Pig rpl11 gene promoter and application thereof

Abstract

The application belongs to the technical field of molecules, and specifically discloses a pig RPL11 gene promoter and application thereof. RPL11 The nucleotide sequence of the gene promoter is shown as SEQ ID No. 1. The application determines that the promoter can drive the high-efficiency, stable and extensive expression of an exogenous gene in pig tissue cells through a cell test, avoids the problems of gene silencing, inconsistent expression and low expression efficiency of an exogenous promoter possibly occurring in the preparation process of a transgenic pig product, and has practical application value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecules, and particularly relates to a porcine RPL11 gene promoter and application thereof. BACKGROUND

[0002] Pigs are highly similar to humans in anatomy, physiology, tissue and nutrient metabolism, and therefore transgenic pigs are widely used as animal models for researching human disease models. In the process of constructing a transgenic pig model, an efficient, stable and suitable expression profile promoter is a key element for realizing precise expression of a target gene.

[0003] Although the currently commonly used virus-derived strong promoters (such as CMV promoters) or hybrid promoters (such as CAG promoters) and some endogenous constitutive promoters (such as EF1 alpha promoters) exhibit strong driving capacity in various cell types, in actual applications, especially in pig cells, there are some limitations: ① expression heterogeneity: the expression activity of CMV, CAG and the like promoters in different types of pig cells can be significantly different. This heterogeneity leads to unpredictable and uncontrollable expression levels of transgenes, affecting the reliability and application effect of experimental results; ② silencing effect: virus-derived promoters (especially CMV) can be affected by epigenetic modification (such as DNA methylation) and transcriptional silencing in long-term expression or in vivo environment, leading to a decrease in transgene expression levels over time; ③ insufficient tissue / cell specificity: for transgene applications that require extensive and constitutive expression (such as marker genes, housekeeping gene replacement or biological reactor basic expression), an ideal promoter should maintain consistent activity in most cell types. The performance of existing promoters in this regard is not always satisfactory.

[0004] Directly using the constitutive strong promoter of pigs to drive expression of exogenous genes can theoretically better simulate the expression pattern of endogenous genes, reduce positional effects and silencing risks, and at the same time can have better biocompatibility. However, the current systematic mining and verification of strong and broad-spectrum constitutive promoters of pig origin is relatively less, and therefore, it is urgent to mine and verify new endogenous promoters of pig origin, which should have strong driving capacity, high expression consistency in various pig cell types and good stability, in order to overcome the shortcomings of existing commonly used promoters and provide better tools for pig genetic engineering research and application. SUMMARY

[0005] To achieve the above-mentioned purpose, the application provides a porcine RPL11 gene promoter, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0006] The application further provides a recombinant vector containing the porcine RPL11The plasmid of the gene promoter and the target gene.

[0007] Further, the target gene comprises human thrombomodulin hTM The gene, the luciferase gene of firefly and / or the reporter gene EGFP .

[0008] Further, the plasmid comprises PGL3 plasmid vector, Topo plasmid vector.

[0009] The application further provides a pig as aforementioned. RPL11 The gene promoter, the use of the recombinant vector as aforementioned in the preparation of the reagent for promoting the specific expression of the target gene in the pig cell.

[0010] Further, the target gene comprises human thrombomodulin hTM The gene, the luciferase gene of firefly and / or the reporter gene EGFP .

[0011] Further, the pig cell comprises pig kidney epithelial cell, pig fibroblast and / or pig aortic endothelial cell.

[0012] The application further provides a recombinant cell which is the pig cell into which the pig as aforementioned. RPL11 The gene promoter or the recombinant vector as aforementioned is introduced.

[0013] Further, the pig cell comprises pig kidney epithelial cell, pig fibroblast and / or pig aortic endothelial cell.

[0014] Further, the transgenic animal is transgenic pig.

[0015] Compared with the prior art, the application has the following remarkable effects:

[0016] The application isolates and identifies a pig RPL11 The gene promoter is from the region of -1209bp-1bp upstream of the pig RPL11 The application determines through cell test that the gene promoter can drive the high-efficiency, stable and extensive expression of the exogenous gene in the pig tissue cell, avoids the problems of gene silencing and inconsistent expression and low expression efficiency which the exogenous promoter may face in the preparation process of the transgenic pig product. The pig RPL11 gene promoter has practical application value when used in the preparation of the transgenic pig.

[0017] Obviously, according to the above content of the application, according to the common technical knowledge and conventional means in the art, other various forms of modification, replacement or change can be made without departing from the above basic technical idea of the application.

[0018] The above content of the present application will be further explained in detail by way of specific embodiments in the form of examples. However, it should not be understood that the above content of the present application is limited to the following examples. Any technology realized based on the above content of the present application falls within the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Map of recombinant plasmid PGL3-pRPL11;

[0020] Figure 2 Column chart of relative luciferase activity;

[0021] Figure 3 Column chart of average EGFP fluorescence intensity;

[0022] Figure 4 Human functional gene expression. DETAILED DESCRIPTION

[0023] The raw materials, reagents and equipment used in the specific embodiments of the present application are known products, which can be obtained by commercial purchase, and the nucleotide sequence information involved is as follows:

[0024] pig RPL11 Gene promoter sequence (SEQ ID No. 1):

[0025]

[0026] CMV promoter sequence (SEQ ID No. 2):

[0027] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

[0028] CAG promoter sequence (SEQ ID No. 3):

[0029] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG

[0030] EF1 alpha promoter sequence (SEQ ID No. 4):

[0031]

[0032] Gene ID: 7056 on NCBI for human thrombomodulin hTM gene;

[0033] GenBank No. M15077.1 on NCBI for firefly luciferase gene;

[0034] reporter gene EGFP GenBank No. U57609.1 on NCBI for human β-actin gene.

[0035] Example 1. Study on the promoter of pig RPL11 gene

[0036] 1. Pig RPL11 Prediction and cloning of gene promoter sequence

[0037] 1.1 Sequence acquisition and prediction

[0038] Access the NCBI database using pig genome reference sequence Sscrofa11.1 (GCF_000003025.6) to locate the ribosomal protein 11 gene (RPL11) of pig. Extract the genomic sequence about 1500-2000 bp upstream of the translation start site (ATG) of the gene, and then analyze the extracted sequence to identify the core promoter elements. Based on the prediction results, select the sequence 1209 bp upstream of the start codon ATG as the candidate promoter region, named pRPL11.

[0039] 1.2 Primer design and PCR amplification

[0040] According to the predicted pRPL11 sequence (1209 bp), specific PCR primers were designed. The 5' end of the primers was introduced with appropriate restriction enzyme sites (HindIII and XhoI) to facilitate subsequent cloning. Upstream primer: 5'-CCAAGCTTtaagctagaccagacaggac-3' (containing HindIII site); Downstream primer: 5'-CCCTCGAGctgcaacagggaagcgcc-3' (containing XhoI site). Using the extracted wild-type healthy Bama pig ear tissue genomic DNA as the template, PCR amplification was performed using high-fidelity DNA polymerase.

[0041] 1.3 PCR product purification and cloning

[0042] The PCR product was separated by agarose gel electrophoresis, and the band of the target size (about 1209 bp) was recovered. The purified PCR product was double-digested with Hind III and Xho I, and the PGL3-Basic reporter plasmid (which has no promoter and contains the Firefly Luciferase gene) was digested with the same enzymes. After purification, the pRPL11 fragment was ligated to the multiple cloning site of the PGL3-Basic vector using DNA ligase. The ligation product was transformed into competent E. coli DH5α, and plated on LB plates containing ampicillin. Single colonies were picked for colony PCR and / or plasmid double digestion for preliminary identification, and the positive clones were sent for sequencing to confirm the correctness and integrity of the inserted fragment sequence. The recombinant plasmid PGL3-pRPL11 was obtained. The map is shown in Figure 1

[0043] 2. Preliminary verification of the activity of the pRPL11 promoter (dual luciferase reporter system)

[0044] 2.1 Cell culture and transfection

[0045] The commonly used pig cell lines, pig epithelial cells, pig fibroblasts, and pig aortic endothelial cells, were recovered and cultured. When the cells grew to an appropriate density (about 70-80% confluence), transient transfection experiments were performed.

[0046] 2.2 Preparation and grouping of plasmids

[0047] Experimental group: PGL3-pRPL11 (containing pRPL11 driving Luc)

[0048] Negative control group: PGL3-Basic (no promoter, driving Luc)

[0049] Internal reference plasmid: pRL-TK (containing TK promoter driving Renilla Luciferase)

[0050] Transfection: The above plasmids were co-transfected into cells according to the experimental group / control group and the internal reference plasmid pRL-TK using the electroporation method. More than 3 biological replicates were set for each group.

[0051] ​Detection and analysis: 48 hours after transfection, discard the culture medium, wash the cells with PBS, and add 1x passive lysis buffer to lyse the cells. Use the dual luciferase reporter gene detection kit to detect the activity of firefly luciferase (Firefly Luc) and Renilla luciferase (Renilla Luc) in turn on the microplate reader. Calculate the relative luciferase activity (Relative Luciferase Activity, RLA): RLA = (Firefly Luc Activity) / (Renilla Luc Activity). Compare the relative activity multiples of the PGL3-pRPL11 group and the PGL3-Basic group.

[0052] Results are as follows Figure 2 : PGL3-pRPL11 showed significantly higher luciferase activity than PGL3-Basic in pig epithelial cells and pig fibroblasts and pig aortic endothelial cells, demonstrating that the pRPL11 fragment has significant promoter activity.

[0053] 3 pRPL11 drives EGFP expression and comparison of cell consistency with commonly used promoters

[0054] Expression vector construction: amplify the pRPL11 fragment cloned and verified under the item "Prediction and cloning of pig RPL11 gene promoter sequence", connect the EGFP sequence, and construct the pRPL11-EGFP expression vector. At the same time, prepare control vectors CMV-EGFP, CAG-EGFP, and EF1α-EGFP using CMV promoter, CAG promoter, and EF1α promoter in the same way.

[0055] Cell transfection and culture: select pig epithelial cells (Epithelial cell) and pig fibroblasts (Fibroblast) and pig aortic endothelial cells (Endothelial cell) for experiments, and independently transfect the above four expression vectors (pRPL11-EGFP, CMV-EGFP, CAG-EGFP, EF1α-EGFP) into each type of cell. Set up duplicate wells for each group.

[0056] Expression detection and analysis: 48 hours after transfection, collect the cells, resuspend them with PBS. Use flow cytometry to detect EGFP mean fluorescence intensity (Mean Fluorescence Intensity, MFI), and record the average MFI of each group.

[0057] Results are as follows Figure 3: The average EGFP fluorescence intensity (MFI) of RPL11-EGFP expressed in different types of pig cells is lower than that of the strong promoters: EF1a, CAG promoter, but the MFI coefficient of variation (CV) between different cell types is significantly smaller than that of CMV, CAG and EF1a promoters. This indicates that the pRPL11 promoter driven transgene expression has higher consistency between different pig cell types.

[0058] 4. Verification of pRPL11-driven expression of human transgenes in pig fibroblasts

[0059] Transgene expression vector construction: select human genes: human thrombomodulin hTM gene, clone the coding sequence (cDNA) of the human gene to the Topo vector containing RPL11 promoter (RPL11-hTM), and the Topo vector without promoter as negative control (control). Cell transfection: culture adult pig skin fibroblasts. When the cells grow to the appropriate density, transfect the cells with RPL11-hTM and Topo, respectively. After 72h, incubate with APC-mouse anti-human TM antibody, detect and calculate the average fluorescence intensity by flow cytometry, and uncolored cells as negative control,

[0060] The results are as follows Figure 4 : The RPL11 promoter-containing group can detect effective expression of exogenous genes, proving the feasibility of the promoter driving the expression of functional exogenous genes. The group without the promoter does not detect the expression of exogenous genes, which provides direct experimental evidence for the application of pRPL11 promoter in the construction of transgenic pig models (such as humanized organs, bioreactors).

[0061] In summary, the present application isolates and identifies the pig RPL11 gene promoter from the-1209bp-1bp region upstream of the pig RPL11 gene. This promoter can drive efficient, stable and widespread expression of exogenous genes in pig tissue cells, avoiding the problems of gene silencing and inconsistent expression, as well as low expression efficiency that may be faced by exogenous promoters in the preparation process of transgenic pig products. The pig RPL11 gene promoter has practical application value for the preparation of transgenic pigs.

Claims

1. A type of pig RPL11 Gene promoters, characterized by: Its nucleotide sequence is shown in SEQ ID No.

1.

2. A recombinant vector, characterized in that: It is a pig containing a nucleotide sequence as shown in SEQ ID No.

1. RPL11 Gene promoters and plasmids of target genes.

3. The recombinant vector according to claim 2, characterized in that: The target gene includes human thrombomodulin. hTM Genes, firefly luciferase gene and / or reporter gene EGFP .

4. The recombinant vector according to claim 2 or 3, characterized in that: The plasmids include the PGL3 plasmid vector or the Topo plasmid vector.

5. The pig according to claim 1 RPL11 Use of a gene promoter or the recombinant vector according to any one of claims 2 to 4 in the preparation of a reagent that promotes the specific expression of a target gene in porcine cells.

6. The use according to claim 5, characterized in that: The target gene includes human thrombomodulin. hTM Genes, firefly luciferase gene and / or reporter gene EGFP .

7. The use according to claim 5, characterized in that: The porcine cells include porcine renal epithelial cells, porcine fibroblasts, and / or porcine aortic endothelial cells.

8. A recombinant cell, characterized in that: It is the pig described in claim 1 that has been introduced. RPL11 porcine cells containing a gene promoter or a recombinant vector as described in any one of claims 2 to 4.

9. The recombinant cell according to claim 8, characterized in that: The porcine cells include porcine renal epithelial cells, porcine fibroblasts, and / or porcine aortic endothelial cells.

10. The use of the recombinant cells according to claim 8 or 9 in the preparation of transgenic animals, characterized in that: The genetically modified animal is a genetically modified pig.

Images