Primer pair for simultaneously detecting cyprinid herpesvirus II and cyprinid herpesvirus III as well as dual fluorescent quantitative PCR (polymerase chain reaction) detection method and application of primer pair

Abstract

The invention belongs to the technical field of disease prevention and control in agriculture, fishery, aquaculture and aquaculture, and particularly relates to a primer pair for simultaneously detecting cyprinid herpesviruses II and III as well as a dual fluorescent quantitative PCR (polymerase chain reaction) detection method and application of the primer pair. Primer pairs for simultaneously detecting the cyprinid herpesviruses II and III are shown as SEQ ID NO.1 and SEQ ID NO.2 as well as SEQ ID NO.7 and SEQ ID NO.8, dual fluorescent quantitative PCR detection is carried out, the cyprinid herpesviruses II and III can be simultaneously detected, and the primer pairs have the advantages of being high in specificity, high in sensitivity, good in repeatability, short in time, easy and convenient to operate, low in cost, high in specificity, high in sensitivity, high in repeatability, high in specificity, high in sensitivity, high in repeatability, high in sensitivity, high in sensitivity, high in sensitivity, high in sensitivity, high in sensitivity and high The kit provides a reliable tool for rapid differential diagnosis and epidemiological control of the cyprinid herpesvirus, and has wide application prospect and market value.

Description

Technical Field

[0001] The present invention belongs to the technical fields of agriculture, fishery, aquaculture and aquaculture disease prevention and control, and specifically relates to a dual fluorescence quantitative PCR detection kit for carp herpesvirus type II and type III, and further relates to a dual fluorescence quantitative PCR detection method for carp herpesvirus type II and type III. Background Art

[0002] Crucian carp ( Cyprinus auratus ) is an important freshwater economic fish, widely distributed in Asia and Europe (Wenet al., 2022). Cyprinus carpio var koi) are popular as ornamental fish worldwide, and carp ( Cyprinus carpio ) are widely distributed around the world because of their delicious meat, fast growth rate and strong adaptability. Their aquaculture volume ranks among the top five in the world. These three fish all belong to the Cyprinidae family in taxonomy ( Cyprinidae )(Li et al., 2022). However, with the rapid development of global aquaculture, the genus Cyprinid Herpesvirus ( Cyprinivirus ) infection poses a serious threat to the carp aquaculture industry. Cyprinid herpesvirus belongs to the Heteroherpesviridae family ( Alloherpesviridae ), with high mortality and risk of cross-species transmission (Davison et al., 2009). Cyprinid herpesvirus 2, CyHV-2) and Cyprinid herpesvirus type III ( Cyprinid herpesvirus CyHV-3 and CyHV-3 are two major pathogens in the genus Cyprinid Herpesvirus, and their natural hosts are both Cyprinidae fish (Streiff et al., 2023). Among them, CyHV-2, also known as Goldfish haematopoietic necrosis virus (GFHNV), has been prevalent in many parts of Asia, Europe, and America since its first outbreak in Japan in 1992. It is also widely distributed in crucian carp farms in eastern and central provinces of my country, with an acute infection mortality rate of up to 100% (Li et al., 2022, Gui et al., 2019). Its genome is a 290.3 kb linear double-stranded DNA encoding 150 open reading frames (ORFs), which mainly infects goldfish and silver crucian carp ( Carassius gibelio )、Black Crucian Carp( Carassius Carassius ) and other fish. Symptoms of the disease include superficial bleeding, pale gill filaments, and dark body color (Wen et al., 2021, Thangaraj et al., 2019). CyHV-3 is also known as koi herpesvirus ( koi herpesvirusCyHV-3 (KHV) is a highly pathogenic virus that affects koi, common carp, and their variants, with a mortality rate of approximately 90% in both fry and adult carp (Streiff et al., 2023, Zheng et al., 2023, Ilouze et al., 2011). The viral genome is a linear double-stranded DNA sequence of 295 kb, containing 156 open-label fragments (ORFs), making it one of the largest known herpesvirus genomes (Davison et al., 2013, Zheng et al., 2016). Fish infected with CyHV-3 exhibit symptoms such as increased mucus secretion, gill necrosis, and lethargy, typically dying within 6-7 days of infection. Because both goldfish and koi belong to the Cyprinidae family and are closely related to common carp, CyHV-2 and CyHV-3 share some overlap in host selection. Streiff et al. found that under laboratory conditions, both CyHV-2 and CyHV-3 can infect zebrafish, indicating that these two viruses have the potential to spread across species, increasing the difficulty of prevention and control (Streiff et al., 2023). In addition, studies have found that CyHV-2 and CyHV-3 can co-infect, and this mixed infection increases the risk of virus transmission in the aquaculture environment, posing new challenges to the aquaculture industry (Cano et al., 2021).

[0003] Furthermore, herpesviruses can establish lifelong latent infections. Studies have shown that CyHV-2 and CyHV-3 can also remain latent in infected fish and, under certain conditions, can reactivate, leading to relapse. For example, CyHV-2 actively replicates at temperatures between 15 and 25°C. However, when water temperatures drop below 10°C or rise above 30°C, the virus can enter a latent state within the host organism, during which the host does not exhibit any clinical symptoms (Chai et al., 2020). However, if the water temperature returns to its optimal range (15–25°C) or the host is exposed to stress factors, latent CyHV-2 may reactivate, leading to viral replication and transmission (He et al., 2023, Liang et al., 2023). Furthermore, CyHV-3 has an optimal temperature range of 18-28°C. Studies have found that the virus exhibits excellent thermal stability between 3 and 36°C, maintaining its ability to infect at temperatures as high as 37°C and as low as 4°C. However, its activity gradually decreases at temperatures above 36°C, reaching complete inactivity at 50°C (Zhou et al., 2018). At temperatures below 15°C, CyHV-3 can maintain a latent state in its host, where the viral genome persists but does not replicate in ganglion cells. Reactivation is possible upon exposure to temperatures suitable for growth, leading to frequent CyHV-3 outbreaks in spring when water temperatures rise (Eid et al., 2011, Donohoe et al., 2015). The viral genome can still be detected in the brain tissue of carp that survived infection with CyHV-3 one year after infection (Yuasa et al., 2009). Diagnosis of latent infection presents challenges such as low viral loads, making it difficult to detect using traditional methods; a long incubation period, with subtle symptoms that are difficult to detect with the naked eye; intermittent viral shedding, increasing the risk of transmission; and the need for long-term dynamic monitoring, which traditional methods struggle to meet. This latency and reactivation not only complicates detection but also makes viral prevention and control more challenging. The complexity of latent infection requires more sensitive and efficient detection technologies to ensure early detection and effective prevention and control, safeguarding the healthy development of the aquaculture industry.

[0004] Currently, a variety of detection technologies for CyHV-2 and CyHV-3 are available. For example, Jeffrey et al. observed CyHV-2 viral particles in the kidney tissue and nuclei of diseased goldfish using electron microscopy (Jeffrey et al., 2007). Waltzek et al. developed a conventional polymerase chain reaction (PCR) method based on the CyHV-2 helicase gene sequence for the specific detection of CyHV-2 (Waltzek et al., 2009). Leutenegger et al. developed a fluorescence quantitative PCR technique for the quantitative detection of CyHV-3 (Leutenegger et al., 2004). Other techniques include multiplex PCR, fluorescence in situ hybridization (FISH), and loop-mediated isothermal amplification (LAMP). While these detection methods have achieved some success in detecting CyHV-2 and CyHV-3, they still suffer from low efficiency, difficulty in distinguishing mixed infections, and inability to achieve quantitative detection. For example, although electron microscopy is intuitive, it is complex, time-consuming, and unable to directly identify CyHV-2 (Ding et al., 2014). Conventional PCR methods, while highly specific, lack quantitative detection and have limited ability to discriminate mixed infections. Cell isolation and culture techniques, while highly accurate, are cumbersome, inefficient, and require specialized laboratory conditions (Volpe et al., 2023). Conventional multiplex PCR relies on gel electrophoresis for interpretation, resulting in low sensitivity and inability to quantify. High-throughput sequencing, while highly sensitive and specific, is expensive, requires large amounts of data, and is complex, making it difficult to scale up in primary laboratories (Nizamani et al., 2024). FISH is susceptible to environmental factors and primarily provides qualitative detection, not quantitative analysis (Dey et al., 2025). LAMP, while highly sensitive, has high environmental requirements and is susceptible to interference from other DNA in the sample, resulting in false positives (Liao et al., 2023).

[0005] Therefore, there is an urgent need to develop an efficient, accurate, and rapid detection method to address current challenges in CyHV-2 and CyHV-3 detection and provide technical support for the rapid differential diagnosis and prevention of carp herpesviruses. Currently, fluorescent quantitative PCR has become the gold standard for viral diagnosis due to its high sensitivity, wide dynamic range, and closed-tube anti-contamination properties (Cassedy et al., 2021, Bustin et al., 2009). It can overcome the limitations of existing technologies and meet the needs of mixed infection screening and incubation period monitoring. Although single-plex fluorescent quantitative PCR methods have been established for CyHV-2 or CyHV-3 (Gilad et al., 2004, Desmecht et al., 2023), dual-plex fluorescent quantitative PCR methods that can simultaneously detect both viruses have not been reported. Therefore, this study aimed to develop a dual-plex fluorescent quantitative PCR method for CyHV-2 and CyHV-3, hoping to provide a reliable tool for the rapid differential diagnosis and epidemiological control of carp herpesviruses. Summary of the Invention

[0006] The present invention provides a primer pair for simultaneously detecting carp herpesvirus type II and type III and a dual fluorescence quantitative PCR detection method and application. Double-stranded viral DNA is used as a template in combination with a dye to construct a dual fluorescence quantitative PCR detection method for the simultaneous detection of CyHV-2 and CyHV-3. Expensive TaqMan probes are abandoned, and there is no need to construct recombinant plasmid standards. It has the characteristics of high efficiency, accuracy, speed, and low cost, and is particularly suitable for large-scale sample screening and low-load virus monitoring during the incubation period. Simultaneous detection of CyHV-2 and CyHV-3 is achieved, detection efficiency is improved, detection costs are reduced, and problems such as the difficulty in identifying mixed infections and the inability to achieve quantitative detection in the prior art are solved.

[0007] The technical solution of the present invention is a primer pair for simultaneously detecting carp herpesvirus type II and type III, comprising a primer pair SEQ ID NO.1 and SEQ ID NO.2 for amplifying carp herpesvirus type II ORF71, and a primer pair SEQ ID NO.7 and SEQ ID NO.8 for amplifying carp herpesvirus type III ORF140, the carp herpesvirus type II ORF71 sequence is shown in SEQ ID NO.12, and the carp herpesvirus type III ORF140 sequence is shown in SEQ ID NO.13.

[0008] The Tm value of the primer pair designed by the present invention for amplifying carp herpesvirus type II is 82.78°C; the Tm value of the primer pair designed by the present invention for amplifying carp herpesvirus type III is 89.22°C.

[0009] The primer pair for amplifying carp herpesvirus type II and the primer pair for amplifying carp herpesvirus type III designed by the invention do not interfere with each other in a double fluorescence quantitative PCR reaction and specifically combine with target viral DNA sequences only.

[0010] The primer pair for simultaneously detecting carp herpesvirus type II and type III of the present invention can be used to simultaneously detect carp herpesvirus type II and type III, and can also be used to prepare products for the simultaneous detection of carp herpesvirus type II and type III. The products can be reagents, kits, detection systems, devices, instruments or equipment, etc.

[0011] The present invention also provides a product for simultaneous detection of carp herpesvirus type II and type III, comprising the aforementioned primer pair for simultaneous detection of carp herpesvirus type II and type III. The product can be a reagent, a kit, a detection system, a device, an instrument or equipment, etc.

[0012] The product also contains TB Green Mix and nuclease-free water. The TB Green fluorescent dye in TB Green Mix binds to the double-stranded DNA in the PCR product, emitting a fluorescent signal whose intensity is proportional to the amount of PCR product. Detection and analysis of the fluorescent signal allows for accurate quantification of CyHV-2 and CyHV-3 viruses.

[0013] The product also contains cyprinid herpesvirus type II ORF71 DNA standard and cyprinid herpesvirus type III ORF140 DNA standard, and the concentration range of each is 1×10 0 to 1×10 9 Standards are used for calibration and quantitative detection to generate standard curves, thereby enabling quantitative detection of unknown samples.

[0014] The present invention also provides a dual fluorescence quantitative PCR detection method for simultaneously detecting carp herpesvirus type II and type III, the steps comprising: mixing the sample to be tested with the primer pair for simultaneously detecting carp herpesvirus type II and type III mentioned above or the product for simultaneously detecting carp herpesvirus type II and type III mentioned above, performing a dual fluorescence quantitative PCR reaction, collecting the fluorescence signal, and performing qualitative and / or quantitative detection of carp herpesvirus type II and / or type III.

[0015] Furthermore, the dual fluorescence quantitative PCR reaction conditions were as follows: 95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s, 35 cycles, with the temperature continuously raised from 60 °C to 95 °C at a constant rate of 0.05-0.1 °C / s, and fluorescence was continuously collected.

[0016] Furthermore, the dual fluorescence quantitative PCR reaction system contains TB Green Mix and nuclease-free water.

[0017] Furthermore, in the dual fluorescence quantitative PCR reaction system, the concentration of the primer pair for amplifying carp herpesvirus type II is 2-4 μmol / L, preferably 2-3 μmol / L, further preferably 2-2.5 μmol / L, and further preferably 2.2-2.4 μmol / L; the molar ratio of the primer pair for amplifying carp herpesvirus type II to the primer pair for amplifying carp herpesvirus type III is 0.5-2:1, preferably 0.5-1:1, further preferably 0.5-0.8:1, further preferably 0.55-0.65:1, and further preferably 0.6:1; the molar ratio of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type II is 1:1, and the molar ratio of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type III is 1:1. As an embodiment, in the dual fluorescence quantitative PCR reaction system, the concentration of the primer pair for amplifying carp herpesvirus type II is 2.3 μmol / L, the molar ratio of the primer pair for amplifying carp herpesvirus type II to the primer pair for amplifying carp herpesvirus type III is 0.6:1, the molar ratio of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type II is 1:1, and the molar ratio of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type III is 1:1. Specifically, in a 13 μL reaction volume, the concentrations of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type II are 50 μmol / L, respectively, the volumes of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type II are 0.3 μL, respectively, the concentrations of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type III are 50 μmol / L, respectively, and the volumes of the forward and reverse primers in the primer pair for amplifying carp herpesvirus type III are 0.5 μL, respectively.

[0018] Compared with the prior art, the dual fluorescence quantitative PCR detection method and kit of the present invention have the following advantages: First, the cost is low. This method eliminates the need for expensive TaqMan probes and the construction of recombinant plasmid standards, significantly reducing testing costs. Traditional detection methods, such as the TaqMan probe method, are expensive, and the construction of recombinant plasmid standards is complex, time-consuming, and labor-intensive. However, this method utilizes a double-stranded DNA-binding dye (TB Green), which is relatively inexpensive and easy to use, effectively reducing testing costs and making it particularly suitable for cost control in large-scale sample screening.

[0019] Second, the experimental design is simpler and faster, and the operation is simple, the present application saves the complex steps of probe design and optimization, only needs to design and verify the primer, greatly shortens the experimental starting time, and is especially suitable for rapid screening or limited target sequence information. The specific primer is designed for the conserved region of CyHV-2 and CyHV-3 virus, the primer has high specificity and sensitivity, and has good thermal stability. Compared with other primer groups, the Tm value difference is obvious, which is beneficial to the differentiation of CyHV-2 and CyHV-3 in double fluorescent quantitative PCR.

[0020] Third, the method steps are clear and definite, the professional technical requirements of the operator are relatively low, and ordinary laboratory personnel can operate skillfully after simple training.

[0021] Fourth, the detection is efficient, the present application realizes the simultaneous detection of CyHV-2 and CyHV-3 through double fluorescent quantitative PCR technology. Compared with the existing single detection method, the two viruses can be detected in one reaction, the detection time is greatly shortened, and the detection efficiency is improved. For the case that a large number of samples need to be detected in aquaculture industry, the detection result can be quickly obtained, and the basis for virus prevention and control is provided in time.

[0022] Fifth, the specificity is high, the specific primer pair is designed for the conserved sequence of CyHV-2 and CyHV-3 virus, which ensures that the primer is only specific to the target virus DNA sequence, reduces the possibility of non-specific amplification, and the primer can accurately identify and amplify the specific sequence of the two viruses, so as to realize the differential detection of the two viruses. There is no cross reaction with grass carp reovirus type I (GCRV-1), grass carp reovirus type II (GCRV-2), grass carp reovirus type III (GCRV-3) and carp spring virus haemorrhagic virus (SVCV), which ensures the specificity of the detection result. At the same time, through the optimization of the double fluorescent quantitative PCR reaction system, especially the optimization of the volume of the primer in the PCR reaction system, the best reaction condition is determined, so that the amplification efficiency of the reaction system reaches the best state, the volume of the optimized primer pair can make the double peaks of the melting curve more separated and clear, which ensures that the amplification of CyHV-2 and III type is not interfered with each other, further guarantees the sensitivity, specificity and accuracy of the reaction. And the standard product is prepared for calibration and quantitative detection, which further improves the accuracy of the detection result.

[0023] Sixth, the sensitivity is high, the sensitivity of CyHV-2 is 14.8 copies / μL, and the sensitivity of CyHV-3 is 21.9 copies / μL, which can detect low load virus and meet the monitoring demand.

[0024] Seventh, it has good repeatability, with the coefficient of variation of Ct value <3% and the coefficient of variation of Tm value <0.2%, which can maintain consistency and stability of results in multiple tests.

[0025] Clinical verification results showed that the detection method of the present invention had a CyHV-2 positive rate of 27.7% and a CyHV-3 positive rate of 23.1%, which were higher than conventional PCR (21.5% and 21.5%), further demonstrating the advantages of the present invention in practical applications. It can more accurately detect virus-infected samples and provide more effective technical support for the healthy development of the aquaculture industry.

[0026] In summary, the dual fluorescence quantitative PCR detection method based on double-stranded DNA binding dye and its supporting kit of the present invention provide an efficient, accurate, fast and low-cost reliable tool for the rapid differential diagnosis and epidemiological control of carp herpesvirus, and have broad application prospects and market value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The specific results of the primers for CyHV-2 (A) and CyHV-3 (B) PCR reactions. In panel A, M: DNA Marker DL1000; in panel B, M: DNA Marker DL2000; NC: negative control.

[0028] Figure 2 Melting curve results of target fragments of three primer pairs for CyHV2 and CyHV3, A: CyHV-2-F1R1, B: CyHV-2-F2R2, C: CyHV-2-F3R3, D: CyHV-3-F1R1, E: CyHV-3-F2R2, F: CyHV-3-F3R3, 1-3: 3 repeats, NC: negative control.

[0029] Figure 3 These are the Tm value results of the target fragments of CyHV-2 (A) and CyHV-3 (B) by fluorescence quantitative PCR.

[0030] Figure 4 The results of primer volume optimization for dual fluorescence quantitative PCR are shown. A and C are amplification curves; B and D are melting curves.

[0031] Figure 5 The results of the CyHV-2 fluorescence quantitative standard curve are shown in Figure 2.

[0032] Figure 6 The results of the CyHV-3 fluorescence quantitative standard curve are shown in Figure 2.

[0033] Figure 7 The specific detection results of dual fluorescence quantitative PCR, A: melting curve, B: amplification curve.

[0034] Figure 8 Duplex qPCR and melting curve results for CyHV-2 and CyHV-3.

[0035] Figure 9 CyHV-2 and CyHV-3 standard linear fragment 1 x 10 0 -1 x 10 7 copies / μL amplification curve results.

[0036] Figure 10 Duplex qPCR and melting curve results for clinical sample amplification.

[0037] Figure 11 PCR detection results for 65 clinical samples, A-F are CyHV-2 clinical sample PCR detection by national standard method, G-L are CyHV-3 clinical sample PCR detection by national standard method, NC: negative control, P: positive control. DETAILED DESCRIPTION

[0038] 1. Materials and methods 1.1 Virus strains and clinical samples CyHV-2 virus YC-01 strain (MN593216) was isolated from a crucian carp farm in Yancheng, Jiangsu Province, and CyHV-3 virus GZ1301 strain was provided by the Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences. Clinical samples of CyHV-2, CyHV-3, and GCRV-1, GCRV-2, GCRV-3, and SVCV were provided by the National Aquatic Animal Pathogen Bank of Shanghai Ocean University.

[0039] 1.2 Preparation of template standards CyHV-2 and CyHV-3 virus DNA was extracted as a template, and the ORF71 gene of CyHV-2 and the ORF140 gene fragment of CyHV-3 were amplified using specific primers. The PCR reaction system was 1 μL of forward and reverse primers (10 μmol / L), 12.5 μL of Taq Mix, 1 μL of template, and 9.5 μL of nuclease-free water. The reaction conditions were 94 ℃ for 5 min, 94 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 2 min, with 35 cycles of amplification; 72 ℃ for 10 min, and finally 4 ℃ for incubation. The amplified products were subjected to agarose gel electrophoresis for gel recovery of the target fragments.

[0040] 1.3 Primer design and screening Based on the GenBank sequences of the CyHV-2 ORF71 gene (KM200722.1) and the CyHV-3 ORF140 gene (NC009127.1), specific primers were designed targeting conserved regions of these genes. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Primer information is shown in Table 1. Six primer pairs were initially screened by conventional PCR amplification to select primer pairs that specifically amplified the target fragments. Fluorescence quantitative PCR was then used to measure the melting temperatures (Tm values) of the products of each primer pair. Ultimately, two primer pairs with significantly different Tm values ​​were selected to ensure clear differentiation of CyHV-2 and CyHV-3 amplification signals in the dual fluorescence PCR reaction, laying the foundation for the subsequent development of a dual fluorescence PCR detection method.

[0041] ACAAGATGAGGACCGTGGAG TTTATGCCTCTGAAACTGGCGCACGGCATGAATACTTATTTCTGCCAGGGACTGACGTTCAAGTTTCCAGTGGTTTACTGTCCACCAAATTTTTACGCGTCCAGTCCCATCAAACCGAGTTGTTATGTTGTGTGTACAAGGGTGACAAATCGGGGTTTACTAAACTTGA CCAACTGTTCTTTCGCC AA CACTATAACCGGACAGACTTACTACTTTTCACCCGAGTGTGTTCGGTTCAAGTTGGATTTCGAGCTGGGCTACCGACTGGATCCAGCGTTCAGAATTCAGAAAAACCCTAAAAGACGGTAG CyHV-3 ORF140基因序列(SEQ ID NO.13):ATGGAACCCGAGACCTCGACAGCGAGAACCGCCGAGCATGCCCTTTCATGGACACGCCGGGGCGCCCTGATCATCCTGGAAGGCGTCGATCGTTCGGGTAAGTCGACGCAGTGTCGCATGCTGGTCAAGGCCCTGCTGGAGATGGGAGTCGAGGCCGAGCTGATGAGGTTCCCGGACAGGACCACTCCGATCGGACAGATGATCAACTCGTACCTGCTCAACAAGAGCGATCTGGACGATCACGTCGTACACCTCCTGTTCTCGGCCAACCGATGGGAAGCCGCCTCCGACCTGAAGCGCAAGCTGATGAAGGGTACCACCATCGTGCTCGACCGCTACGCGTTCTCCGGCGTAGCCTTCACGGCGGCGAAGCCCGGGTTCGAGCTCGAGTGGTGTAAGCGAACCGACGTGGGTCTGCCCAAGCC CGACCTGGTGGTGTTCCTGGCCATCGAGGCCTCCGCCGTGGAGAGCAGAGGCGGCTTCGGCGACGAGCGGTACGAGGTCAGCGCCTTCCAGGCCGCCGTCCGAGAAAACTTTGAGGTGCTCATGAAAGATGTCACCGTCAACTGGCGCAAGGTGGACGCTGCCCGGACTCCGGAGCAGGTCCATGGTGACATCCTCAGGCTGACGGACGACG CCCACAACGCC ATCTACGA CTCCAGAGACGGCTTCGACGACACCATTCCCACTTTATGGTCTTGA Table 1 Primer sequences and amplified genes

[0042] 1.4 Establishment of standard curve for fluorescence quantitative PCR Dilute the standard prepared in 1.2 to 1 × 10 9 The initial concentration was 1 × 10 copies / μL, and then 10-fold serial dilutions were performed until the final concentration reached 1 × 10 0 copies / μL. 1×10 9 to 1×10 0 The standard linear fragment with a concentration of copies / μL was used as a template for fluorescence quantitative PCR amplification, and the test results were recorded to construct a standard curve.

[0043] 1.5 Optimization of the Dual Fluorescence Quantitative PCR System Optimization of primer volume: Using a primer concentration of 50 μmol / L, duplex qPCR reactions were performed in volumes of 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL, and 0.6 μL, respectively, to determine the most appropriate primer volume.

[0044] Melting curve analysis and Tm value determination: Based on the Tm value range previously determined for single-plex fluorescent quantitative PCR, the Tm values ​​of the double-peak melting curves obtained in the duplex fluorescent quantitative PCR amplification experiment were evaluated to verify whether they were consistent with the Tm values ​​of the specific single-peak melting curves obtained in the single-plex fluorescent quantitative PCR assays we previously developed for CyHV-2 and CyHV-3.

[0045] 1.6 Dual fluorescence quantitative PCR specificity and repeatability test Double fluorescence quantitative PCR amplification was performed on CyHV-2, CyHV-3, GCRV-1, GCRV-2, GCRV-3 and SVCV, and 1×105 copies / μL to 1 x 10 7 copies / μL concentration were tested in triplicate. The duplex real-time PCR reaction system was 1 μL of template, 0.3 μL of each of the CyHV-2 forward and reverse primers, 0.5 μL of each of the CyHV-3 forward and reverse primers, 6.5 μL of TB Green Mix, 3.9 μL of nuclease-free water, and the duplex real-time PCR reaction conditions were 95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s, 35 cycles, with a constant rate of 0.05-0.1 °C / s from 60 °C to 95 °C, and fluorescence was continuously collected.

[0046] 1.7 Sensitivity test of duplex real-time PCR The virus templates of CyHV-2 and CyHV-3 were diluted by 10-fold gradient, and 1 x 10 9 copies / μL to 1 x 10 0 copies / μL concentration standard linear fragments were used as positive templates, and ddH2O was used as a negative control for real-time PCR testing. The Ct values of each dilution were recorded, and a standard curve was plotted. The slope, intercept, and R2 value of the standard curve were used to evaluate the efficiency and consistency of PCR amplification. By comparing the changes in Ct values at different dilutions, the minimum detection limit of duplex real-time PCR was determined, i.e., the lowest virus concentration that could be reliably detected.

[0047] 2 Results 2.1 Screening of duplex real-time PCR primer sets and optimization of reaction system The specificity of the three pairs of primers for CyHV-2 and CyHV-3 was evaluated by conventional PCR detection, and the results showed that the CyHV-2-F1R1, CyHV-2-F2R2, and CyHV-2-F3R3 primers produced expected bands at 208 bp, 158 bp, and 162 bp, respectively, and the CyHV-3-F1R1, CyHV-3-F2R2, and CyHV-3-F3R3 primers produced expected bands at 231 bp, 172 bp, and 178 bp, respectively ( Figure 1 ). This indicated that the designed primers had good specificity and could be used for subsequent experiments.

[0048] Further, the three pairs of primers for CyHV-2 and CyHV-3 were subjected to real-time PCR amplification, and the results of melting curve analysis showed that the CyHV-2-F1R1 and CyHV-3-F1R1 primer sets had clear single peaks and no non-specific amplification ( Figure 2). Further observation of the Tm value of the six primer groups found that the Tm values of CyHV-2-F1R1, CyHV-2-F2R2, CyHV-2-F3R3 were 82.78℃, 86.97℃, 87.37℃, respectively, and the Tm values of CyHV-3-F1R1, CyHV-3-F2R2, CyHV-3-F3R3 were 89.22℃, 88.18℃, 88.4℃, respectively. Figure 3 ), which showed that CyHV-2-F1R1 and CyHV-3-F1R1 primer groups had good thermal stability, and the Tm value difference was obvious compared with other primer groups, which was beneficial to distinguish CyHV-2 and CyHV-3 in duplex fluorescent quantitative PCR. Therefore, CyHV-2-F1R1 and CyHV-3-F1R1 primer groups were selected for the establishment of subsequent duplex fluorescent quantitative PCR detection method.

[0049] The volume of primer pairs of CyHV-2 and CyHV-3 was evaluated by fluorescent quantitative PCR technology. The primer pairs were CyHV-2-F1R1 and CyHV-3-F1R1 primer groups selected above, and 0.3 μL CyHV-2-FR+0.5 μL CyHV-3-FR, 0.4 μL CyHV-2-FR+0.5 μL CyHV-3-FR, 0.5 μL CyHV-2-FR+0.5 μL CyHV-3-FR, 0.6 μL CyHV-2-FR+0.5 μL CyHV-3-FR; 0.5 μL CyHV-2-FR+0.3 μL CyHV-3-FR, 0.5 μL CyHV-2-FR+0.4 μL CyHV-3-FR, 0.5 μL CyHV-2-FR+0.5 μL CyHV-3-FR, 0.5 μL CyHV-2-FR+0.6 μL CyHV-3-FR different primer volume combinations were used for reaction. The results showed that under the concentration of 50 μmol / L, the volume of forward and reverse primers of CyHV-2 was 0.3 μL and the volume of forward and reverse primers of CyHV-3 was 0.5 μL, which showed the best reaction effect. Figure 4 ).

[0050] 2.2 Establishment of fluorescent quantitative PCR standard curve The optimized fluorescent quantitative reaction system was used to construct the standard curve of CyHV-2 and CyHV-3 according to the logarithmic relationship between Ct value and standard concentration. The results showed that the standard curves of CyHV-2 and CyHV-3 both showed good linear relationship, and the correlation coefficient R² was higher than 0.99, and the slope and intercept value of the standard curve further verified the efficiency of PCR amplification. Figure 5-6 ), which indicated that the established duplex fluorescent quantitative PCR method had good accuracy and reliability.

[0051] 2.3 Dual fluorescence quantitative PCR specificity test The results of double fluorescence quantitative PCR reaction using GCRV-1, GCRV-2, GCRV-3 and SVGV nucleic acid products as templates showed no amplification reaction. The results of double fluorescence quantitative PCR reaction using CyHV-2 and CyHV-3 nucleic acid products as templates showed that specific amplification signals were generated ( Figure 7 The results showed that the dual fluorescence quantitative PCR detection method for CyHV-2 and CyHV-3 had no cross-reaction with GCRV-1, GCRV-2, GCRV-3, and SVCV, indicating that this method has a high specificity and can effectively distinguish CyHV-2 and CyHV-3 from other aquatic animal viruses.

[0052] 2.4 Repeatability test of dual fluorescence quantitative PCR The concentration of CyHV-2 and CyHV-3 viruses was 1×10 5 -1×10 7 The fluorescence quantitative PCR test was repeated three times at 100 copies / μL. The results showed that the amplification curves of CyHV-2 and CyHV-3 showed a clear single peak and no nonspecific amplification ( Figure 8 The coefficients of variation of the Ct values ​​were less than 3%, and the coefficients of variation of the Tm values ​​were less than 0.2% (Table 2), indicating that the method has good repeatability and the results are stable and reliable.

[0053] Table 2 Repeatability analysis of Ct and Tm values ​​at different concentrations of fluorescence quantitative PCR

[0054] 2.5 Dual fluorescence quantitative PCR sensitivity test CyHV-2 and CyHV-3 standard linear fragments 1×10 0 -1×10 7 The results showed that the detection limit of CyHV-2 fluorescence quantitative PCR was 14.8 copies / μL ( Figure 9 The detection limit of CyHV-3 fluorescence quantitative PCR was 21.9 copies / μL ( Figure 9 ). This shows that the detection method has high sensitivity for both CyHV-2 and CyHV-3.

[0055] 2.6 Dual Fluorescence Quantitative PCR Clinical Sample Testing Dual fluorescence quantitative PCR and conventional PCR were performed on 65 tissue samples suspected of mixed infection with CyHV-2 and CyHV-3. The results showed that in the dual fluorescence quantitative PCR test, 5 samples showed dual positive signals for CyHV-2 and CyHV-3, and the melting curve analysis showed clear double peaks. The Tm value was consistent with the previously optimized primer pair. In addition, only CyHV-2 positive signals were detected in 13 samples, and only CyHV-3 positive signals were detected in 10 samples, verifying the accuracy of the dual fluorescence quantitative PCR detection method ( Figure 10 In the PCR test, 14 samples were positive for CyHV-2 and 14 samples were positive for CyHV-3 ( Figure 11 The positive rates for CyHV-2 and CyHV-3 using dual fluorescence quantitative PCR were 27.7% and 23.1%, respectively. The positive rates for CyHV-2 and CyHV-3 using conventional PCR were 21.5% and 21.5% (Table 3). This indicates that dual fluorescence quantitative PCR has higher sensitivity and accuracy than conventional PCR.

[0056] Table 3 Results of dual fluorescence quantitative PCR and conventional PCR clinical sample detection

Claims

1. A primer pair for simultaneous detection of cyprinid herpesvirus type II and type III, characterized in that: It comprises a primer pair SEQ ID NO.1 and SEQ ID NO.2 for amplifying carp herpesvirus type II ORF71, and a primer pair SEQ ID NO.7 and SEQ ID NO.8 for amplifying carp herpesvirus type III ORF140. The carp herpesvirus type II ORF71 sequence is shown as SEQ ID NO.12, and the carp herpesvirus type III ORF140 sequence is shown as SEQ ID NO.

13.

2. The primer pair according to claim 1 is used for the simultaneous detection of carp herpesvirus type II and type III for non-diagnostic and therapeutic purposes, or for the preparation of a product for the simultaneous detection of carp herpesvirus type II and type III.

3. A product for simultaneous detection of carp herpesvirus type II and type III, characterized in that: Contains the primer pair according to claim 1.

4. A product for simultaneous detection of carp herpesvirus type II and type III according to claim 3, characterized in that: The product is a reagent, a kit, a device, or an apparatus.

5. A product for simultaneous detection of carp herpesvirus type II and type III according to claim 3 or 4, characterized in that, Also contains TB Green mix.

6. A product for simultaneous detection of carp herpesvirus type II and type III according to claim 3 or 4, characterized in that, It also contains cyprinid herpesvirus type II ORF71 DNA standard and cyprinid herpesvirus type III ORF140 DNA standard.

7. A dual fluorescence quantitative PCR detection method for simultaneously detecting carp herpesvirus type II and type III, characterized in that: The method is for non-diagnostic and non-therapeutic purposes, and the steps include: mixing the sample to be tested with the primer pair described in claim 1 or the product described in any one of claims 3-6, performing a dual fluorescence quantitative PCR reaction, collecting the fluorescence signal, and performing qualitative and / or quantitative detection of carp herpesvirus type II and / or type III.

8. The dual fluorescence quantitative PCR detection method according to claim 7, characterized in that: The reaction conditions for dual fluorescence quantitative PCR were as follows: 95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s, 35 cycles, with the temperature continuously increasing from 60 °C to 95 °C at a constant rate of 0.05-0.1 °C / s, and fluorescence was continuously collected.

9. The dual fluorescence quantitative PCR detection method according to claim 7, wherein: In the dual fluorescence quantitative PCR reaction system, the concentration of the primer pair for amplifying carp herpesvirus type II is 2-4 μmol / L, and the molar ratio of the primer pair for amplifying carp herpesvirus type II to the primer pair for amplifying carp herpesvirus type III is 0.5-2:

1.

10. The dual fluorescence quantitative PCR detection method according to claim 7, wherein: The dual fluorescence quantitative PCR reaction system contains TB Green Mix.

Images