12: i: - food contamination.

[0013] The present application achieves the following hierarchical technical effects by screening specific primer probe combination and constructing double ERA-LFD system: 1. Breakthrough in basic detection performance: solve the problem of double primer design ① Significant increase in specificity: based on the characteristics of double target gene region, the parameters of primer length, secondary structure risk, GC content and product size are combined to establish a high-specificity primer combination, which overcomes the problem of primer cross interference in double detection, and the double target synchronous precise identification distinguishes Salmonella typhimurium, monophasic variant and other Salmonella serotypes, which is consistent with the results of double PCR and serological typing with more than 90%.

[0014] ② Breakthrough in sensitivity The minimum detection limit is: Salmonella typhimurium 615 CFU / 0.1 mL; monophasic variant 165 CFU / 0.1 mL; significantly better than traditional isolation and identification method and double PCR.

[0015] 2. Breakthrough in field application ① Fast and efficient: The entire process of amplification and detection takes only 15 to 20 minutes, which is significantly faster than serological typing (24 to 72 hours) and PCR (2 to 3 hours).

[0016] ② Low dependence on equipment and personnel: No precision instruments such as thermal cyclers and fluorescence detection equipment are required. Non-professionals can operate it after simple training, breaking through the limitations of the laboratory environment.

[0017] ③ Intuitive and visual results: Read the results directly through the LFD test strips, avoiding complicated product analysis processes.

[0018] 3. Significant application benefits ① Strong adaptability to grassroots scenarios: Applicable to on-site environments such as farms, slaughtering lines, and commercial pork, it can achieve: rapid screening of infection sources in pig herds, reducing the risk of disease transmission and economic losses; real-time monitoring of food contamination, and blocking the transmission chain of foodborne diseases.

[0019] ② Outstanding comprehensive cost advantages: compared with serological typing, it saves more than 80% of reagent and labor costs, and compared with the PCR method, it eliminates equipment investment and reduces the cost of a single test by 60%.

[0020] ③Technical compatibility and reliability: Clinical verification shows that its detection rate and consistency in pig diarrhea feces and fresh pork samples are better than traditional separation and identification methods and double PCR, providing a reliable alternative for serological typing. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 In one embodiment of this application, fljB1,2 Gene, primer screening test for single-plex ERA-LFD; A: chromogenic results of 9 primer combinations amplified using deionized double-distilled water as the negative template; B: chromogenic results of 9 primer combinations amplified using Salmonella typhimurium (12-17) DNA as the template; 1-9: F1+R1, F1+R2, F1+R3, F2+R1, F2+R2, F2+R3, F3+R1, F3+R2, F3+R3; C: quality control line; T: test line (fljB1,2) .

[0022] Figure 2 In one embodiment of this application, STM 4495 genes, primer screening test for dual ERA-LFD; A: chromogenic results of 9 primer combinations amplified using deionized double-distilled water as negative template; B: chromogenic results of F2+R2 primer combination amplified using Salmonella typhimurium (12-17) DNA as template; 1-9: F1+R1, F1+R2, F1+R3, F2+R1, F2+R2, F2+R3, F3+R1, F3+R2, F3+R3; C: quality control line; T1: test line ( fj 1,2); T2: detection line ( STM 4495).

[0023] Figure 3 The results of ERA-LFD reaction detection of Typhimurium and its monophasic variants in one embodiment of the present application are shown in FIG. 1-3: negative control, Salmonella 4,[5],12:i:-(HN1-1), Salmonella typhimurium (HN12-17); C: quality control line; T1: detection line ( fj 1,2); T2: detection line ( STM 4495).

[0024] Figure 4 The specific test results of an embodiment of the present application; wherein, 1: Salmonella typhimurium (12-7); 2-8: Escherichia coli, Staphylococcus aureus, Streptococcus, Haemophilus parasuis, Pasteurella, Aeromonas, Bergey's; C: quality control line; T1: test line ( fj 1,2); T2: detection line ( STM 4495).

[0025] Figure 5 The sensitivity test results in one embodiment of the present application; wherein, A: Salmonella typhimurium sensitivity test; B: Salmonella 4, [5], 12: i: - sensitivity test; C: quality control line; T1: detection line ( fljB1,2 ); T2: detection line ( STM 4495). DETAILED DESCRIPTION

[0026] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below with reference to the accompanying drawings and specific implementation methods.

[0027] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; the biochemical reagents and raw materials involved are all commercially available conventional products unless otherwise specified; the tests and detection methods involved are all conventional methods unless otherwise specified.

[0028] Example 1: Target selection and specific detection primer screening 1. Probe and Primer Design and Synthesis The key to ERA amplification lies in the design of primers. However, ERA is different from conventional PCR reactions. Currently, there is no software or mature design principles for primer design, nor is there a large amount of data to provide a basis for primer design, and there is no mature experience to follow. fj and STMThere are no mature principles for the design of primers and probes for the 4495 gene. There are many impurities in clinical samples, and the mutual interference between primers, probes and bacterial DNA genomes may affect the sensitivity and specificity of amplification, resulting in: false positives caused by primer cross-interference during double detection; there is uncertainty in simultaneously distinguishing Salmonella typhimurium and monophasic variants in clinical infection sources through single-tube reactions.

[0029] Based on long-term practical research, this case is based on the genomic DNA sequence of Salmonella typhimurium LT2 strain (AE006468.2) published in GenBank. STM 4495 genes, fj 1,2 genes) were analyzed for secondary structure. Primer sequences were carefully considered to avoid palindromes, internal secondary structures, and consecutive base repeats (single nucleotide repeat length not exceeding 5 bases). The probe sequence was first determined (the probe sequence did not overlap with the specific primer recognition site and the sequence avoided palindromes, internal secondary structures, and consecutive base repeats). Candidate primers were then selected within the 100-200 bp upstream and downstream regions. For each target gene, one probe and three pairs of upstream and downstream primers were designed and optimized (Table 1). One probe was modified with a FAM tag at its 5' end, with any base approximately 30 nt from the 5' end replaced with a dSpacer (tetrahydrofuran, THF), and a 3' end labeled with a blocking group (3-block, C3 spacer). The other probe was modified with a Dig tag, with any base approximately 30 nt from the 5' end replaced with a dSpacer (tetrahydrofuran, THF), and a 3' end labeled with a blocking group (3-block, C3 spacer). Primers and probes were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0030] Therefore, the probe and candidate primer are located at STM4495 A 331bp fragment in the gene (corresponding to the AE006468.2 genomic locus: 4744121bp-4744451bp), fljB1,2 The 308bp fragment in the gene (corresponding to the AE006468.2 genomic site: 2913807bp-2914114bp) is located in the region.

[0031] Table 1 Probe and candidate primer sequences .

[0032] 2. DNA Extraction For each test bacteria, bacterial DNA was extracted using the boiling method. The specific procedure was as follows: First, a single, well-grown, purified colony was selected and inoculated into 3 mL of broth medium suitable for growth, incubated overnight at 37°C. Second, 1 mL of the culture was aspirated and centrifuged at 12,000 rpm for 1 minute. The supernatant was discarded, 200 μL of deionized water was added, and after vortexing, the culture was placed in boiling water for 10 minutes and then placed on ice for 5 minutes. Third, the culture was centrifuged at 12,000 rpm for 1 minute. 120 μL of the supernatant was collected as the extracted bacterial DNA and stored at -20°C until further use.

[0033] For the bacterial DNA used in the sensitivity test of the established method, a bacterial DNA extraction kit was used. First, 1 mL of culture solution cultured overnight at 37°C was aspirated, and then the bacterial DNA was extracted according to the operating steps required by the instructions.

[0034] For bacterial DNA extraction from artificially contaminated or naturally infected samples, prepare 1 mL of sample enrichment medium and centrifuge at 10,000 rpm for 5 minutes. Carefully discard the supernatant and add 300 μL of 6% (w / v) Chelex 100. Resuspend the suspension and incubate in a constant-temperature water bath at 56°C for 15–20 minutes. After mixing, boil the suspension in boiling water (100°C) for 8 minutes. Place the suspension on ice, cool for 5 minutes, and centrifuge at 14,000 × g for 5 minutes. Collect 200 μL of the supernatant for DNA extraction and freeze at -20°C until needed.

[0035] 3. Establishment of isothermal amplification system and determination of specific primer sets According to the instructions of the test strip-based nucleic acid amplification (ERA) kit (Suzhou Xianda Gene Technology Co., Ltd., 24T / 96T, Cat. No. KS105), the reaction system was prepared based on a total volume of 50 μL, with appropriate adjustments to the amounts of primers and probe. The final amplification system was as follows: 1 μL each of the upstream primer (2 μM), the downstream primer (2 μM), 0.3 μL of the probe (2 μM), 5 μL of the template, 20 μL of the solvent, and the balance of dd HO and 2 μL of the activator. The reaction conditions were constant temperature amplification at 39°C for 20 min.

[0036] against fljB1,2 Gene, upstream primers F1 to F3, downstream primers R1 to R3, cross-pairing the upstream and downstream primers, all with the same probe H2s-probe, a total of 9 combinations of amplification reactions, were used for primer screening experiments using the single-plex ERA-LFD method. The results showed that when deionized double-distilled water was used as the negative template, the 9 combinations of ERA amplification reaction products only showed color on the quality control line on the single-plex lateral flow test strip, and did not show color on the test line ( Figure 1A) when Salmonella typhimurium (12-17) DNA as template, in single transverse lateral flow test strip in the quality control line on the color, and in the detection line with F1 + R2, F1 + R3, F2 + R1, F3 + R3 four primer combination amplification color most obvious (A) Figure 1 B), but the F2 + R1 primer combination amplification product fragment length is the shortest (the highest amplification efficiency); therefore, for fljB1,2 gene, F2 + R1 primer combination in specificity (negative control no false positive), amplification efficiency (detection line color intensity) and product length (211 bp) on the comprehensive optimal. Amplification region AE006468.2 genome: 2913861bp- 2914071bp site (covering Salmonella typhimurium II phase flagellum key region), the size of the amplification product is 211bp.

[0037] For fljB1, 2 gene, specific primer and probe sequence: H2s-F2: TGACGCAGATAATAACAAGTACTTTGTTAC, H2s-R1: AGCATCTGCTGAAACAACTGCCGGTGTATC; H2s-probe: [5'FAM]-CGATTATGAAGTTAACGTTGCTACTGACGGTA[THF]AGTAACCCTTGCGGCTG-[3'C3spacer].

[0038] For STM 4495 gene, upstream primer F1 to F3, downstream primer R1 to R3, cross pairing of upstream and downstream primers, the same probe 4495s-probe, and the best primer pair screened for fljB1,2 gene and probe H2s-probe, also 9 kinds of combination of amplification reaction, double ERA-LFD method of primer screening test. The results show that when deionized double distilled water as negative template, 9 kinds of combination of ERA amplification reaction product, in double transverse lateral flow test strip in the quality control line on the color, and in the detection line T1 for STM4495 gene F2 + R2 primer combination amplification reaction does not show color, and other 8 kinds of primer combination amplification reaction for the gene shows red (A) Figure 2 -A), false positive results; therefore, to exclude false positive results, Salmonella typhimurium (12-17) DNA as template for ERA amplification reaction, and then combined with LFD reaction, in double transverse lateral flow test strip in the quality control line on the color, and in the detection line T1, T2 showed red (B) Figure 2 -B). Therefore, for STM For gene 4495, the primer combination F2+R2 was the only combination with no false positives (only the quality control line showed color in the negative control) and clear color in the positive samples.

[0039] The amplified region was the AE006468.2 genome: site 4744218bp-4744425bp, and the amplified product size was 208bp.

[0040] against STM 4495 genes, specific primer and probe sequences: 4495s-F2:GCCTCAGTACCATATCCAGAAATTGAAGATG, 4495s-R2:GGAGAAGTGTTTCGACTAACTTGATATTTG; 4495s-probe: [5'Dig]-GACTGGGACTCTCAAGAGCAATCATGGGAT[THF]ATGTTTGTTC ACCATTG -[3'C3spacer].

[0041] Fixed probe H2s-probe ( fj ) and 4495s-probe ( STM 4495) worked synergistically with the screening primers without nonspecific binding.

[0042] According to the instructions of the test strip type nucleic acid amplification (ERA method) kit, deionized double distilled water was used as the negative control, and the DNA of Salmonella typhimurium (HN12-17) and Salmonella 4, [5], 12: i: - (HN1-1) were used as the test samples. The best primer pairs and probes screened above were used to prepare the reaction system, and the ERA amplification reaction was performed, and then combined with the LFD reaction. The results showed that on the double horizontal lateral flow test strip, the negative control well only showed color on the quality control line, Salmonella 4, [5], 12: i: - (HN1-1) showed color on the quality control line C and the detection line T2; Salmonella typhimurium (HN12-17) showed color on the quality control line C, the detection lines T1 and T2 ( Figure 3 ), indicating that the established ERA-LFD method can accurately distinguish Salmonella typhimurium (double-target positive) from monophasic variants (only STM 4495 positive), which was consistent with the genomic characteristics.

[0043] The above experimental results show that the primer combination F2 / R1 ( fj ) and F2 / R2 ( STM4495) with a dedicated probe, under the condition of constant temperature amplification at 39℃ for 20min, it can achieve: ① Salmonella typhimurium dual color development at T1 and T2 lines; ② Single-phase variant 4,[5],12:i:- only color development at T2 line; ③ Negative samples only color development at C line.

[0044] 4. Specificity test Using DNA of Escherichia coli, Staphylococcus aureus, Streptococcus, Haemophilus parasuis, Pasteurella, Aeromonas, Bergey's and Salmonella typhimurium (12-17) as templates, the established ERA-LFD method was adopted. According to the operating steps of the test paper-based nucleic acid amplification (ERA method) kit instructions and the double horizontal lateral flow test paper (LFD) display reaction, the specificity test was carried out. The color development results showed that the test of Salmonella typhimurium (12-17) was positive, and the tests of Escherichia coli, Staphylococcus aureus, Streptococcus, Haemophilus parasuis, Pasteurella, Aeromonas and Bergey's were all negative ( Figure 4 ).

[0045] 5. Sensitivity test When the ERA-LFD sensitivity test was performed on Salmonella typhimurium (HN12-17) and Salmonella 4,[5],12:i:-(HN1-1), the two strains were first cultured overnight, and 1 mL of bacterial solution was taken from each strain to extract bacterial DNA. The extracted DNA was then diluted 10-fold (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 ), and then used them as templates for ERA-LFD reaction. At the same time, bacterial plate counts were performed on the two overnight culture solutions mentioned above. The results showed that the bacterial counts of Salmonella typhimurium (HN12-17) and Salmonella 4,[5],12:i:-(HN1-1) were 6.15×10 8 CFU / 0.1mL and 1.65×10 9 CFU / 0.1mL; when the DNA of overnight cultured Salmonella typhimurium (HN12-17) was extracted for 10 -1 ~10 -6 ERA amplification was performed during dilution, and both the detection lines T1 and T2 on the double horizontal lateral flow test strip showed color, indicating that the Salmonella typhimurium test was positive ( Figure 5 -A), the minimum detection concentration was 615 CFU / 0.1mL, while the DNA of overnight cultured Salmonella 4,[5],12:i:-(HN1-1) was extracted for 10-1 ~ 10 -7 Dilution, ERA amplification, detection line T2 of double horizontal lateral flow test strip showed color, and the detection of Salmonella 4, [5], 12:i:- was positive. Figure 5 -B), and the minimum detection concentration of bacteria solution was 165 CFU / 0.1 mL.

[0046] Example Two, Comparison of serological typing, double PCR method and ERA-LFD method for detection For the laboratory preserved Salmonella typhimurium (7 strains), Salmonella 4, [5], 12:i:- (13 strains), London Salmonella (1 strain), and Kentucky Salmonella (1 strain), a total of 22 strains of Salmonella and 1 strain of Pseudomonas aeruginosa, serological typing method, double PCR method and ERA-LFD method were used for comparison detection, and the detection results showed that London Salmonella, Kentucky Salmonella and Pseudomonas aeruginosa were detected by serological method, double PCR method and ERA-LDF method. The detection results were consistent, while 20 strains of Salmonella typhimurium and its single-phase mutant were detected by double PCR method and ERA-LFD method. The detection results were consistent, among which two strains (16-5, 21-20) were detected by serological typing, and the results of double PCR method and ERA-LFD method were different (Table 2). The coincidence rate was 90% (18 / 20), so the established ERA-LDF method for Salmonella typhimurium and its single-phase mutant can be used as a substitute method for serological typing.

[0047] Table 2 Comparison of detection results by various methods

[0048] Note: H2 represents Salmonella 2 flagellin antigen; IS 200 genes, STM 4495 genes represent genes that can be amplified by Salmonella typhimurium and its mutants; fj 1,2 genes represent genes that can be amplified by Salmonella typhimurium but not by mutants; ST represents single-phase Salmonella typhimurium mutant; ST represents Salmonella typhimurium; London represents London Salmonella; Ken represents Kentucky Salmonella; "+" represents positive; "-" represents negative.

[0049] Example Three, Detection of artificially contaminated samples Salmonella typhimurium (HN12-17) was cultured overnight to the stationary growth phase and plate counts were performed. Pork or liver samples were then artificially contaminated at three different concentration levels: 0, 1-10, and 10-100 CFU / 25g. Each artificially contaminated sample was enriched in a 225mL BPW Erlenmeyer flask. Conventional Salmonella isolation and identification procedures were performed, and 1mL of the enrichment solution was aspirated and boiled for bacterial DNA extraction and detection using the established ERA-LFD method.

[0050] The results showed that when S. typhimurium was contaminated in pork or liver samples (n=2) at a concentration of 0 CFU / 25g, the traditional Salmonella isolation and identification method tested negative for S. typhimurium. However, when tested with the ERA-LFD method, neither the test lines T1 nor T2 on the dual lateral flow test strip showed color, and only the control line C showed color, indicating that the S. typhimurium solution tested negative. When S. typhimurium was contaminated in pork or liver samples at a concentration of 1-10 CFU / 25g or 10-100 CFU / 25g, the traditional Salmonella isolation and identification method tested positive for S. typhimurium. However, when tested with the ERA-LFD method, both the control line C and the test lines T1 and T2 on the dual lateral flow test strip showed color, indicating that the S. typhimurium solution tested positive. This study showed that the detection results of artificially contaminated pork or liver samples with Salmonella typhimurium were consistent regardless of whether the traditional Salmonella isolation and identification method or the ERA-LFD method of the present invention was used (Table 3).

[0051] Table 3 Detection results of Salmonella Typhimurium in artificially contaminated pork or liver .

[0052] Example 4: Detection of clinical diseased pig samples Thirty clinical diarrhea pig feces samples were collected from a pig farm in Henan Province. They were first inoculated with BPW enrichment culture and then detected by traditional Salmonella isolation and identification method, dual PCR method and ERA-LFD method established in this study. The results showed that 9 strains of Salmonella 4,[5],12:i:- were isolated from 30 pig diarrhea feces samples by traditional Salmonella isolation and identification method, with a detection rate of 30%. However, 14 and 15 Salmonella 4,[5],12:i:- positive samples were detected from 30 pig diarrhea feces samples by dual PCR method and ERA-LFD method of this study, respectively. Therefore, the detection rates were 46.67% and 50%, respectively (Table 4).

[0053] Table 4 Clinical pig diarrhea sample test results

[0054] Note: MDH Gene, STM Gene 4495 represents a gene that can be amplified in both Typhimurium and its variants; fj 1,2 genes represent genes that are amplified by Salmonella typhimurium but not by its variants; “+” represents positive; “-” represents negative.

[0055] None of the three methods mentioned above detected Salmonella typhimurium; at the same time, when the traditional Salmonella separation and identification method detected Salmonella 4, [5], 12: i: -positive samples, the samples were also Salmonella 4, [5], 12: i: -positive when detected by the dual PCR method and the ERA-LFD method of the present invention; when the dual PCR method detected Salmonella 4, [5], 12: i: -positive samples, the samples were also Salmonella 4, [5], 12: i: -positive when detected by the ERA-LFD method established in this study. The results show that when the ERA-LFD method of the present invention detects pig diarrhea feces samples, the detection rate of Salmonella 4, [5], 12: i: - is higher than that of the dual PCR method and the traditional Salmonella separation and identification method.

[0056] Example 5: Testing of pork samples in the market

[0057] Table 5. Test results of pork samples from the market

[0058] Note: MDH Gene 、STM Gene 4495 represents a gene that can be amplified in both Typhimurium and its variants; fj 1,2 genes represent genes that are amplified by Salmonella typhimurium but not by its variants; “+” represents positive; “-” represents negative.

[0059] Twenty-five pork samples were randomly purchased from a farmer's market in Zhengzhou City. After being cultured with BPW medium, they were tested using the traditional Salmonella isolation and identification method, the dual PCR method, and the ERA-LFD method of the present invention. The results showed that when the traditional Salmonella isolation and identification method was used for detection, the Salmonella detection rate of the 25 pork samples was 0. When the dual PCR method and the ERA-LFD method of the present invention were used for detection, one Salmonella 4,[5],12:i:-positive sample was detected from each of the 25 pork samples, with a detection rate of 4% (Table 5).

[0060] Although some preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of this disclosure.

[0061] Obviously, those skilled in the art may make various changes and modifications to the present disclosure without departing from the spirit and scope of the inventive concept. Thus, if such changes and modifications to the present disclosure fall within the scope of the claims of this application and their equivalents, this application is intended to include such changes and modifications.

Claims

1. A dual ERA-LFD primer set for rapid visual detection of Salmonella typhimurium or its monophasic variants, characterized in that: It consists of the following primers: against fljB1, 2 genes, H2s-F2:TGACGCAGATAATAACAAGTACTTTGTTAC, H2s-R1: AGCATCTGCTGAAACAACTGCCGGTGTATC; against STM 4495 genes, 4495s-F2:GCCTCAGTACCATATCCAGAAATTGAAGATG, 4495s-R2: GGAGAAGGTTTTCGACTAACTTGATATTTG.

2. A probe set matching the dual ERA-LFD primer set according to claim 1, characterized in that: include: H2s- probe: [5'FAM]-CGATTATGAAGTTAACGTTGCTACTGACGGTA[THF]AGTAACCCTTGCGGCTG-[3'C3spacer]; 4495s-probe: [5'Dig]-GACTGGGACTCTCAAGAGCAATCATGGGAT[THF]ATGTTTGTTC ACCATTG-[3'C3spacer].

3. An amplification system for rapid detection of Salmonella typhimurium or its monophasic variants based on ERA-LFD, characterized in that: The total volume is 50 μL, which contains 1 μL of the upstream primer and downstream primer of claim 1 at a concentration of 2 μM, 0.3 μL of the probe of claim 2 at a concentration of 2 μM, 5 μL of template, 20 μL of solvent, 2 μL of activator, and the balance of dd H2O.

4. Use of the dual ERA-LFD primer set of claim 1, the probe set of claim 2, or the amplification system of claim 3 in at least one of the following (1) to (4): (1) Typing or identification of Salmonella typhimurium or / and Salmonella 4,[5],12:i: for non-disease diagnosis and treatment purposes, or preparation of reagents for typing or identification of Salmonella typhimurium or / and Salmonella 4,[5],12:i:; (2) Screening for contamination of food materials with Salmonella typhimurium or Salmonella 4,[5],12:i:, or preparing reagents for screening for contamination of food materials with Salmonella typhimurium or Salmonella 4,[5],12:i:; (3) Preparation of detection reagents for foodborne diseases related to Salmonella typhimurium and / or Salmonella 4,[5],12:i:-; (4) Prepare reagents for rapid screening of Salmonella typhimurium and / or Salmonella 4,[5],12:i:-infection sources in livestock herds.

5. An ERA-LFD detection kit, characterized in that: Contains the dual ERA-LFD primer set of claim 1 and the probe set of claim 2.

6. Use of the dual ERA-LFD detection kit according to claim 5 in at least one of the following (1) to (2): (1) Typing or identification of Salmonella typhimurium and / or Salmonella 4,[5],12:i: for non-disease diagnosis and treatment purposes; (2) Screening for contamination of food materials with Salmonella typhimurium and / or Salmonella 4,[5],12:i:.

Images