Engineering strain construction and high-yield expression method of high-yield soluble bacteriophage perforin Hol41 protein and application
By using a secretion signal peptide and codon-optimized phage perforin Hol41 gene in Pichia pastoris, combined with the AOX1 promoter and methanol induction, the problem of damage to host cells caused by the traditional expression system was solved, and efficient and high-yield expression and purification of soluble phage perforin Hol41 protein was achieved.
Patent Information
- Application Number
- CN202510955677.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-10-17
AI Technical Summary
Traditional prokaryotic expression systems damage host cells when expressing bacteriophage perforin Hol41, making it difficult to express it in large quantities and limiting its industrial production and application.
Pichia pastoris was used as the host cell, and the pPIC9K plasmid secreting the signal peptide and the codon-optimized phage perforin Hol41 gene were used. The AOX1 promoter and methanol induction were used to achieve efficient expression, and the soluble phage perforin Hol41 protein was purified by nickel column affinity chromatography.
The expression level of soluble bacteriophage perforin Hol41 protein is increased, the purification process is simplified, the toxicity to host cells is reduced, the expression time is prolonged, and the expression level is increased.
Smart Images
Figure CN120796094A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to construction of an engineered strain of high-yield soluble phage holin protein Hol41, a high-yield expression method and application. BACKGROUND
[0002] Holin Hol41 is a kind of membrane protein encoded by phage genes, which forms a hole in the host bacterial cell membrane, so that the cell contents flow out, thereby lysing the bacteria. Its unique antibacterial mechanism makes it have potential application value for multiple drug-resistant bacteria. However, due to its unique antibacterial mechanism, it will cause damage to the host cells when expressing holin in traditional prokaryotic expression systems (such as E. coli), thereby making it difficult to express in large quantities, and thus limiting the industrial production and application of phage holin Hol41. SUMMARY
[0003] The present application aims to overcome the defects in the prior art and provides an engineered strain of high-yield soluble phage holin protein Hol41, a high-yield expression method and application, which greatly improves the induced expression amount of soluble phage holin protein Hol41.
[0004] To achieve the above-mentioned purpose, the technical solutions adopted by the present application are as follows:
[0005] An engineered strain of high-yield soluble phage holin protein Hol41 uses fungi as host cells, and uses an expression plasmid capable of secreting a signal peptide to free express a phage holin Hol41 gene, thereby obtaining an engineered strain of high-yield soluble phage holin Hol41 protein.
[0006] As a further technical solution, the expression plasmid capable of secreting a signal peptide uses a p PIC9K plasmid.
[0007] As a further technical solution, the fungi uses Pichia pastoris GS115.
[0008] As a further technical solution, the phage holin Hol41 gene is a codon-optimized phage holin Hol41 gene.
[0009] As a further technical solution, the nucleotide sequence of the codon-optimized phage holin Hol41 gene is shown in SEQ ID NO: 1.
[0010] As a further technical solution, an optimized SUMO tag is inserted into the N terminus of the phage holin Hol41 gene.
[0011] As a further technical scheme, the nucleotide sequence of the optimized SUMO tag is shown as SEQ ID NO: 2.
[0012] As a further technical scheme, the bacteriophage holin Hol41 gene is expressed by the AOX1 promoter.
[0013] A high-yield expression method of soluble bacteriophage holin Hol41 protein, first, the engineering strain is inoculated into BMGY liquid medium, and cultured at 28 DEG C and 180 r / min until OD 600 is 2.0-4.0 (preferably 2.0), centrifuged, and the cell pellet is washed to remove glycerol, to obtain bacterial cells;
[0014] Then, the bacterial cells are transferred to BMMY liquid medium, and cultured at 28 DEG C and 180 r / min for 72 h, and the inducer is added to the culture medium every 24 h until the concentration of the inducer in the culture system is 0.2-1.4% (preferably 1.0%), to induce the engineering strain to produce soluble bacteriophage holin Hol41 protein, to obtain a fermentation broth containing soluble bacteriophage holin Hol41 protein;
[0015] The inducer is methanol.
[0016] A purification method of soluble bacteriophage holin Hol41 protein, the fermentation broth containing soluble bacteriophage holin Hol41 protein is subjected to solid-liquid separation to obtain supernatant, and then the supernatant is purified by nickel column affinity chromatography to obtain soluble bacteriophage holin Hol41 protein.
[0017] The soluble bacteriophage holin Hol41 protein produced by the high-yield expression method is applied to the preparation of enteritis salmonella bacteriostatic drugs.
[0018] The soluble bacteriophage holin Hol41 protein produced by the high-yield expression method is applied to the preparation of bacteriostatic drugs or preservatives as a bacteriostatic agent.
[0019] The amino acid sequence of the soluble bacteriophage holin Hol41 protein is shown as SEQ ID NO: 3.
[0020] Compared with the prior art, the beneficial effects of the present application are that:
[0021] 1. The eukaryotic expression system represented by Pichia pastoris of the present invention is used as a host cell. On the one hand, it is driven by a strong promoter and has high secretion capacity, post-translational modification function and high-density fermentation characteristics, which are suitable for the production and high yield of complex proteins. On the other hand, it belongs to fungi, and its cell membrane structure is different from that of bacteria. Perforin does not perforate its cell membrane. Compared with traditional prokaryotic expression systems, perforin does not damage the host cells during the expression process, thereby extending the expression time of perforin and increasing its expression level.
[0022] 2. The present invention uses a pPIC9K plasmid fused with a secretion signal peptide to express the perforin gene Hol41 in a free manner. This plasmid can guide the secretion of the recombinant perforin-SUMO fusion protein into the extracellular medium through the endoplasmic reticulum-Golgi apparatus pathway after protein synthesis. On the one hand, it can quickly remove the perforin with potential membrane-damaging activity from the intracellular environment, thereby minimizing its toxicity to the host yeast cells. On the other hand, because the target protein is mainly present in the extracellular medium with relatively simple components, the downstream protein purification process can be eliminated by breaking the cell wall, thereby simplifying the protein purification process.
[0023] 3. The present invention adopts promoter AOX1 and uses methanol as an inducer to induce promoter AOX1 to drive the expression of perforin gene. At the same time, the expression level of perforin gene Hol41 is increased by codon optimization, and the solubility of perforin gene Hol41 is improved by optimized SUMO tag design. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 The PCR amplification results of bacteriophage perforin Hol41 in Example 1;
[0025] exist Figure 1 Middle, M: Marker; 1-2: Hol41 amplified gene bands;
[0026] Figure 2 This is the map of the pPIC9K-SUMO-Hol41 recombinant plasmid in Example 1;
[0027] Figure 3 This is the electrophoresis diagram of the bacteriophage perforin Hol41 gene cloning amplification and recombinant plasmid verification product in Example 1;
[0028] exist Figure 3 Middle, M: Marker; 1: band amplified by primers Hol41-F and Hol41-R, 2: band amplified by primers Hol41-F and AOX1-R;
[0029] Figure 4 is an SDS-PAGE image of the fermentation broth supernatant at different inducer concentrations in Example 2;
[0030] In Figure 4 , M: Marker; 1: 0.2%, 2: 0.4%, 3: 0.6%, 4: 0.8%, 5:
[0031] 1.0%, 6: 1.2%, 7: 1.4%;
[0032] Figure 5 Results of SDS-PAGE and WB analysis of the phage holin Hol41 protein in Example 4;
[0033] In Figure 5 , A: SDS-PAGE analysis diagram; B: WB analysis diagram;
[0034] In A and B, M: Marker; 1: uninduced, 2: induced;
[0035] Figure 6 Results of S. enteritidis S4 bacteriostatic experiment in Example 5;
[0036] In Figure 6 , 1: PBS negative control; 2-4: holin treatment group. DETAILED DESCRIPTION
[0037] The technical solutions of the present application will be described below in conjunction with specific examples, apparently, the described examples are part of the embodiments of the present application, rather than all the embodiments. Based on the examples in the present application, all other embodiments obtained by those skilled in the art without making creative efforts are within the scope of protection of the present application.
[0038] In addition, it should be further pointed out that the term "comprise", "include" or any other variant thereof is intended to cover non-exclusive inclusion, so that the process, method, article or equipment including a series of elements not only includes those elements, but also includes other elements not explicitly listed, or includes elements inherent to such process, method, article or equipment.
[0039] Example 1: Construction of engineering strain
[0040] 1. Construction of recombinant plasmid pPIC9K-SUMO-Hol41
[0041] Using phage SP_4 gene as template, using phage holin Hol41 upstream primer Hol41-F: CGCGGATCCATGCTCAACCCACAAATCG and downstream primer Hol41-R: CCGCTCGAGTCACTGATGTTTCGG, the Hol41 base sequence band with a size of 330bp was obtained by PCR amplification (as shown inFigure 1 ) According to the codon bias of Pichia pastoris, the codon-optimized holin gene Hol41 (as SEQ ID NO: 1) was synthesized, and an optimized SUMO tag (as SEQ ID NO: 2) was added to the N-terminus of the holin gene Hol41 (the holin gene Hol41 and the SUMO tag were completed by GenScript Biotech Corporation); then it was inserted into the p PIC9K plasmid vector with an a-MF signal peptide to construct the p PIC9K-SUMO-Hol41 recombinant plasmid (as Figure 2 ), which was verified by primers Hol41 upstream primer and downstream primer and p PIC9K plasmid universal upstream primer Hol41-F: TAATACGACTCACTATAGGG and downstream primer AOX1-R: GCTAGTTATTGCTCAGCGG, and the results (see Figure 3 ) showed that the band size of the target fragment was consistent with the expected, and the sequencing result was 100% consistent with the Hol41 sequence.
[0042] 2. Construction of engineering strain:
[0043] After linearization of the correctly sequenced recombinant plasmid p PIC9K-SUMO-Hol41 with restriction endonuclease Sac I, it was electroporated into Pichia pastoris GS115, and the multi-copy transformants were screened by G418 resistance to obtain the engineering strain GS115-p PIC9K-SUMO-Hol41 with high yield of soluble phage holin Hol41 protein
[0044] Example 2: Screening of expression conditions of soluble phage holin Hol41 protein
[0045] The OD 600 value of Pichia pastoris GS115 in the logarithmic growth phase was 2.0-4.0, and the optimal growth temperature was 28-30℃. According to the characteristics of the three transmembrane domains and cytotoxicity of holin, the induction scheme of low OD 600 value and low temperature culture should be selected, so the induction conditions selected by this method were 28℃, and the OD 600 of the bacterial solution reached 2.0 when the inducer was added.
[0046] The positive expression strain GS115-p PIC9K-SUMO-Hol41 obtained in Example 1 was inoculated into 7 portions of BMGY liquid medium, respectively, and cultured at 28℃ and 180 r / min until the OD 600The culture was centrifuged at 2000xg for 5 min at 4°C. After the cell pellet was washed twice with physiological saline to completely remove glycerol. The cells were transferred to BMMY liquid medium and cultured at 28°C, 180r / min for 72h. Methanol was added to the culture medium every 24h to a final concentration of 1.0% to induce the engineered bacteria GS115-pPIC9K-SUMO-Hol41 to produce soluble bacteriophage holin Hol41 protein, and a fermentation broth containing soluble bacteriophage holin Hol41 protein was obtained.
[0047] The results are shown in Figure 4 SDS-PAGE, and in the sample group with a methanol addition concentration of 1.0%, the expression amount was the highest.
[0048] Example 3: High-yield expression of soluble bacteriophage holin Hol41 protein
[0049] The positive expression strain GS115-pPIC9K-SUMO-Hol41 obtained in Example 1 was inoculated into BMGY liquid medium, and cultured at 28°C, 180r / min until OD 600 The culture was centrifuged at 2000xg for 5 min at 4°C. After the cell pellet was washed twice with physiological saline to completely remove glycerol. The cells were transferred to BMMY liquid medium and cultured at 28°C, 180r / min for 72h. Methanol was added to the culture medium every 24h to a final concentration of 1.0% to induce the engineered bacteria GS115-pPIC9K-SUMO-Hol41 to produce soluble bacteriophage holin Hol41 protein, and a fermentation broth containing soluble bacteriophage holin Hol41 protein was obtained.
[0050] The initial medium (BMGY liquid medium) contains 1% yeast extract, 2% peptone, 100mM potassium phosphate buffer, 1.34% YNB, 1% glycerol, pH 6.0;
[0051] The induction medium (BMMY medium) contains 1% yeast extract, 2% peptone, 100mM potassium phosphate buffer, 1.34% YNB, pH 6.0; induced at 28°C for 72h.
[0052] Example 4: Protein purification and verification
[0053] First, the fermentation broth containing soluble bacteriophage holin Hol41 protein obtained in Example 3 was centrifuged at 6000xg for 5 min to obtain the supernatant;
[0054] Then, the obtained supernatant was purified by affinity chromatography using a nickel column, and the nickel column was washed 3-5 times with a washing solution, and the target protein was eluted with an elution solution to obtain the soluble phage holin Hol41 protein.
[0055] Finally, the soluble phage holin Hol41 was mixed with a protein loading buffer (5x) and reacted at 37°C for 15 min, and then identified by SDS-PAGE electrophoresis and subjected to WB detection, and the results are shown in Figure 5 After the soluble Hol41 protein expressed was purified and detected by SDS-PAGE, the soluble Hol41 protein obtained in this embodiment had a high purity without other protein bands, and the WB test further verified this conclusion
[0056] The washing solution formula is: 20 mM imidazole, 50 mM Tris, 500 mM NaCl, 10% glycerol, and hydrochloric acid is used to adjust the pH to 7.5;
[0057] The elution solution formula is: 250 mM imidazole, 50 mM Tris, 500 mM NaCl, 10% glycerol, and hydrochloric acid is used to adjust the pH to 7.5.
[0058] Example 5: Effect of soluble phage holin Hol41 protein on Salmonella enteritidis S4
[0059] Salmonella enteritidis S4 was cultured to the logarithmic phase, centrifuged at 2000xg for 5 min, the supernatant was discarded, and the bacterial pellet was resuspended in LB medium and adjusted to a McFarland turbidity of 0.5, and then plated on LB solid medium. The bacteriostatic activity of the soluble phage holin Hol41 protein obtained in Example 4 was determined by the Oxford cup method, and the results (see Figure 6 ) showed that the soluble phage holin Hol41 protein produced a clear inhibition zone on Salmonella enteritidis S4, and the diameter of the inhibition zone was measured to be 16 mm, indicating that the soluble phage holin Hol41 protein had a significant bacteriostatic effect on Salmonella enteritidis.
[0060] Example 6: Determination of the lysis spectrum of soluble phage holin Hol41 protein
[0061] Staphylococcus aureus ATCC33951, Streptococcus pneumoniae ATCC49619, Streptococcus dysgalactiae 27957, Salmonella enteritidis ATCC SE, Enterococcus faecalis ATCC29212, Escherichia coli strain ATCC25922 and other six kinds of clinically common pathogenic bacteria were cultured to the logarithmic growth phase, the bacterial bodies were collected by centrifugation at 2000xg for 5min, resuspended with LB medium and adjusted to McIlvaine turbidity 0.5, and then uniformly coated on LB solid medium plate. The lytic activity of the soluble phage holin Hol41 protein obtained in Example 4 on the above strains was detected by Oxford cup method, and the results (Table 1) showed that the soluble phage holin Hol41 protein showed different degrees of growth inhibition effect on the six kinds of pathogenic bacteria, suggesting that the soluble phage holin Hol41 protein had broad-spectrum bacteriostatic potential.
[0062] Table 1: Soluble phage holin Hol41 protein lysis spectrum and its bacteriostatic circle size
[0063]
[0064] Example 7: Influence of Pichia pastoris expression system and Escherichia coli expression system on the yield of soluble phage holin Hol41 protein
[0065] Test group: 200mL of the fermentation broth containing soluble phage holin Hol41 protein obtained in Example 2 was purified by the protein purification method shown in Example 3, and 11.35mg of soluble phage holin Hol41 protein was obtained. Therefore, the concentration of soluble phage holin Hol41 protein in the fermentation broth containing soluble phage holin Hol41 protein obtained in Example 2 was 5.6675mg / 100mL;
[0066] Control group: Step 1, construction of engineering strain pET28a(+)-SUMO-Hol41-BL21(DE3)
[0067] The optimized SUMO soluble tag as shown in the nucleotide sequence of SEQ ID NO. 5 was spliced to the plasmid pET28a(+), and the pET28a(+)-SUMO vector was obtained.
[0068] The codon-optimized phage holin Hol41 gene (as shown in SEQ ID NO. 4) was inserted into the pET28a(+)-SUMO vector by PCR using the phage SP_4 gene as a template, and the recombinant plasmid pET28a(+)-SUMO-Hol41 was obtained.
[0069] The recombinant plasmid pET28a(+)-SUMO-Hol41 was transformed into E. coli BL21(DE3) competent cells, then coated on LB plate containing 50 μg / mL kanamycin, cultured at 37°C for 12 h, and the positive clone bacteria, i.e. the engineered strain pET28a(+)-SUMO-Hol41-BL21(DE3) producing soluble phage holin protein, was obtained.
[0070] Step 2, induction expression of soluble phage holin protein
[0071] The pET28a(+)-SUMO-Hol41-BL21(DE3) was inoculated into 200 mL LB medium containing 50 μg / mL kanamycin, and cultured at 28°C until the OD 600 was 0.6-0.8, 0.8 mM IPTG was added, and the fermentation liquid was obtained after 8 h of induction expression;
[0072] Step 3, purification
[0073] After centrifugation of 200 mL fermentation liquid, the supernatant was discarded, and the bacterial cells were collected; the lysis solution containing 0.5% EDTA and 1% protease inhibitor was used for resuspension, and the ultrasonic crushing was performed at 300 W power, with a working cycle of 5 s and an intermittent cycle of 10 s, for 25 min, and the bacterial liquid was clear and transparent; after crushing, the supernatant was collected by centrifugation at 6000 x g at 4°C for 5 min;
[0074] Then the supernatant was purified by affinity chromatography with a nickel column, and the purification method was the same as that in Example 4;
[0075] The results showed that 3.41 mg of soluble phage holin protein Hol41 was obtained from 200 mL fermentation liquid; therefore, the concentration of soluble phage holin protein Hol41 in the fermentation liquid was 1.705 mg / 100 mL, which was much lower than that of the Pichia pastoris expression system.
[0076] The above-described embodiments are only preferred embodiments of the present application, and are not exhaustive of the feasible implementations of the present application. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present application should be considered to be included in the protection scope of the claims of the present application.
Claims
1. An engineered strain for high production of soluble bacteriophage perforin Hol41 protein, characterized in that: The fungus was used as a host cell, and an expression plasmid capable of secreting a signal peptide was used to express the bacteriophage perforin Hol41 gene episomally, thereby obtaining an engineered strain with high production of soluble bacteriophage perforin Hol41 protein.
2. The engineered strain according to claim 1, characterized in that The expression plasmid capable of secreting the signal peptide is pPIC9K plasmid.
3. The engineered strain according to claim 1, characterized in that The fungus used is Pichia pastoris GS115.
4. The engineered strain according to claim 1, characterized in that The bacteriophage perforin Hol41 gene adopts a codon-optimized bacteriophage perforin Hol41 gene; the nucleotide sequence of the codon-optimized bacteriophage perforin Hol41 gene is shown in SEQ ID NO:
1.
5. The engineered strain according to claim 1, characterized in that A SUMO tag is inserted into the N-terminus of the bacteriophage perforin Hol41 gene, and the SUMO tag is an optimized SUMO tag; the nucleotide sequence of the optimized SUMO tag is shown in SEQ ID NO:
2.
6. The engineered strain according to claim 1, characterized in that The bacteriophage perforin Hol41 gene is expressed by the AOX1 promoter.
7. A method for high-yield expression of soluble bacteriophage perforin Hol41 protein, characterized in that: First, the engineered strain according to any one of claims 1 to 5 was inoculated into BMGY liquid culture medium and cultured at 28°C and 180 rpm until OD 600 The concentration was 2.0-4.0, centrifuged, and the cell pellet was washed to remove glycerol to obtain bacterial cells; Then, the bacterial cells were transferred to BMMY liquid culture medium and cultured at 28°C and 180 rpm for 72 hours. An inducer was added to the culture medium every 24 hours until the concentration of the inducer in the culture system was 0.2-1.4%, thereby inducing the engineered strain to produce soluble bacteriophage perforin Hol41 protein, thereby obtaining a fermentation broth containing the soluble bacteriophage perforin Hol41 protein. The inducer is methanol.
8. A method for purifying soluble bacteriophage perforin Hol41 protein, characterized in that: The fermentation liquid containing the soluble bacteriophage perforin Hol41 protein obtained in claim 7 is subjected to solid-liquid separation to obtain a supernatant, and then the supernatant is purified by nickel column affinity chromatography to obtain the soluble bacteriophage perforin Hol41 protein.
9. Use of the soluble bacteriophage perforin Hol41 protein produced by the high-yield expression method according to claim 7 in the preparation of an antibacterial drug for Salmonella enteritidis.
10. Use of the soluble bacteriophage perforin Hol41 protein produced by the high-yield expression method according to claim 7 as an antibacterial agent in the preparation of antibacterial drugs or preservatives.