Rice Remorin protein OsGIP1 and application of coding gene thereof in disease-resistant breeding
By overexpressing the OsGIP1 gene in rice and regulating the plant's disease resistance, the problem of insufficient disease-resistant resources in rice breeding was solved, and efficient enhancement of resistance to rice blast was achieved.
Patent Information
- Application Number
- CN202511132259.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-13
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies lack effective disease-resistant gene resources in rice breeding. Traditional breeding methods have long cycles and limited resistance sources, making it difficult to meet the needs of rice disease prevention and control.
By overexpressing the OsGIP1 gene in rice, the plant's disease resistance can be regulated and the rice's resistance to rice blast can be improved.
The transgenic plants obtained showed higher resistance to rice blast than the background variety ZH11. The OsGIP1 protein and its encoding gene are of great significance in breeding disease-resistant rice varieties.
Smart Images

Figure CN120796366A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, in particular to application of a rice Remorin protein OsGIP1 and its coding gene in disease resistance breeding. BACKGROUND
[0002] Rice is the most important food crop, and its safe production is threatened by various diseases. Fungal pathogens cause rice blast and other diseases every year, resulting in huge yield losses and seriously affecting agricultural economy. Traditional breeding methods face problems such as long cycle and limited resistance sources in breeding disease-resistant varieties, while molecular breeding techniques based on disease-resistant genes provide a new way to improve crop resistance. At present, a variety of disease-resistant genes have been identified in plants such as rice and Arabidopsis, including genes encoding effector proteins and genes regulating immune signaling pathways, which have shown potential for application in disease-resistant transgenic breeding. However, due to the diversity of crop genetic backgrounds and the rapid evolution of pathogenic bacteria, existing disease-resistant gene resources still cannot fully meet the breeding needs, and new disease-resistant functional genes need to be explored.
[0003] In recent years, the Remorin family of plant membrane microdomain marker proteins has attracted attention due to its regulatory role in membrane signal platform assembly and immune receptor activation. Studies have shown that certain Remorin proteins can participate in plant-pathogen interactions by regulating the formation of plasma membrane microdomains, but their specific functions in rice disease resistance are not yet clear. The rice genome encodes multiple Remorin family members, among which OsGIP1 (Oryza sativa GPI-anchored protein interacting partner 1) is an interacting factor for GPI-anchored proteins, and its protein structure has typical Remorin family characteristics, including a conserved C-terminal helical domain and a potential protein interaction interface. Although previous studies have suggested that Remorin proteins may be involved in plant stress response, there is no report on whether OsGIP1 is involved in rice disease resistance and its molecular mechanism. Previous studies on OsGIP1 have focused on its cell membrane localization function, and its molecular mechanism and application potential in anti-fungal or anti-bacterial disease resistance remain to be explored. Exploring the biological function of OsGIP1 in disease resistance not only provides new clues for elucidating the immune regulation network of rice, but also provides new gene resources for disease-resistant molecular breeding, which has important value for solving the disease prevention and control problems in rice production. SUMMARY
[0004] The application aims to provide a rice Remorin protein OsGIP1 and an application of a coding gene thereof in disease-resistant breeding, so as to solve the problems in the prior art. The transgenic plants obtained by overexpressing the OsGIP1 gene of Zhonghua 11 (ZH11) in ZH11 show a phenotype of higher resistance to rice blast than ZH11. It is indicated that OsGIP1 positively regulates the disease resistance of plants, and the OsGIP1 protein and the coding gene thereof are of great significance for breeding rice varieties with disease resistance.
[0005] To achieve the above object, the application provides the following solutions.
[0006] The application provides an application of a rice Remorin protein OsGIP1 and / or a related biological material thereof in any one of the following A1) to A3):
[0007] A1) regulating the disease resistance of plants;
[0008] A2) preparing a product for improving the disease resistance of plants;
[0009] A3) breeding plants with high disease resistance;
[0010] The amino acid sequence of the rice Remorin protein OsGIP1 is shown in SEQ ID NO. 4, or has more than 80% identity with the amino acid sequence shown in SEQ ID NO. 4 and has the same function.
[0011] Further, the CDS sequence of the rice Remorin protein OsGIP1 is shown in SEQ ID NO. 3.
[0012] Further, the related biological material includes any one of the following B1) to B9):
[0013] B1) a nucleic acid molecule encoding the rice Remorin protein OsGIP1;
[0014] B2) an expression cassette containing the nucleic acid molecule of B1);
[0015] B3) a recombinant vector containing the nucleic acid molecule of B1) or containing the expression cassette of B2);
[0016] B4) a recombinant microorganism containing the nucleic acid molecule of B1), containing the expression cassette of B2), or containing the recombinant vector of B3);
[0017] B5) a transgenic plant cell line containing the nucleic acid molecule of B1) or containing the expression cassette of B2);
[0018] B6) a transgenic plant tissue containing the nucleic acid molecule of B1) or containing the expression cassette of B2);
[0019] B7) a transgenic plant organ comprising the nucleic acid molecule of B1) or the expression cassette of B2);
[0020] B8) a nucleic acid molecule that increases or promotes the expression of the rice Remorin protein OsGIP1;
[0021] B9) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule of B8).
[0022] Further, the regulation of the plant disease resistance is that the increase of the expression of the rice Remorin protein OsGIP1 enhances the disease resistance of the plant, and the decrease of the expression of the rice Remorin protein OsGIP1 weakens the disease resistance of the plant.
[0023] Further, the disease resistance is the disease resistance to the fungal disease of the plant.
[0024] Further, the fungal disease of the plant includes rice blast.
[0025] Further, the plant includes rice.
[0026] The present application also provides a method for improving the disease resistance of a plant, comprising the step of overexpressing the rice Remorin protein OsGIP1 in the plant; the amino acid sequence of the rice Remorin protein OsGIP1 is shown in SEQ ID NO. 4, or has more than 80% identity with the amino acid sequence shown in SEQ ID NO. 4 and has the same function.
[0027] Further, the disease resistance is the disease resistance to the fungal disease of the plant; the fungal disease of the plant includes rice blast.
[0028] Further, the plant includes rice.
[0029] The present application discloses the following technical effects:
[0030] The present application identifies a rice Remorin protein, which is named OsGIP1. Experiments prove that the OsGIP1 protein has the function of improving the disease resistance of rice. The transgenic plants obtained by overexpressing the OsGIP1 gene of Zhonghua 11 (ZH11) in ZH11 show a phenotype higher than ZH11 in the resistance to rice blast. It is proved that OsGIP1 positively regulates the disease resistance of the plant, and the OsGIP1 protein and its encoding gene have important significance for cultivating disease-resistant rice varieties. BRIEF DESCRIPTION OF DRAWINGS
[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced as follows. Obviously, the accompanying drawings in the following description only relate to some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without any creative effort.
[0032] Figure 1 Figure 1 is a schematic diagram of the protein structure of OsGIP1 (A) and the sgRNA designed at the target site of OsGIP1 gene knockout (B);
[0033] Figure 2 Figure 2 is the sequencing identification of OsGIP1 knockout lines OsGIP1-KO1 and OsGIP1-KO2 which are genetically stable and based on ZH11;
[0034] Figure 3 Figure 3 is the expression identification of OsGIP1 overexpression lines OsGIP1-OE1 and OsGIP1-OE2 which are genetically stable and based on ZH11;
[0035] Figure 4 Figure 4 is the stab-inoculation phenotype of control and OsGIP1 knockout and overexpression plants; wherein, A is a representative picture of the lesion of three-week-old Zhonghua 11 (ZH11), OsGIP1-KO1, OsGIP1-KO2, OsGIP1-OE1 and OsGIP1-OE2 plant leaves after being inoculated with Magnaporthe oryzae (physiological race zhong10-8-14) for 5 days; B is the statistical result of the lesion length of three-week-old Zhonghua 11 (ZH11), OsGIP1-KO1, OsGIP1-KO2, OsGIP1-OE1 and OsGIP1-OE2 plant leaves after being inoculated with Magnaporthe oryzae (physiological race zhong10-8-14) for 5 days. DETAILED DESCRIPTION
[0036] Various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but rather as a description of certain aspects, features and embodiments of the present application.
[0037] It should be understood that the terms used in the present application merely describe particular embodiments, and are not intended to limit the present application. In addition, for the numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or stated range, and any other stated value or intermediate value in the stated range, is also encompassed within the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.
[0038] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not construed as an admission that it is prior art with respect to the present application.
[0039] Many modifications and variations of this application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.
[0040] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", and the like are open-ended terms that are intended to permit but not limit the inclusion of elements or the number of elements, as well as the possibility that one or more elements can be incorporated into the composition, method, or process, or that one or more elements can be replaced by other elements.
[0041] The technical problem to be solved by the present application is how to improve the disease resistance of rice or how to breed rice with high disease resistance.
[0042] To solve the above technical problem, the present application first provides a protein. The protein is OsGIP1. The OsGIP1 can be the protein of A1), A2) or A3) as follows:
[0043] A1) a protein with an amino acid sequence as shown in SEQ ID NO. 4;
[0044] A2) a protein derived from A1) or having 80% or more identity with the protein shown in A1) and having the same function, obtained by substitution and / or deletion and / or addition of one or more amino acid residues to the amino acid sequence shown in SEQ ID NO. 4 and having the same function;
[0045] A3) a fusion protein obtained by connecting a protein tag to the N-terminal or / and C-terminal of A1) or A2).
[0046] In the above protein, the amino acid sequence shown in SEQ ID NO. 4 consists of 316 amino acid residues.
[0047] The above protein can be artificially synthesized, or the encoding gene thereof can be first synthesized and then expressed biologically.
[0048] The protein tag refers to a polypeptide or protein fused to the target protein for expression, detection, tracking, and / or purification of the target protein using DNA recombination technology. The protein tag can be a GFP tag, a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and / or a SUMO tag.
[0049] The identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity of the amino acid sequence can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search in Advanced BLAST 2.1, and then the value of the identity (%) can be obtained.
[0050] The identity of more than 80% can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100%.
[0051] To solve the above technical problem, the present application also provides a biological material related to the above protein, which can be any one of the following B1) to B9):
[0052] B1) a nucleic acid molecule encoding the above protein;
[0053] B2) an expression cassette containing the nucleic acid molecule of B1);
[0054] B3) a recombinant vector containing the nucleic acid molecule of B1), or a recombinant vector containing the expression cassette of B1);
[0055] B4) a recombinant microorganism containing the nucleic acid molecule of B1), or a recombinant microorganism containing the expression cassette of B2), or a recombinant microorganism containing the recombinant vector of B3);
[0056] B5) a transgenic plant cell line containing the nucleic acid molecule of B1), or a transgenic plant cell line containing the expression cassette of B2);
[0057] B6) a transgenic plant tissue containing the nucleic acid molecule of B1), or a transgenic plant tissue containing the expression cassette of B2);
[0058] B7) a transgenic plant organ containing the nucleic acid molecule of B1), or a transgenic plant organ containing the expression cassette of B2);
[0059] B8) a nucleic acid molecule that enhances or promotes the expression of the above-mentioned protein;
[0060] B9) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule of B8).
[0061] In the above-mentioned biological material, the nucleic acid molecule of B1) can be a coding gene of the above-mentioned protein as shown in b1), b2) or b3):
[0062] b1) a cDNA molecule or a DNA molecule whose coding sequence is the nucleotide of SEQ ID NO. 3;
[0063] b2) a DNA molecule whose nucleotide is shown in SEQ ID NO. 3,
[0064] b3) a cDNA molecule or a DNA molecule that hybridizes with the cDNA or DNA molecule defined in b2) and encodes a protein having the same function.
[0065] In the above-mentioned biological material, the expression cassette containing the nucleic acid molecule of B2) refers to a DNA that can express the above-mentioned protein in a host cell. The DNA can include not only a promoter that initiates the transcription of a protein coding gene, but also a terminator that terminates the transcription of a protein coding gene. Further, the expression cassette can include an enhancer sequence. The promoters that can be used in the present application include, but are not limited to, constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters.
[0066] The recombinant expression vector containing the expression cassette of the protein coding gene can be constructed using the existing plant expression vector. The plant expression vector includes Agrobacterium binary vector and vector for plant microprojectile bombardment, etc. Such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA2300, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company), etc. The plant expression vector can also contain the 3' untranslated region of the foreign gene, i.e. containing the polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as the untranslated region of the 3' end of the Agrobacterium crown gall tumor inducing (Ti) plasmid gene (such as the nos gene of nopaline synthase), plant gene (such as the rice starch synthase gene). When using the gene of the present application to construct a plant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used. These enhancer regions can be the ATG start codon or the adjacent region start codon, but must be the same reading frame as the coding sequence to ensure correct translation of the entire sequence.
[0067] In the above-mentioned biological material, the recombinant microorganism can be yeast, bacteria, algae and fungi.
[0068] The above-mentioned protein and / or the above-mentioned biological material can also be used in the following applications:
[0069] Q1. The protein and / or the biological material in regulating plant disease resistance;
[0070] Q2. The protein and / or the biological material in the preparation of products for improving plant disease resistance;
[0071] Q3. The protein and / or the biological material in the cultivation of high disease resistance plants;
[0072] Q4. The protein and / or the biological material in plant breeding.
[0073] 1) linked to a variety of plant-expressible promoters to facilitate its expression in plants; the promoters can include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the temporal and spatial needs of expression, and will also depend on the target species; for example, tissue- or organ-specific expression promoters, depending on what stage of development the desired recipient is at; ideally, dicot promoters are selected for expression in dicots, and monocot promoters are selected for expression in monocots, although many promoters derived from dicots have proven functional in monocots, and vice versa;
[0074] 2) linked to a suitable transcription terminator, which can also increase the efficiency of expression of the genes of the application; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked to the genes of the application;
[0075] 3) introduction of enhancer sequences, such as intron sequences (for example, from Adhl and bronze 1) and viral leader sequences (for example, from TMV, MCMV, and AMV).
[0076] In the above method, the plants resistant to fungal disease stress can be transgenic plants.
[0077] In the above method, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants, and cells.
[0078] The plants described above can be any of the following:
[0079] D1) dicot plants;
[0080] D2) monocot plants;
[0081] D3) grasses;
[0082] D4) Poaceae plants;
[0083] D5) Oryza plants;
[0084] D6) rice.
[0085] The disease resistance described above is resistance to fungal diseases.
[0086] The technical solutions of the present application will now be described in detail in conjunction with specific embodiments.
[0087] The technical solutions of the present application will be described in detail in combination with specific embodiments.
[0088] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0089] Rice variety Zhonghua 11 (O. Sativa L. spp. japonica, var zhonghua 11, AA genome, ZH11) belongs to the japonica subspecies and is recorded in the non-patent document "Ni Yuchong, New Rice Cultivar Zhonghua 11, Agricultural Science and Technology Communication, 1989, 07, 35"; provided by Professor Chen Xuewei of Sichuan Agricultural University.
[0090] OsGIP1 knockout and overexpression transgenic rice were completed by Boyuan Biotechnology Co., Ltd.
[0091] Plant binary expression vector pTCRISPR was provided by Professor Tang Yongyan, Associate Professor of State Key Laboratory of Sichuan Agricultural University.
[0092] Plant binary expression vector pCambia2300 was provided by Professor Chen Xuewei of State Key Laboratory of Sichuan Agricultural University.
[0093] Total RNA extraction kit: TRIzol from Invitrogen, USA, catalog number 15596026.
[0094] Reverse transcription kit: HiScript III RT SuperMix for qPCR (+gDNA wiper) from Vanzyme, China, catalog number R323-01.
[0095] Homologous recombination kit: ClonExpress II One Step Cloning Kit from Vanzyme, China, catalog number C112-01.
[0096] Example 1 Rice Remorin Protein OsGIP1 and Cloning Thereof
[0097] A rice Remorin protein OsGIP1 was screened in rice. According to the rice ZH11 genome reference gene sequence, primers were designed as follows:
[0098] OsGIP1-F: ATGGAGGCGGAGGACGACGA, SEQ ID NO. 1;
[0099] OsGIP1-R: CAGCGACATGCTGTGCTGCT, SEQ ID NO. 2.
[0100] A DNA band of about 1 kb was obtained by amplification with the above primers using ZH11 total cDNA as template. After sequencing, it was confirmed to be OsGIP1 gene belonging to Remorin protein family. After alignment of the sequence of LOC_Os07g38170 (OsGIP1) in rice genome reference sequence and the cloned sequence obtained by amplification from ZH11 total cDNA, it was shown that the cloned sequence obtained from ZH11 was identical to the sequence of LOC_Os07g38170 (OsGIP1). The amino acid sequence of OsGIP1 protein is shown as SEQ ID NO. 4. The CDS sequence of the coding strand of the gene OsGIP1 encoding OsGIP1 protein is shown as SEQ ID NO. 3.
[0101] SEQ ID NO. 3:
[0102] ATGTTGAGTGAACAAACGGCGGCTAGTGGTAGCAGCAGCAGCAGCCGCGGCGCCGACGACCGGGAGATTGTCATCAGCACCGGCCGGGAGATCGTCGTCAGAAGCAGCGGGGGTGAGGAGAGGGAGGAGGAGGTGGTGGTGGAGGAGGAGCTCGAGGAGCCGGAGTTCAGGGACATCCACGCGCTGAGCCCGCCGCCGACGCCGACGCCGAGCCAGCCGTCGTCGTCGTACCACCGGCGGAGGAGGGAGTCGTGGGAGTCCGCGGCGGGGAGCAGGCACACGTCGATCCGCTCCGTGGGGAGCGACACCGCCCCAAGTGAGCTCTTCCCTACTATGAGCAGGGAGTTCTCGGCCATGGTCGCCGCAGCAGCCAACGCCAACGCCGCCGCCGCCGCAGCCGCGAACGGCGGCGACTCCAGCCGCGCCGGGGTGGACGACGCGCTGGGGAGGATCGGGGAGGATGAGCTCGAGGAGACGAACCCGCTCGCCATCGTCCCGGACAGCAACCCCATCCCGTCCCCTCGCCGCGCCCACCTCGCGCTCCCCGCCCCCGGCGACGTGTCGTCGGCGGGCGGCGGCCACGGCGACGAGGTGTCGGTGGGGCAGGTGAAGAAGGAGGAGGTGGAGTCCAAGATCGCCGCGTGGCAGATCGCCGAGGTCGCCAAGGTCAACAACCGCTTCAAGCGCGAGGAGGTCGTCATCAATGGCTGGGAGGGCGACCAGGTCGAGAAGGCCAACGCCTGGCTCAAGAAGTACGAGAGGAAGCTGGAGGAGAAGAGGGCCAAGGCGATGGAGAAGGCGCAGAACGAGGTGGCGAAGGCGCGGCGGAAGGCGGAGGAGAAGCGGGCGTCGGCGGAGGCGAAGAGGGGCACCAAGGTGGCGCGCGTGCTGGAGCTCGCCAACTTCATGAGGGCCGTGGGGAGGGCGCCATCCAAGCGCTCCTTCTTCTGA.
[0103] SEQ ID NO. 4:
[0104] MLSEQTAASGSSSSSRGADDREIVISTGREIVVRSSGGEEREEEVVVEEELEEPEFRDIHALSPPPTPTPSQPSSSYHRRRRESWESAAGSRHTSIRSVGSDTAPSELFPTMSREFSAMVAAAANANAAAAAAANGGDSSRAGVDDALGRIGEDELEETNPLAIVPDSNPIPSPRRAHLALPAPGDVSSAGGGHGDEVSVGQVKKEEVESKIAAWQIAEVAKVNNRFKREEVVINGWEGDQVEKANAWLKKYERKLEEKRAKAMEKAQNEVAKARRKAEEKRASAEAKRGTKVARVLELANFMRAVGRAPSKRSFF.
[0105] Construction of OsGIP1 plant knock-out vector
[0106] The protein structure of OsGIP1 and the sgRNA designed at the knock-out target site are shown as follows. Figure 1 The knock-out target 1 sequence is designed as GAGATCGTCGTCAGAAGCAG (SEQ ID NO. 5) using the genome of rice ZH11 as a template.
[0107] The following primers are synthesized:
[0108] F1: TGTGCGTCGTCGTCGTCG, SEQ ID NO. 6; GAGATCGTCGTCAGAAGCAG R1: AAAACGGATCCGAGATCGTCGTCGTCG, SEQ ID NO. 7.
[0109] CTGCTTCTGACGACGATCTC The knock-out target 2 sequence is designed as CGTCGTCGTCGTACCACCGG (SEQ ID NO. 8).
[0110] The following primers are synthesized:
[0111] F2: TGTGCGTCGTCGTCGTACCACCGGG, SEQ ID NO. 9;
[0112] R2: AAAACCCGGTGGTACGACGACGACG, SEQ ID NO. 10.
[0113]
[0114] After denaturation at 95°C, annealing to form double-stranded. pTCRISPR vector was digested by Bsal, and linearized vector was recovered. The above DNA double-stranded and linearized vector were mixed according to the system shown in Table 1, and T4 DNA ligase ligation reaction was performed at room temperature for 30 minutes. pTCRISPR-sgRNA OsGIP1-Target1 and pTCRISPR-sgRNA OsGIP1-Target2 Knockout vector.
[0115] Table 1 Construction of knockout vector ligation system
[0116]
[0117]
[0118] pTCRISPR-sgRNA OsGIP1-Target1 and pTCRISPR-sgRNA OsGIP1-Target2 The knockout vector was transformed into DH5a competent cells, respectively, and after kanamycin screening, single colonies were picked for colony PCR identification. The positive colonies were extracted for plasmid and sequencing correct, and pTCRISPR-sgRNA OsGIP1-Target1 and pTCRISPR-sgRNA OsGIP1-Target2 No error, genetic transformation can be carried out. OsGIP1 knockout transgenic rice was completed by Boyuan Biotechnology Co., Ltd.
[0119] Example 3 Construction of OsGIP1 plant expression vector
[0120] The cDNA obtained by reverse transcription of total RNA of rice ZH11 was used as a template, and the cloning primer was:
[0121] F: TATCCAGATCCAGTGGGATCC ATGGAGGCGCAGTGGCTCGC, SEQ ID NO. 11;
[0122] R: CGCACTAGTAAGCTTGGTACC GTAACCACATCTTCTGTGGCAT, SEQ ID NO. 12.
[0123] PCR amplification obtained OsGIP1 full-length cDNA, pCambia2300-35S: eGFP-nosT vector was digested by BamHI and Kpnl, and linearized vector was recovered. The above PCR recovery product OsGIP1 full-length cDNA and linearized vector were mixed according to the system shown in Table 2, and homologous recombination was performed to obtain pCambia2300-35S: OsGIP1 recombinant vector.
[0124] Table 2 Construction of recombinant vector ligation system
[0125] cDNA fragment 0.5-5 μL Linearized vector 0.5-5 μL 5X CEII Buffer 4 μL Exnase II 2 μL ddH2O q.s. 20 μL
[0126] The pCambia2300-35S:OsGIP1 recombinant vector was transformed into DH5a competent cells, and after kanamycin screening, single colonies were picked for colony PCR identification. After the positive colonies were extracted for plasmid and sequencing, it was confirmed that pCambia2300-35S:OsGIP1 was correct and could be used for genetic transformation. The OsGIP1 overexpression transgenic rice was completed by Boyuan Biotechnology Co., Ltd.
[0127] Example 4 OsGIP1 is involved in regulating the disease resistance of plants
[0128] In plants, OsGIP1 is mainly focused on plant growth and development. The inventors found that OsGIP1 plays an important role in regulating plant disease resistance. Therefore, the effect of OsGIP1 on rice disease resistance was tested.
[0129] The test materials were Zhonghua 11 (ZH11), OsGIP1 knockout lines OsGIP1-KO1 and OsGIP1-KO2 which were genetically stable and based on ZH11, and OsGIP1 overexpression lines OsGIP1-OE1 and OsGIP1-OE2 which were genetically stable and based on ZH11. The sequencing identification of OsGIP1 knockout lines OsGIP1-KO1 and OsGIP1-KO2 which were genetically stable and based on ZH11 is shown in Figure 2 The expression identification of OsGIP1 overexpression lines OsGIP1-OE1 and OsGIP1-OE2 which were genetically stable and based on ZH11 is shown in Figure 3 .
[0130] Puncture inoculation treatment in seedling stage: Choose seeds with full grains, put them in conical bottles with tap water, and place them in a 37°C dark incubator for germination. Change the water every day. After 2 days, choose the white seeds and put them in a 96-well seedling plate. Place the 96-well seedling plate on a float and grow in Hoagland nutrient solution. After 21 days, select the penultimate leaf of rice with uniform growth and size, puncture and inoculate 5 μL of Zhong10-8-14 rice blast spores with a concentration of 5×10 5 mL -1 After 5 days, observe and count the lesion length.
[0131] The statistics show that after 5 days of puncture inoculation, compared with ZH11, the lesion length of OsGIP1-KO1 and OsGIP1-KO2 plants based on ZH11 background is extremely significantly increased, and the disease resistance is weakened; the lesion length of OsGIP1-OE1 and OsGIP1-OE2 plants is significantly reduced, and the disease resistance of the plants is obviously enhanced Figure 4). The above indicates that OsGIP1 positively regulates the disease resistance of plants, and the coding gene OsGIP1 can be used as a target gene for molecular breeding to improve the disease resistance of plants.
[0132] The above-described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope defined by the claims of the present application.
Claims
1. Use of a rice remorin protein OsGIP1 and / or its related biomaterials in any one of the following items A1) to A3): A1) Regulate plant disease resistance; A2) preparing products for improving plant disease resistance; A3) Cultivating highly disease-resistant plants; The amino acid sequence of the rice Remorin protein OsGIP1 is shown in SEQ ID NO. 4, or has more than 80% identity with the amino acid sequence shown in SEQ ID NO. 4 and has the same function.
2. The use according to claim 1, characterized in that The CDS sequence encoding the rice Remorin protein OsGIP1 is shown in SEQ ID NO.
3.
3. The use according to claim 1, characterized in that The relevant biological materials include any one of the following B1) to B9): B1) a nucleic acid molecule encoding the rice Remorin protein OsGIP1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), the expression cassette described in B2), or the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B8) a nucleic acid molecule that increases or promotes the expression of the rice Remorin protein OsGIP1 according to claim 1; B9) An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing the nucleic acid molecule described in B8).
4. The use according to claim 1, characterized in that The regulating plant disease resistance is to increase the expression of the rice Remorin protein OsGIP1 to enhance the disease resistance of the plant, and to reduce the expression of the rice Remorin protein OsGIP1 to weaken the disease resistance of the plant.
5. The use according to claim 4, characterized in that The disease resistance is resistance to plant fungal diseases.
6. The use according to claim 5, characterized in that The plant fungal diseases include rice blast.
7. The use according to claim 1, characterized in that The plants include rice.
8. A method for improving plant disease resistance, characterized in that: The method comprises the step of overexpressing rice Remorin protein OsGIP1 in the plant; the amino acid sequence of the rice Remorin protein OsGIP1 is shown in SEQ ID NO.4, or has more than 80% identity with the amino acid sequence shown in SEQ ID NO.4 and has the same function.
9. The method according to claim 8, characterized in that The disease resistance is resistance to plant fungal diseases; the plant fungal diseases include rice blast.
10. The method according to claim 8, characterized in that The plants include rice.