Domesticated strain of morchella septimelata and application thereof
By domesticating wild Morchella septimelata in Zhouqu County, Gannan Tibetan Autonomous Prefecture, a new variety, Morchella septimelata YYZQ-220421, with wide adaptability and high yield was screened out, which solved the limitation of Morchella in temperature resistance and achieved a high-yield and stable cultivation effect.
Patent Information
- Application Number
- CN202510764813.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-10-17
AI Technical Summary
Morels have strict requirements on the growing environment, and existing varieties have limitations in temperature resistance, resulting in low and unstable yields and difficulty in adapting to climatic conditions in different regions.
By screening and domesticating wild Morchella septimelata from Zhouqu County, Gannan Tibetan Autonomous Prefecture, the strain Morchella septimelata YYZQ-220421 was obtained. Mycelium isolation and purification, biological characteristics research, fertility testing and regional trials were carried out, and a new variety with wide adaptability and high yield was bred.
This new variety exhibits a wide range of fruiting temperatures when cultivated in different regions, with high yield, early fruiting, and a long fruiting period. It has good tolerance, alleviates the problem of low yield caused by weather changes, and has great promotion value.
Smart Images

Figure CN120796075A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of edible fungi, in particular to a domesticated strain of Morchella septimelata and application thereof. BACKGROUND
[0002] Morchella is one of the important pillars of the edible fungi industry for rural revitalization due to its unique flavor, diverse physiological activity, obvious cultivation advantage, low labor intensity, and high cultivation benefit. However, Morchella has more stringent requirements for the growth environment, especially the geotemperature and air temperature from primordium to small mushroom formation stage. Inappropriate management may result in low yield or even absolute loss. Overall, the current common varieties of Morchella have certain limitations in temperature resistance. Breeding a Morchella strain with a wider range of fruiting temperature is an important feature of an excellent Morchella strain. Due to the objective reality that Morchella is a sac fungus, does not have a lock-like joint feature, and single-spore strain field hybridization test cannot effectively screen hybridization, domesticating and utilizing local wild Morchella resources, breeding strains more suitable for local climate conditions, and reducing the influence of environmental factors on Morchella planting are effective paths for breeding excellent Morchella strains. SUMMARY
[0003] The present application provides a domesticated strain of Morchella septimelata and application thereof. The domesticated strain provided by the present application has high yield, wide adaptability, and stable yield in different regions.
[0004] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows: The present application provides a domesticated strain of Morchella septimelata, which is Morchella septimelata YYZQ-220421. Morchella septimelata The strain has been preserved in China Center for Type Culture Collection on July 3, 2024, and the preservation number is CCTCC NO:M 20241468.
[0005] The present application also provides application of the domesticated strain of Morchella septimelata in Morchella agricultural planting.
[0006] The present application also provides application of the domesticated strain of Morchella septimelata as a parent in breeding.
[0007] Preferably, the breeding includes self-breeding, cross-breeding, or molecular breeding.
[0008] The present application also provides mycelium obtained by culturing the domesticated strain of Morchella septimelata.
[0009] The present application also provides fruiting bodies obtained by cultivating the domesticated strain of Morchella septimelata.
[0010] The application also provides the application of the fruiting body or the extract thereof in food processing.
[0011] The application also provides the application of the fruiting body or the extract thereof in the field of pharmacy.
[0012] Compared with the prior art, the application has the following beneficial effects: 1. The application provides a new Morchella angusticeps strain, which greatly enriches Morchella cultivation strains, and the strain has the advantages of fast mycelium growth speed, developed aerial mycelium, slow pigment production, rich and white sclerotia, and good uniformity.
[0013] 2. The strain has wide mushrooming temperature and good primordium formation ability in cultivation in different regions, high yield, early mushrooming, long mushrooming period, large fruiting body, and thin and short stipe, and has better resistance to low temperature and high temperature adverse weather that may occur in production, helps to alleviate the problem of low Morchella yield and serious economic losses of growers due to weather in production, and has good commodity performance, and therefore has great popularization value in production.
[0014] Therefore, the application aims to provide a new Morchella angusticeps variety and cultivation related technology. BRIEF DESCRIPTION OF DRAWINGS
[0015] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced.
[0016] Figure 1 is a genetic development tree constructed by the application based on four different fragments; Figure 2 is a purification plate diagram of the Morchella strain YYZQ-220421 parent of the application; Figure 3 is a mushrooming test diagram of the Morchella strain YYZQ-220421 of the application; Figure 4 is a young mushroom stage morphology diagram of the Morchella strain YYZQ-220421 of the application; Figure 5 is an antagonistic test of the strain YYZQ-220421 of the application, in which: ① YYZQ-220421, ② Morchella angusticeps ZQ-11, and ③ Mel-211942; Figure 6 is a mating gene amplification result of the strain YYZQ-220421 of the application; Figure 7is a fruit body morphology diagram of the Morchella strain YYZQ-220421 of the present application Figure 8 The present application is tested in the Gongfeng shell area of Zhouqu County in Gannan Prefecture. Figure 9 is the mushroom test situation of the present application in the Siguangzhai village area of Xifeng District in Qingyang City. DETAILED DESCRIPTION
[0017] In order to make the purpose and advantages of the present application clearer and more apparent, the present application will be further described in detail below in combination with examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.
[0018] The instruments, reagents, materials, etc. involved in the following examples, if not specifically stated, are all conventional instruments, reagents, materials, etc. already existing in the prior art, which can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following examples, if not specifically stated, are all conventional experimental methods, detection methods, etc. already existing in the prior art.
[0019] Gansu Province is rich in wild Morchella resources, and the Di'bu Morchella was approved by the state as a national geographical indication protection product on November 22, 2017. The present application takes the wild Qimei Morchella collected from the adjacent Zhouqu County as the parent, and through mycelium separation and purification, biological property research, fertility detection, fruiting test and regional test, an excellent strain is screened out, and the strain number is: Morchella septimelata YYZQ-220421.
[0020] YYZQ-220421 strain preservation statement: Classification and naming: Qimei Morchella Strain name: YYZQ-220421 Latin name: Morchella septimelata Preservation number: CCTCC NO: M 20241468 Preservation agency: China Center for Type Culture Collection Preservation address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province Preservation date: July 3, 2024.
[0021] Example 1 Domestication of Qimei Morchella Strain 1 Fruit body collection During the fruiting season of Morchella (late April to late May), wild Morchella was collected in Zhouqu County and nearby counties of Gannan Tibetan Autonomous Prefecture. The specific method was as follows: after finding Morchella, first take a photo and number it, then carefully loosen the surrounding soil with a small shovel, gently pull it out, pay attention not to damage the stipe and cap, put the fruiting body into an envelope bag independently, and take it back to the laboratory for shade drying. Please refer to Table 1 for the collection situation.
[0022] Table 1 Collection of wild Morchella
[0023] 2 Identification of fruiting bodies 2.1 DNA extraction: using the collected wild fruiting bodies as materials, CTAB method was used to extract DNA.
[0024] CTAB method: place the target tissue in a 2 mL centrifuge tube and grind; add 800 μL of CTAB extraction buffer, 65°C water bath for 1 h, and invert and mix every 15 min; add 800 μL of phenol:chloroform:isopropanol (25:24:1), invert and mix, centrifuge at 12000 rpm for 10 min, transfer the upper aqueous phase to a new 2 mL centrifuge tube; add an equal volume of chloroform:isopropanol (24:1), invert and mix, centrifuge at 12000 rpm for 10 min, transfer the supernatant to a new 1.5 mL centrifuge tube; add 0.6 times the volume of isopropanol, precipitate at -20°C for 30 min or more; centrifuge at 12000 rpm for 10 min, discard the supernatant, wash twice with 75% ethanol; dry in a vacuum drying instrument for about 40 min, add water to dissolve the DNA.
[0025] 2.2 PCR amplification: four pairs of primers ITS, ef1-α, rpb1 and rpb2 were used for amplification. The specific conditions of the primers are shown in Table 2. The amplification reaction system was 25 μL, 1 μL of forward and reverse primers, 2×TaqMix enzyme 12.5 μL, DNA template 2 μL, and ddH2O was added to 25 μL; the amplification reaction program conditions were as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 10 s, annealing for 15 s (ITS 50°C, ef1-α 58°C, rpb1 55°C, rpb2 54°C), 72°C extension for 20 s, 35 cycles, finally 72°C extension for 8 min, 4°C storage. 72°C extension for 8 min, 4°C storage.
[0026] 2.3 PCR amplification product detection and sequencing: The amplification products of primers ITS, ef1-a, rpb1, rpb2 (the primer sequences are shown in SEQ ID NO: 1-SEQ ID NO: 8) were detected by 1% agarose electrophoresis (100 mL 1xTAE + 1 g agarose), and after observing bright bands, the amplification products were sent to Beijing Aokeding Sheng Biological Technology Co., Ltd. for sequencing.
[0027] Table 2: Amplification site, primer name and primer sequence
[0028] 2.4 Comparison of sequencing results and phylogenetic analysis: The target sequence was compared in the NCBI (National Center for Biotechnology Information) database by BLAST (Basic Local Alignment Search Tool), and sequences with homology greater than 99% were downloaded for phylogenetic analysis; the ITS, ef1-a, rpb1, rpb2 matrix was constructed respectively, adjusted in BioEdit, and finally integrated into a joint matrix, and the phylogenetic tree was constructed by using MEGA 7.0 software Neighbor-joining clustering analysis method.
[0029] Through target sequence comparison, it was found that among the 86 collected fruiting bodies, 12 fruiting bodies could be cultivated in the current cultivation mode, including 8 fruiting bodies of industry leading variety Qimei (Mel-7), 2 fruiting bodies of cultivable variety Mel-13, and 2 fruiting bodies of Mel-21. For details, please refer to Table 3. Figure 1
[0030] Table 3: Current mode of cultivated Morel germplasm resources
[0031] 3 Mycelium isolation and purification 3.1 Tissue isolation 3.1.1 Preparation of PDA plate medium PDA plate medium: potato 200 g, glucose 20 g, agar powder 18 g, water 1000 ml.
[0032] Take 200 g of washed peeled potatoes, cut into finger-thick strips, add 1000 ml of water and boil, cook for another 20 min after the water boils, then filter with gauze, take the filtrate, if the filtrate is less than 1000 ml, add 1000 ml to make up, then add agar powder and cook until melted, then add glucose and melt. Pour the prepared medium into a suitable size triangular bottle to 2 / 3, seal with a breathable sealing film, then autoclave at 0.11 MPa-0.12 MPa, 121℃-126℃ for 25 min, when the medium temperature drops to about 60℃, dispense into φ90 mm sterile petri dishes in the clean bench, about 20 ml per dish, then it is PDA flat plate medium.
[0033] 3.1.2 Tissue separation Select the fruiting bodies of Morchella angusticeps, and screen the wild fruiting bodies with large size, dark color, mushroom-shaped robustness and no pollution for tissue separation.
[0034] Use tweezers to clamp about (1.0 x 1.0) cm 2 Size tissue blocks, rinse several times with sterile water in a clean bench (tissue will absorb and swell), fully absorb surface moisture with sterile paper, then cut into sesame size tissue blocks with sterile scissors, inoculate on PDA flat plate medium, inoculate 3 blocks per plate, and inoculate at least 10 plates per fruiting body.
[0035] 3.1.3 Mycelium purification Place the separation plates of step 3.1.2 in a constant temperature incubator at 23℃, after 2-3 days, white mycelium will grow from the tissue blocks and their surroundings, promptly pick the tip of the colony with fast germination, fast growth speed and more mycelium branches for transfer and purification, inoculate 1 block per plate, continue to culture until the mycelium covers the plate Figure 2 ). Select the plates with better growth corresponding to each fruiting body and number them as the plate mother strain for the next test.
[0036] 4 Mycelium growth observation PDA flat plate medium: preparation method is step 3.1.1.
[0037] Use a 5 mm diameter puncher to transfer the mycelium blocks with consistent age and equal size from the plate mother strain of step 3.1.3 to the center of the PDA flat plate medium, and incubate at 20℃ in the dark, draw a cross after the mycelium germinates, and stop drawing when the mycelium of one plate grows first; observe the development of aerial mycelium, the color and distribution of sclerotia, and the intensity of mycelial pigment according to the specific methods of "Guidelines for Specificity, Uniformity and Stability Testing of Plant Varieties. Morchella", calculate the mycelium growth rate, repeat 3 times for each strain, and refer to Table 4 for the observation results.
[0038] Table 4 Mycelial growth characteristics of strains
[0039] Note: 20℃, light-avoiding culture for 7d to observe the development of aerial mycelium, sclerotia color and distribution, 20℃, light-avoiding culture for 10d to observe the intensity of mycelium pigment From the observation of mycelial growth, the aerial mycelium of strain ZQ1-1 was developed, followed by strains ZQ1-4, ZQ1-5, ZQ1-6, and the aerial mycelium of strains ZQ1-2, ZQ1-3 was relatively weak; strains ZQ1-1, ZQ1-5, ZQ1-6 had sclerotia, and the sclerotia were white and randomly distributed; strains ZQ1-2, ZQ1-3, ZQ1-4 had no sclerotia; after light-avoiding culture for 10d, the mycelium of strains ZQ1-1, ZQ1-4, ZQ1-5 was white or very light yellow, and almost no obvious pigment was produced, while the mycelium of strains ZQ1-2, ZQ1-3, ZQ1-6 showed obvious light yellow; the mycelial growth rate of strains ZQ1-2, ZQ1-4, ZQ1-5, ZQ1-6 was outstanding, and compared with strains ZQ1-1, ZQ1-3, the mycelial growth rate of strains ZQ1-1, ZQ1-3 was general, but the average growth rate of the two strains was greater than 0.7cm / d after 6d of culture.
[0040] 5 Preparation of master strain 5.1 Preparation of master strain medium The master strain medium includes, by mass percentage, 40% master strain culture material and 60% moisture.
[0041] The master strain culture material includes, by mass percentage, 60% grass charcoal soil, 25% chaff, 13% wood chips and 2% lime.
[0042] Fresh and non-molded culture material is selected, and the grass charcoal soil, chaff and wood chips are pre-wetted. The wood chips need to be intermittently watered, turned and leavened until there is no white core. Then the culture materials are mixed and stirred according to the proportion to prepare the fungus material. The fungus material is loaded into 500mL bottles for sterilization at 0.11MPa~0.12MPa and 121℃~126℃ for 2.5h, and is ready for use.
[0043] 5.2 Inoculation of master strain The plate mother strain selected in step 3.1.3 is taken out and reserved, and the surface is sterilized in a clean bench. Then the plate is opened on the side of the alcohol lamp flame, and about (1.5×1.5)cm 2 square mother strain is quickly taken out with a clean forceps and placed in the master strain bottle prepared in step 5.1.
[0044] 5.3 Culture of master strain The inoculated stock of step 5.2 is placed in a culture box for light-free management, and the temperature of the culture box is controlled at 20℃. After about 20 days, the original strains of different strains are obtained.
[0045] 6 Cultivated species preparation and observation The cultivated species culture medium comprises, by mass percentage: 40% cultivated species culture material, and 60% moisture.
[0046] The cultivated species culture material comprises, by mass percentage: 70% wheat, 12% corn cob, 10% rice husk, 5% bran, 2% gypsum, and 1% lime.
[0047] 6.1 Cultivated species preparation Fresh and non-molded culture material is selected. The wheat is soaked until there is no white core, and then taken out and spread to dry the surface. The corn cob is intermittently watered, turned over, and allowed to rise until there is no white core. The rice husk is pre-wetted. The three are mixed together in proportion. The bran, gypsum, and lime are mixed together in proportion and dry mixed uniformly. Finally, all the raw materials are mixed and stirred uniformly to prepare the cultivated species culture material. A polypropylene bag with a length, width, and thickness of 33cm x 17cm x 0.05mm is selected to pack the material, with 1.0kg of material per bag. The bag is sealed with a 3.8cm breathable food fungus non-woven fabric cover. Under the conditions of 0.11MPa~0.12MPa and 121℃~126℃, the material is autoclaved for 2.5h. When the temperature drops to 20℃, the prepared original strain of step 5.3 is inoculated under sterile conditions, and then moved to a culture room for uniform cultivation. The specific cultivation conditions are as follows: the temperature is controlled at 20℃, the cultivation is carried out in the dark, the air is ventilated 1~2 times per day, and each time is 25min~30min to keep the air fresh. After about 30 days, the cultivated species of different strains are obtained.
[0048] 6.2 Observation of cultivated species After the cultivated species is cultured for 15 days, the color of the sclerotia is observed according to the "Guidelines for Testing the Specificity, Uniformity and Stability of Plant Varieties. Morchella" method. The observation results are shown in Table 5.
[0049] Table 5 Color of cultivated species sclerotia
[0050] Through the observation of the cultivated species sclerotia, the cultivated species of strains ZQ1-1 and ZQ1-6 all have sclerotia, and the cultivated species of strains ZQ1-2, ZQ1-3, ZQ1-4, and ZQ1-5 only have individual sclerotia.
[0051] 7 Mushroom production test The overwintering mushroom production test is carried out in a sunlight greenhouse, and the production season is from early December to the following March.
[0052] 7.1 Sowing According to the ridge width 1.0m, ridge height 0.3m, ridge ditch width 0.5m ridge, length depending on the shed, the prepared cultivation seed in step 6.1 is crushed into 0.5~1.0m 3 Size, using the way of strip planting evenly into the ditch (use the amount of seed 150kg / 667m 2 ), flatten the ridge soil, cover the fungus, and spray water in 24h to keep the soil moist.
[0053] 7.2 Exogenous nutrition bag making After sowing, start making exogenous nutrition bag, which includes 40% of nutrition bag culture medium and 60% of water; the exogenous nutrition bag ingredients include 60% of wheat, 37% of sawdust, 2% of gypsum and 1% of lime.
[0054] Fresh, non-molded culture medium is selected, wheat is soaked until there is no white core and is spread to dry until the surface is not obvious water, sawdust core is intermittently watered, turned over and leavened until there is no white core, and the two are mixed together according to the proportion; gypsum and lime are mixed together according to the proportion, dry mixed uniformly, and finally all the raw materials are mixed and stirred uniformly to prepare the exogenous nutrition bag ingredients (water content 60wt%). A 15cm×30cm polyethylene bag is selected, 0.5kg per bag, high pressure sterilization for 2.5h, and used after cooling.
[0055] 7.3 Exogenous nutrition bag placement After 7d of sowing, a large amount of white fungus occurs on the ridge, at this time, the exogenous nutrition bag is placed, two 8cm~10cm long and 0.5cm wide slits are made on the longitudinal axis of the exogenous nutrition bag with a knife tip, the opening is downward and close to the soil, the bag spacing is kept at 0.5m, 2500 bags are placed per 667m 2 (acre), and finally a small shed is built along the ridge and covered with black mulch with air holes.
[0056] 7.4 Management The temperature in the shed after sowing is kept below 20℃, the soil temperature is kept at 1℃-16℃, the soil moisture content is kept at 25%-30%, and fresh air is ventilated every day to make the mycelium reproduce rapidly; after 80 days of mycelium management, when the soil temperature is stable at 5℃-8℃, the black film is removed, a small amount of water is sprayed to irrigate the ridge surface, the soil humidity is kept at 30%-35%, and at the same time, the ventilation is increased and the air in the shed is kept fresh, and the primordium is formed after 3-5 days. During the primordium growth stage, do not spray water, keep the small environment stable by closing the shed and reducing ventilation, keep the relative humidity of the air above 85%, keep the ridge surface temperature at 5℃-15℃, and maintain for 10 days. When the young mushroom grows to 2-3 cm, the temperature in the shed is kept below 18℃, the water is supplemented in time by micro-spraying, the relative humidity of the air is kept at 85%-90%, the soil moisture content is kept at 20%-30%, and the ventilation is strengthened, and the harvest can be completed after 15-20 days. During the entire harvest period, record the yield of each harvest and calculate the total yield. The mushroom test results are shown in Table 6. Figures 3-4
[0057] Table 6 Yield statistics table of mushroom test
[0058] 8 Screening The mycelial growth and mushroom test of 6 wild Morchella septentrionalis isolates were compared, and the strain numbered ZQ1-1 with fast mycelial growth speed, rich sclerotia, not easy to age, strong primordium formation ability, early mushroom and high yield was screened out, and the strain was numbered YYZQ-220421 Morchella septimelata ), preserved in China Center for Type Culture Collection, located at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, preserved on July 3, 2024, and the preservation number is CCTCC NO: M20241468.
[0059] Example 2 Strain test In this example, the new strain of Morchella septentrionalis YYZQ-220421 obtained by domestication in Example 1 was tested.
[0060] 1 Antagonistic test The new strain of Morchella septentrionalis YYZQ-220421 of this example, the Morchella esculenta Mel-211942 strain (Yang Q, Wang S X, Wang H F, et al. Molecular identification of 21 wild Morchella strains collected from Gannan prefecture [J]. Gansu Science and Technology, 2021, 52(05): 50-52) and the fruiting body isolated strain ZQ11-1 of Morchella septentrionalis ZQ-11 were used as test materials, and the test method referred to NY / T1845 Edible fungus strain differential identification antagonistic reaction.
[0061] Antagonistic test plate medium: same as PDA plate medium, the specific preparation method is step 3.1.1.
[0062] The Morchella septentrionalis strain YYZQ-220421, the Morchella septentrionalis strain Mel-21 1942 and the Morchella septentrionalis strain ZQ11-1 were inoculated and cultured on the antagonistic test plate medium, and the culture conditions were 20℃ constant temperature culture for 7d, and the test results can be referred to Table 7 and Table 8. Figure 5
[0063] Table 7 Morchella antagonistic test
[0064] Note: "+" indicates antagonism.
[0065] The antagonistic experiment shows that the Morchella septentrionalis strain YYZQ-220421 is different from the Morchella septentrionalis strain Mel-21 1942 and the Morchella septentrionalis strain ZQ-11.
[0066] 2 Fertility test 2.1 Mycelium culture The activated strain block of the Morchella septentrionalis strain YYZQ-220421 was inoculated in a liquid CYM medium, and was cultured at 20℃ for 7d-10d, then the mycelium was collected, washed repeatedly with sterile water, and the water was absorbed with a sterilized filter paper, and was used for standby.
[0067] 2.2 Genomic DNA extraction The total DNA of the test mycelium was extracted by using a column type HP Fungal DNA Kit D3195-01 reagent kit.
[0068] 2.3 PCR amplification The mating type gene specific primers Mat1-1-1TF / R (AAAACGCTCTATCGCCACCA / TGCGAAGTTGCGTTTTCAGG, as shown in SEQ ID NO: 9-SEQ ID NO: 10) and Mat1-2-1TF / R (ATGAAGGCTGTTCGCCAGAA / TGGTGCTCTCGTGCAGATTT, as shown in SEQ ID NO: 11-SEQ ID NO: 12) were used for amplification, and the amplification conditions were the same as step 2.2 in Example 1.
[0069] 2.4 Electrophoresis detection The PCR product was detected by 1% agarose gel electrophoresis, and the electrophoresis band was photographed and recorded by a gel imaging system. The MAT1-1 and MAT1-2 amplification bands were obvious, indicating that the Morchella septentrionalis strain YYZQ-220421 had mating genes. Figure 6 ).
[0070] Example 3 Evaluation of production performance 1 Comparative test The Morchella strain YYZQ-220421 of the present application and the introduced Morchella varieties Chuanmorchella No. 6, Liumei No. 13, G3, G8, G10, G18, 205, Gaoyuanhong, and A were respectively cultivated in the same sunlight greenhouse, and the specific methods were as follows: 1.1 Strain preparation: The master strains of the strain YYZQ-220421, Chuanmorchella No. 6, Liumei No. 13, G3, G8, G10, G18, 205, Gaoyuanhong, and A were prepared according to the method of step 5 of Example 1 and the master strain culture medium 11 of step 4 of Example 2, and were ready for use.
[0071] 1.2 Sowing, exogenous nutrient bag preparation, placement, and management: The same as step 7 of Example 1.
[0072] 1.3 Harvesting: During the entire harvesting period, the yield and quantity of each harvesting were recorded, the total yield and single mushroom weight were calculated, and 30 fruiting bodies were randomly selected on the harvesting day to observe the shape and color of the cap, stem, and flesh of the fruiting body. The test results are shown in Tables 7-10. Figure 7
[0073] Table 8 Yield per mu of different Morchella varieties
[0074] Table 9 Agronomic traits of fruiting bodies of different Morchella varieties
[0075] Table 10 Subordinate function values and ranking of production performance indicators of different Morchella varieties
[0076] The yield of the Morchella angusticeps strain YYZQ-220421 of the application is (658.22±26.39) kg / mu according to the suitable cultivation method, which is the first among all widely used varieties; the fruiting body is relatively large, nearly oval, the cap is medium to dark brown, the rib is relatively dense, the stem is yellowish white, trapezoidal, thin and short; the cap length is 50.83mm~72.30mm, the average is 62.076mm, the cap width is 25.34mm~45.86mm, the average is 35.635mm, the cap thickness is 4.64mm~11.1mm, the average is 7.905mm, the stem length is 2.4cm~4.4cm, the average is 3.078cm, and the stem diameter is 0.6cm~1.5cm, the average is 1.009cm. The ten Morchella varieties are comprehensively evaluated by the membership function method, and the Morchella angusticeps strain YYZQ-220421 of the application is the first.
[0077] 2 Regional test The Morchella angusticeps strain YYZQ-220421 is cultivated in different regions, different facilities and different bifurcations, and the specific cultivation method is the same as step 1 of embodiment 4, and the test results can be referred to Figures 8-9 , Table 11.
[0078] Table 11: Regional test of strain YYZQ-220421
[0079] The regional test shows that the Morchella angusticeps strain YYZQ-220421 has strong adaptability and relatively wide mushrooming temperature, and has good primordium formation ability. Even if the primordium is killed by high temperature and low temperature outside, as long as it is still in the primordium formation stage and the conditions are suitable, the primordium will form. Compared with the rest of the varieties planted in each test point, the strain YYZQ-220421 has early fruiting and long fruiting period.
[0080] The above only describes the preferred embodiments of the application and is not intended to limit the application. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the application shall be included in the protection scope of the application.
Claims
1. A domesticated strain of Morchella septempunctata, characterized by: The domesticated strain is Morchella septempunctata Morchella septimelata YYZQ-220421, this strain was deposited in the China Center for Type Culture Collection on July 3, 2024, with the deposit number CCTCC NO:M 20241468.
2. Application of the domesticated strain of Morchella septempunctata as claimed in claim 1 in Morchella agricultural cultivation.
3. Use of the domesticated strain of Morchella septempunctata as claimed in claim 1 as a parent in breeding.
4. The use according to claim 3, characterized in that: The breeding includes self-breeding, hybrid breeding or molecular breeding.
5. Mycelium obtained by culturing the domesticated strain of Morchella chinensis according to claim 1.
6. The fruiting body obtained by cultivating the domesticated strain of Morchella chinensis according to claim 1.
7. Use of the fruiting body or extract thereof as claimed in claim 6 in food processing.
8. Use of the fruiting body or extract thereof as claimed in claim 6 in the pharmaceutical field.