Separation and application of Metarhizium rileyi

By isolating and applying Metarhizium rileyiSY_M1, various formulations of fungal agents were prepared and sprayed onto plants to control fall armyworm, solving the problems of high cost and ecological threat of chemical control and achieving the effect of biological control.

CN120796081APending Publication Date: 2025-10-17CHINA AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511001743.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-21
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

The fall armyworm causes serious damage to corn production. Chemical pesticide control increases costs and threatens ecological security, necessitating the development of green and sustainable control technologies.

Method used

Metarhizium rileyiSY_M1 was isolated and applied to control fall armyworm by preparing fungal agents containing spores, mycelia, and infected plant tissues. The formulations included liquid, emulsion, and suspension, which were sprayed onto plants to control the pest.

Benefits of technology

It significantly reduces the mortality rate of fall armyworm larvae and pupae, provides a new option for biological control, reduces the use of chemical pesticides, and protects ecological security.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of microbial screening, and particularly relates to separation of Metarhizium rileyi and application of Metarhizium rileyi. According to the invention, diseased bombyx batryticatus is collected from corn field soil in Sanjian City, Hainan Province, a metarhizium anisopliae strain is separated, the metarhizium anisopliae strain is subjected to sequencing comparison and identification as Metarhizium rileyi through a fungus ITS4 / 5 universal primer pair, the strain number is SYM1, and the preservation number is CGMCC NO.41843. When the strain is used for treating eggs, larvae (1-6 years old) and pupas of the spodoptera frugiperda, the strain is found to have a relatively high fatality rate on low-age larvae (2-4 years old) and pupas of the spodoptera frugiperda, and the fatality rate is increased along with the increase of the use concentration and the increase of the use time. The invention provides a new scheme for biological control of spodoptera frugiperda.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial screening technology, and specifically relates to a strain of Metarhizium anisopliae Metarhizium rileyi Separation and application of 。 Background Art

[0002] Fall Armyworm Spodoptera frugiperda (JE Smith), native to tropical and subtropical regions of the Americas, has now invaded numerous countries and regions worldwide, significantly impacting global food security. It can harm over 350 crops, including corn, wheat, rice, soybeans, and sorghum, particularly targeting corn at all stages, from seedling to ear and maturity. Since its invasion of my country in late 2018, it has severely damaged corn production and has been twice included in the List of Category I Crop Pests and Diseases.

[0003] Hainan Province has favorable phenological conditions for the growth, development, and reproduction of the fall armyworm, making it a year-round breeding area. Since invading Hainan in late April 2019, it has, in just a few years, become a major pest of corn in the field. This has led to a significant increase in the number of chemical pesticide applications per corn crop, from 4.27–5.47 in 2019 to 7.73–8.77. The overuse of chemical pesticides not only increases agricultural production costs, threatens the safety of farmland ecosystems, and creates problems such as pesticide residues. Therefore, the development of green and sustainable control technologies for the fall armyworm is urgently needed.

[0004] Entomopathogenic fungi are a class of insect pathogenic microorganisms originating from the soil. More than 60% of insect deaths in nature are caused by fungal diseases. Therefore, entomopathogenic fungi have also been developed for use in biological pest control. After the fall armyworm invaded my country, from the initial chemical emergency prevention and control to the current green ecological prevention and control, the exploration and utilization of entomopathogenic fungi to control fall armyworm has gradually become a research hotspot. Hainan Province has been the main area for corn breeding in southern my country for many years, and has played a good role in promoting the development of my country's corn seed industry. Therefore, it is necessary to develop and utilize more efficient Hainan native biocontrol fungi strains of fall armyworm to safeguard the development of corn breeding in southern China. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to prevent and control the Noctuidae insects (Spodoptera frugiperda) from damaging plants. For this purpose, a strain of Metarhizium anisopliae is provided, which is Metarhizium raigensis ( Metarhizium rileyi )SY_M1, which is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms (CGMCC for short, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), with the deposit number CGMCC No.41843.

[0006] The present application also provides a composition containing the Metarrhizium anisopliae. The active ingredient of the composition can contain the Metarrhizium anisopliae or / and metabolites of the Metarrhizium anisopliae or / and culture of the Metarrhizium anisopliae.

[0007] The culture can be the substance obtained by culturing the Metarrhizium anisopliae in a microbial culture medium. The culture can be obtained by culturing the Metarrhizium anisopliae in a SMAY culture medium in a 28℃ incubator for 7-15 days.

[0008] The formula of the SMAY culture medium is: 1 L distilled water plus 10 g maltose, 10 g proteose peptone, 10 g yeast extract powder, 16 g agar, 121℃ high-temperature sterilization for 15 min.

[0009] The composition includes culture containing spores, mycelium of the Metarrhizium anisopliae, plant tissues infected by the Metarrhizium anisopliae and / or substrates for culturing the Metarrhizium anisopliae. The spores and mycelium both belong to the Metarrhizium anisopliae, and the plant tissues infected by the Metarrhizium anisopliae also contain corresponding mycelium.

[0010] The active ingredient of the above-mentioned composition can also contain other biological components or non-biological components, and other active ingredients of the above-mentioned composition can be determined by those skilled in the art according to the effect of the composition.

[0011] The above-mentioned composition can also be a microbial agent.

[0012] The above-mentioned microbial agent can be a microbial inoculant.

[0013] The above-mentioned microbial agent refers to a viable microbial preparation processed from the fermentation broth or solid fermentation product of the target microorganism after expansion using a carrier as an adsorbent.

[0014] In the above-mentioned microbial agent, the dosage form of the microbial agent can be various dosage forms, including but not limited to liquid, emulsion, suspension, powder, granule, wettable powder or water dispersible granule, etc.

[0015] According to the need, the microbial agent can also include a carrier. The carrier can be a solid carrier or a liquid carrier.

[0016] The composition is any one of the following: A1) a composition with biocontrol effect; A2) a composition for controlling noctuidae insects; A3) a composition for controlling Spodoptera exigua.

[0017] The Spodoptera exigua can be Spodoptera exigua larvae.

[0018] The present application also provides a method for preparing the above-mentioned composition, which includes the step of using the Metarrhizium anisopliae as a composition ingredient.

[0019] The application also provides the use of the Metarrhizium or the composition in the preparation of a product.

[0020] The product has at least one of the following properties: B1) has a biocontrol effect; B2) controls noctuidae insects; B3) controls Spodoptera exigua.

[0021] The application also provides a method for controlling Spodoptera exigua from damaging a plant, the method comprising contacting a biocontrol product and the plant to control Spodoptera exigua, the biocontrol product being the Metarrhizium or the composition.

[0022] In the method, the contacting of the biocontrol product and the plant can be spraying the biocontrol product onto the plant (such as the leaf).

[0023] The biocontrol product can be a suspension of the Metarrhizium and an aqueous solution containing a suspending agent. The suspending agent is Tween-80 or other non-ionic surfactant, preferably Tween-80, with a concentration of 0.05% (V / V).

[0024] Further, the concentration of the spore suspension can be 1.0×10 4 -1.0×10 8 / mL.

[0025] Further, the concentration of the spore suspension can be 1.0×10 8 / mL.

[0026] In a specific embodiment of the application, the Spodoptera exigua can be in the 1st instar-6th instar, pupa and / or egg stage.

[0027] Further, the Spodoptera exigua can be in the 2nd instar-4th instar and / or pupa.

[0028] For larva control, the leaf dipping method is preferred, and for egg and pupa stages, the dipping method is preferred.

[0029] In the above, the plant can be any of the following: C1) an angiosperm plant; C2) a monocotyledon plant; C3) a plant of the order Poales; C4) a plant of the family Poaceae; C5) a plant of the genus Zea; C6) corn.

[0030] The application has the following beneficial effects: the application isolates a strain of Metarrhizium lewisi Metarhizium rileyi , which can be used to control Spodoptera exigua, especially for low instar larvae and pupae, and the application provides a new choice for biological control of Spodoptera exigua.

[0031] Deposit Description Strain name: Metarhizium rileyi Latin name: Metarhizium rileyi Strain number: SY_M1 Preservation agency: China General Microbiological Culture Collection Center Abbreviation of preservation agency: CGMCC Address: No. 1, Yihuan Road, Beijing, China Preservation date: March 18, 2025 Preservation center registration number: CGMCC No. 41843 BRIEF DESCRIPTION OF DRAWINGS Figure 1 Photo of diseased beetles collected in the field.

[0032] Figure 2 : Metarhizium rileyi Grown on SMAY medium for about 7-15 days.

[0033] Figure 3 : 3rd instar larvae of Spodoptera exigua were Metarhizium rileyi infected with different concentrations (1.0×10 4 -1.0×10 8 spore suspensions.

[0034] Figure 4 : 3rd instar larvae of Spodoptera exigua were Metarhizium rileyi covered with green mycelium 1-3 days after being infected and died.

[0035] Figure 5 : Hatchability of eggs of Spodoptera exigua after Metarhizium rileyi being infected with spore suspension (1.0×10 8 spores / mL).

[0036] Figure 6 : Pupation rate of pupae of Spodoptera exigua after Metarhizium rileyi being infected with spore suspension (1.0×10 8 spores / mL).

[0037] Figure 7 : Survival curve of larvae (1-6 instars) of Spodoptera exigua after Metarhizium rileyi being infected with spore suspension (1.0×10 8 spores / mL).

[0038] Figure 8 : Survival curve of 3rd instar larvae of Spodoptera exigua after Metarhizium rileyi being infected for 24 and 72 h. DETAILED DESCRIPTION

[0039] The application will be further described in detail below with specific embodiments, and the examples given are only for illustration of the application, not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0040] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0041] In the following examples, survival analysis and variance analysis tools in GraphPad Prism 8 software are used to perform survival analysis on the statistical data of each treatment group and draw the result graph.

[0042] Example 1 Metarhizium rileyi Metarhizium rileyi Collection, isolation and identification 1. Collection of diseased beetles: The diseased beetles were collected in a corn field in Sanya City, Hainan Province (N18.362499°, E109.213189°), and brought back to the laboratory for photography, isolation and identification, see Figure 1 .

[0043] 2. Isolation and identification of biocontrol fungi: The infected fungi of the diseased insects were first sterilized with 75% ethanol for 1 min, washed with sterile water for 3 times, and then part of the insect tissue was cut with a sterile knife and inoculated on PDAY medium with a streptomycin concentration of 50 μg / mL. The culture was carried out at 28±1℃, 75±5% for 7-15 days, and the single colonies that grew were inoculated on PDAY medium with a streptomycin concentration of 50 μg / mL for further purification culture. Then, the culture was transferred to SMAY medium without streptomycin and cultured at 28℃ for 15 days. Pure spore-producing colonies can be observed, and the specific appearance can be seen in Figure 2 .

[0044] The preparation method of PDAY medium is as follows: 200 g peeled potatoes are placed in 800 mL distilled water, boiled and filtered to obtain juice in a 1 L beaker. Then, 5 g yeast extract, 20 g sucrose and 15 g agar powder are added to the 1 L beaker and stirred uniformly. Distilled water is added to make up to 1 L, and sterilized at 121℃ for 15 min under high temperature and high pressure.

[0045] The preparation method of SMAY medium is as follows: 1 L of distilled water is added with 10 g of maltose, 10 g of proteose peptone and 10 g of yeast extract powder, and 16 g of agar is added. The mixture is sterilized at 121℃ for 15 min.

[0046] 3. Molecular identification of the strain: The isolated strain was extracted by CTAB method to extract genomic DNA, amplified and sequenced by fungal universal ITS4 (5'-TCCTCCGCTTATTGATATGC-3') / ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3') primer pair, and the sequence obtained by sequencing was 601 bp (SEQ ID NO: 1), and the sequence alignment analysis was confirmed by using NCBI website BLAST tool as Metarhizium rileyi Metarhizium rileyi .

[0047] The amplification product is sequence 1 (SEQ ID NO: 1, 601 bp) in the sequence list, and the specific sequence is as follows: 5'-TCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCATGTGAACTTATACCCTTTTCCTGTTGCCTCGGCGGGTCATTTGCCCCGGACCGGGCTCGTCCAGAGCCCGCCCGGAAACAGGCGCCCGCCGCGGGACCGAAACTCTGTATCTCTTAGCCTTTGGCACGTCTGAGTGGAATCATACAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGCGGTTTGGTGTTGGGGGCCGGCGATTGTCAGCTGGGCCGCTCAGGCGGTTCCCTGCGGCGCCGCCCCCGAAATGAATTGGCGGCCCCGTCGCGGCCTCCTCTGCGTAGTAGCACAACCTCGCAACAGGAGCGCGGCGCGGCCACTGCCGTAAAACGCACAAACTTCTCCAAGAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA-3'.

[0048] The identified strain was deposited in the China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Michen West Road, Beijing City, Chaoyang District, No. 3, Building 3) on March 18, 2025, with a preservation number of CGMCC No. 41843, and named SY_M1. Hereinafter referred to as SY_M1 or Metarhizium rileyi SY_M1.

[0049] Example 2 Metarhizium rileyi Metarhizium rileyi Pathogenicity test of SY_M1 on Spodoptera exigua 1. Test materials 1.1. Test strain: The test strain is the strain isolated and identified in Example 1 above. Metarhizium rileyi SY_M1.

[0050] 1.2 Test insects: Spodoptera exigua 3rd instar larvae were collected from corn fields in Sanya City and were reared indoors for 5 generations before being used for pathogenicity test.

[0051] 1.3 Preparation of molecular spore suspension: First, prepare a 0.05% Tween-80 solution, sterilize and reserve. Use a sterile medicine spoon to scrape conidiospores into a 5 mL sterile glass tube containing glass beads and 0.05% Tween-80 solution, vortex for 2 min, and count the number of spores under a microscope. Dilute the spore suspension with the above-mentioned sterile Tween water to adjust the spore concentration to 1.0×10 8 spores / mL (referred to as 1.0×10 8 spore suspension), and dilute according to the gradient to obtain a spore suspension with a spore concentration of 1.0×10 8 spores / mL (referred to as 1.0×10 7 spore suspension), 1.0×10 7 spores / mL (referred to as 1.0×10 7 spore suspension), 1.0×10 6 spores / mL (referred to as 1.0×10 6 spore suspension), 1.0×10 6 spores / mL (referred to as 1.0×10 5 spore suspension), 1.0×10 5 spore suspension), 1.0×10 5 spore suspension), 1.0×10 4 spore suspension), and 1.0×10 4 spore suspension). 4

[0052] 2. Method for testing pathogenicity of the strain ​Pathogenicity test was conducted by leaf-dipping and insect-dipping methods. 2.1 Leaf-dipping method: Corn leaves with a diameter of 1.5 cm were cut and dipped in different concentrations (1.0×10 4 - 1.0×10 8 spore suspensions for 1 min. The control group was treated with 0.05% Tween-80 solution (v / v) without spore suspension. After drying, the corn leaves were fed to the selected Spodoptera frugiperda larvae (1-6 instar), with 2 leaves per larva. The artificial feed was replaced with fresh feed 24 h later, and the number of dead larvae in each treatment group was counted every 24 h. The survival analysis was conducted after 7-10 days of observation.

[0053] 2.2 Insect-dipping method: Spodoptera frugiperda eggs (with a laying time of <24 h) and pupae (with a pupating time of <24 h) were dipped in 1.0×10 8 spore suspensions for 1 min. The control group was treated with 0.05% Tween-80 solution (v / v) without spore suspension. After drying, the eggs and pupae were placed in sterile culture plates, and the egg hatching and pupal eclosion were observed and counted within 3-10 days to calculate the egg hatching rate and pupal eclosion rate.

[0054] Each treatment was set up in triplicate, with 20 test insects per replicate.

[0055] 3. Test results 3.1 Effect of different concentrations of spore suspensions on the pathogenicity of the strain The pathogenicity of different concentrations (1.0×10 4 -1.0×10 8 spore suspensions on 3rd instar Spodoptera frugiperda larvae was determined by leaf-dipping method. The results showed that at concentrations of 1.0×10 5 -1.0×10 8 , there was a significant difference in survival rate compared with the control group, and the survival rate of 3rd instar Spodoptera frugiperda larvae gradually decreased ( Figure 3 ) with increasing spore suspension concentration. The specific treatments were as follows: The test was set up with 6 treatments, including 1.0×10 4 treatment, 1.0×10 5 treatment, 1.0×10 6 treatment, 1.0×10 7 treatment, 1.0×10 8 treatment, and the control group (CK). Each treatment was set up in triplicate, with 20 test insects per replicate, and the survival analysis was conducted after 7 days of observation. The number of dead insects in each treatment group was counted every 24 h.

[0056] 1.0 x 10 4 Inoculant group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 4 The leaves were soaked in the inoculant for 1 min, allowed to dry, and fed to 3rd instar H. zea larvae selected for uniform size in 12-well plates, 2 leaves per larva, and replaced with artificial diet 24 h later.

[0057] 1.0 x 10 5 Inoculant group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 5 The leaves were soaked in the inoculant for 1 min, allowed to dry, and fed to 3rd instar H. zeta larvae selected for uniform size in 12-well plates, 2 leaves per larva, and replaced with artificial diet 24 h later.

[0058] 1.0 x 10 6 Inoculant group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 6 The leaves were soaked in the inoculant for 1 min, allowed to dry, and fed to 3rd instar H. zeta larvae selected for uniform size in 12-well plates, 2 leaves per larva, and replaced with artificial diet 24 h later.

[0059] 1.0 x 10 7 Inoculant group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 7 The leaves were soaked in the inoculant for 1 min, allowed to dry, and fed to 3rd instar H. zeta larvae selected for uniform size in 12-well plates, 2 leaves per larva, and replaced with artificial diet 24 h later.

[0060] 1.0 x 10 8 Inoculant group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 8 The leaves were soaked in the inoculant for 1 min, allowed to dry, and fed to 3rd instar H. zeta larvae selected for uniform size in 12-well plates, 2 leaves per larva, and replaced with artificial diet 24 h later.

[0061] Control group (CK): 1.0 x 10 4 Inoculant group: 1.0 x 10 4 The inoculant was replaced with 0.05% Tween-80 solution (v / v), and other operations were the same.

[0062] H. zeta larvae were Metarhizium rileyiAfter SY_M1 infection, the phenotype changed from white mycelium (Fig. 1A) to green conidia (Fig. 1B) in 1-3 days. Figure 4 Figure 4

[0063] 3.2 Effect of the same concentration of spore suspension on the pathogenicity of Spodoptera exigua eggs and pupae The survival rate of S. exigua larvae (1-6 instars) was determined by leaf dipping method under the condition of 1.0 x 10 8 Metarhizium rileyi The pathogenic effect of SY_M1 on S. exigua eggs and pupae was determined by immersing the eggs and pupae in 1.0 x 10 8

[0064] The results showed that the egg hatching rate of S. exigua treated by the immersing method was 56.58%, and the pupation rate of S. exigua treated by the immersing method was 2.47%, which was significantly lower than that of the control group. Figure 5 Figure 6

[0065] 3.3 Effect of the same concentration of spore suspension on the pathogenicity of different instar larvae of S. exigua The survival rate of S. exigua larvae (1-6 instars) was determined by leaf dipping method under the condition of 1.0 x 10 8

[0066] The 6 spore suspension treatment groups included Mr_1st, Mr_2nd, Mr_3rd, Mr_4th, Mr_5th, and Mr_6th, and the 6 control groups included CK_1st, CK_2nd, CK_3rd, CK_4th, CK_5th, and CK_6th. The treatment methods of the 6 spore suspension treatment groups were as follows: Mr_1st: Fresh corn leaves with a diameter of 1.5 cm were cut and immersed in 1.0 x 10 8 ​​​​​​​The larvae were fed with the bacterial agent for 1 min, and then the larvae were fed with 2 pieces of corn leaf per larva in a 12-well plate. The corn leaf was replaced with artificial diet after 24 h.

[0067] The Mr_2nd treatment group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 8 The larvae were fed with the bacterial agent for 1 min, and then the larvae were fed with 2 pieces of corn leaf per larva in a 12-well plate. The corn leaf was replaced with artificial diet after 24 h.

[0068] The Mr_3rd treatment group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 8 The larvae were fed with the bacterial agent for 1 min, and then the larvae were fed with 2 pieces of corn leaf per larva in a 12-well plate. The corn leaf was replaced with artificial diet after 24 h.

[0069] The Mr_4th treatment group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 8 The larvae were fed with the bacterial agent for 1 min, and then the larvae were fed with 2 pieces of corn leaf per larva in a 12-well plate. The corn leaf was replaced with artificial diet after 24 h.

[0070] The Mr_5th treatment group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 8 The larvae were fed with the bacterial agent for 1 min, and then the larvae were fed with 2 pieces of corn leaf per larva in a 12-well plate. The corn leaf was replaced with artificial diet after 24 h.

[0071] The Mr_6th treatment group: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 x 10 8 The larvae were fed with the bacterial agent for 1 min, and then the larvae were fed with 2 pieces of corn leaf per larva in a 12-well plate. The corn leaf was replaced with artificial diet after 24 h.

[0072] The corresponding CK group was treated with 1.0 x 10 8 The bacterial agent was replaced with 0.05% Tween-80 solution (v / v) without spore suspension, and other operations were the same.

[0073] Results show that: Metarhizium rileyi SY_M1 had significant pathogenic effect on 2-4 instar larvae of Spodoptera frugiperda, and made the survival rate of 3 instar larvae lowest. Figure 7 ).

[0074] 3.3 Influence of pathogenicity of spore suspension with same concentration on 3 instar larvae of Spodoptera frugiperda In the case of 1.0×10 8 The pathogenic effect of SY_M1 on 3 instar larvae of Spodoptera frugiperda was determined by leaf dipping method in the case of 1.0×10 Metarhizium rileyi The pathogenic effect of SY_M1 on 3 instar larvae of Spodoptera frugiperda was determined by leaf dipping method in the case of 1.0×10 8 The pathogenic effect of SY_M1 on 3 instar larvae of Spodoptera frugiperda was determined by leaf dipping method in the case of 1.0×10 CK_24h treatment group: fresh corn leaves with a diameter of 1.5 cm were cut, soaked in 0.05% Tween-80 solution (v / v) without spore suspension for 1 min, and then dried, and fed to the selected 3 instar larvae of Spodoptera frugiperda in 12-hole culture plates, 2 corn leaves per larva, and replaced with artificial feed for continuous feeding after 24 h.

[0075] CK_72h treatment group: fresh corn leaves with a diameter of 1.5 cm were cut, soaked in 0.05% Tween-80 solution (v / v) without spore suspension for 1 min, and then dried, and fed to the selected 3 instar larvae of Spodoptera frugiperda in 12-hole culture plates, 2 corn leaves per larva, fed every 24 h, a total of 3 times, and replaced with artificial feed for continuous feeding after 72 h.

[0076] Mr_24h treatment group: fresh corn leaves with a diameter of 1.5 cm were cut, soaked in 1.0×10 8 bacterium obtained in 1.3 for 1 min, and then dried, and fed to the selected 3 instar larvae of Spodoptera frugiperda in 12-hole culture plates, 2 corn leaves per larva, and replaced with artificial feed for continuous feeding after 24 h.

[0077] Mr_72h treatment group: fresh corn leaves with a diameter of 1.5 cm were cut, soaked in 1.0×10 8 bacterium obtained in 1.3 for 1 min, and then dried, and fed to the selected 3 instar larvae of Spodoptera frugiperda in 12-hole culture plates, 2 corn leaves per larva, fed every 24 h, a total of 3 times, and replaced with artificial feed for continuous feeding after 72 h.

[0078] It is found that the survival rate of the 3rd instar larvae of the fall armyworm is significantly decreased with the increase of the treatment time (from 24 h to 72 h) Figure 8 ).

[0079] Compared with the prior art, the application utilizes the Metarhizium anisopliae isolated from the diseased cadaver in a corn field Metarhizium rileyi The SY_M1 is used for biological control of the fall armyworm, and the strain has a significant lethal effect on the larvae and pupae of the fall armyworm, indicating that the strain has a great commercial development potential and has a good application prospect.

[0080] The above only describes the preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

[0081] The present application is described in detail above. For those skilled in the art, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the present application and without unnecessary experiments. Although the present application gives a special embodiment, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including the changes made by the conventional technology known in the art out of the range disclosed in the present application.

Claims

1. Metarhizium anisopliae, characterized in that The Metarhizium anisopliae is Metarhizium raigensis ( Metarhizium rileyi )SY_M1, which is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms (CGMCC for short, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), with the deposit number CGMCC No.41843.

2. A composition characterized in that The composition contains the green anisopliae described in claim 1.

3. The composition according to claim 2, characterized in that The composition is a culture, and the culture is a substance obtained by culturing the Metarhizium anisopliae in a microbial culture medium.

4. The composition according to claim 2, characterized in that The composition is a bacterial agent.

5. The composition according to any one of claims 2 to 4, characterized in that The composition is any one of the following: A1) Compositions with biocontrol effects; A2) Compositions for controlling insects of the family Noctuidae; A3) A composition for controlling fall armyworm.

6. A method for preparing a composition, characterized in that The composition is the composition according to any one of claims 2 to 5, and the method includes the step of using the green anisopliae according to claim 1 as a component of the composition.

7. Use of the Metarhizium anisopliae described in claim 1 or the composition described in claims 2-5 in preparing products.

8. The product according to claim 7, characterized in that The product has at least one of the following properties: B1) Has biological control effect; B2) Control of Noctuidae insects; B3) Control the fall armyworm.

9. A method for controlling plant damage caused by fall armyworm, characterized in that: The method comprises contacting a biocontrol product with a plant to control fall armyworm, wherein the biocontrol product is the green anisopliae described in claim 1 or the composition described in claims 2-5.

10. The composition according to claim 5, the product according to claim 8, or the method according to claim 9, characterized in that The plant is any one of the following: C1) Angiosperms; C2) Monocotyledons; C3) Gramineae; C4) Grasses; C5) Zea mays; C6) Corn.

Citation Information

Patent Citations

  • Metarhizium rileyi MRJCBT190808 and application thereof to control of spodoptera frugiperda

    CN110669676A

  • Metarhizium rileyi and application thereof

    CN111662828A

  • Metarhizium rileyi CDTLJ1 and application thereof

    CN112812976A