Breast cancer subtype diagnosis platform based on modular DNA logic calculation and fluorescence coding
Through a modular DNA logic calculation and fluorescence coding breast cancer subtype diagnosis platform, DNAzyme cutting and logic operations are used to generate binary fluorescence codes, which solves the problems of low sensitivity and high cost in breast cancer subtype diagnosis in existing technologies and realizes efficient and low-cost breast cancer subtype classification.
Patent Information
- Application Number
- CN202510601031.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-10-17
AI Technical Summary
Existing breast cancer diagnostic methods have problems such as low sensitivity, complex multiple detection requirements, and high costs. In particular, it is difficult to achieve efficient and low-cost typing diagnosis in breast cancer subtype classification.
A breast cancer subtype diagnosis platform using modular DNA logic computing and fluorescence coding includes a DNAzyme catalysis module, a logic operation module, and a fluorescence coding output module. It identifies miRNA through the DNAzyme cleavage module and generates binary fluorescence coding by combining entropy-driven reactions and logic operations.
It achieves the coordinated detection of triple miRNAs, reduces reagent costs, improves the ability to distinguish breast cancer subtypes, has good target specificity and high sensitivity, and simplifies the detection process.
Smart Images

Figure CN120796468A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of medicine, and particularly relates to a breast cancer subtype diagnosis platform based on modular DNA logic computation and fluorescence coding. BACKGROUND
[0002] Breast cancer is one of the most commonly diagnosed cancers and the second leading cause of cancer-related deaths in women worldwide. In most cases, if diagnosed and treated early, about 70-80% of primary breast cancer patients can be cured. However, the heterogeneity between tumors (different patients) and within tumors (patients themselves) and multiple molecular subtypes significantly affect the diagnosis, treatment, and prognosis of breast cancer. According to immunohistochemistry and molecular characteristics, it is mainly divided into: estrogen receptor / progesterone receptor positive type (ER+ / PR+, Luminal), human epidermal growth factor receptor 2 positive type (HER2+) and triple negative type (ER- / PR- / HER2-, TNBC). The high heterogeneity of breast cancer leads to problems such as strong subjectivity, low sensitivity, and poor patient compliance in subtype classification in traditional diagnostic methods such as tissue biopsy and immunohistochemistry. In recent years, the development of molecular diagnostic techniques has provided a new direction for precise typing of breast cancer, and microRNA (miRNA) is widely considered an ideal biomarker due to its key role in tumor occurrence, metastasis, and other processes.
[0003] However, the current detection of miRNA faces multiple challenges, including ① low abundance: the concentration of miRNA in body fluids or cells is usually in the picomolar (pM) to nanomolar (nM) range, and the detection method needs to meet high sensitivity detection; ② multiple detection requirements: a single miRNA cannot fully reflect tumor heterogeneity, and multiple miRNAs need to be detected simultaneously to improve the accuracy of typing; ③ complex sample interference: there are a large number of non-target RNAs, proteins, and other interferents in clinical samples (such as plasma), which affect the detection specificity.
[0004] Traditional RNA detection methods, such as reverse transcription quantitative polymerase chain reaction (RT-qPCR), require complex primers and are difficult to detect multiple targets simultaneously. RNA sequencing can analyze miRNA expression profiles with high throughput, but the cost is high and the data analysis is complex, which is not suitable for rapid clinical diagnosis. In addition, when using fluorescence signals for result differentiation, multiple fluorescent dyes (such as Cy3, FAM, ROX) are needed to correspond to different breast cancer subtypes, resulting in increased system complexity and cost. Therefore, there is an urgent need for a simple, convenient, and low-cost breast cancer detection method. SUMMARY
[0005] This section is intended to introduce some aspects of one or more embodiments of the present application, which are described below in the detail section. This section is not intended to limit the application in any way, but to provide insight into various aspects of the application. In the following description, for purposes of explanation and not limitation, specific details are set forth such as particular architectures, techniques, etc. in order to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that the present application can be practiced in other embodiments that depart from these specific details. In other instances, detailed descriptions of well-known methods are not presented in order to avoid obscuring the application.
[0006] In view of the above and / or other problems existing in the prior art, the present application is proposed.
[0007] Therefore, the purpose of the present application is to overcome the deficiencies in the prior art, and provide a breast cancer subtype diagnosis platform based on modular DNA logic calculation and fluorescence encoding.
[0008] To solve the above technical problems, the present application provides the following technical scheme: a breast cancer subtype diagnosis platform based on modular DNA logic calculation and fluorescence encoding, characterized in that: the breast cancer subtype diagnosis platform comprises a deoxyribozyme catalytic module, a logic operation module and a fluorescence encoding output module.
[0009] The deoxyribozyme catalytic module comprises a 10-23 type DNAzyme chain, a DNAzyme blocking chain and a DNAzyme cut substrate chain.
[0010] The logic operation module comprises three computing elements, CE1, CE2 and CE3.
[0011] The fluorescence encoding module comprises two signal output modules, Cy3 fluorescence signal and FAM fluorescence signal.
[0012] As a preferred scheme of the breast cancer subtype diagnosis platform, the DNAzyme blocking chain is used to respond to miR-21, the substrate binding arm of the DNAzyme and the 21-B chain are combined to inhibit the substrate cutting activity of the DNAzyme, and the miR-21 and the 21-B chain are completely complementary to release the DNAzyme, which activates the cutting of the substrate Fuel chain.
[0013] As a preferred scheme of the breast cancer subtype diagnosis platform, the Fuel chain has a hairpin structure, and after the RNA site is cut, two single-stranded Fuel1 and Fuel2 are generated.
[0014] As a preferred scheme of the breast cancer subtype diagnosis platform, the CE1 is a double-stranded formed by the combination of an entropy-driven initiation catalytic chain and a miR-587 response blocking chain, performs an OR logic gate operation, and the CE1 and the miR-587 are released through a stand-based point-mediated strand displacement reaction.
[0015] As a preferred scheme of the breast cancer subtype diagnosis platform, the CE2 is a double strand formed by the combination of the entropy-driven initiation catalytic chain ST and the closed chain response of miR-210, performs the OR logic gate operation, and the ST chain is released by the stand point-mediated chain displacement reaction of CE2 and miR-210.
[0016] As a preferred scheme of the breast cancer subtype diagnosis platform, the CE3 is a triple strand formed by the combination of the entropy-driven initiation catalytic chain ST, the closed chain response of miR-587 and the closed chain response of miR-210, performs the AND logic gate operation, and the ST chain is output by the stand point-mediated chain displacement reaction of CE3, miR-587 and miR-210.
[0017] As a preferred scheme of the breast cancer subtype diagnosis platform, the Cy3 fluorescence signal comprises a double strand with a Cy3 fluorescence group chain and a quenching group BHQ2 chain.
[0018] As a preferred scheme of the breast cancer subtype diagnosis platform, the FAM fluorescence signal comprises a triple strand with a FAM fluorescence group chain, a quenching group BHQ1 chain and an entropy-driven substrate chain.
[0019] Still another object of the present application is to provide an application of a breast cancer subtype diagnosis platform based on modular DNA logic calculation and fluorescence coding in disease detection, so as to overcome the defects in the prior art.
[0020] As a preferred scheme of the application, the breast cancer subtype diagnosis platform realizes the differentiation of the health, Luminal, HER2+ and TNBC subtypes through logic operation.
[0021] The present application has the following beneficial effects:
[0022] (1) Modular DNA logic calculation architecture: the present application divides the detection process into three modules of DNAzyme catalytic cleavage module, logic operation module (OR / AND gate) and fluorescence output module, and realizes the cooperative detection of three miRNAs through cascade reaction. The present application constructs the DNAzyme catalytic cleavage module response miR-21 and the initiation chain ST response miR-587 and miR-210 through the dye chain Fuel1 based on entropy-driven reaction and OR / AND logic operation.
[0023] (2) Binary fluorescence encoding-based subtype discrimination: The present application only uses two fluorescence signals of Cy3 (YES logic gate) and FAM (YES, OR-AND and YES, AND-AND logic gate) to generate three-bit binary encoding through logic operation. The traditional multi-fluorescent probe system needs three signals to correspond to distinguish four breast cancer subtypes, while the present application reduces the signal dimension through logic operation and reduces the cost of reagents; the present application also breaks through the limitation that it is difficult to distinguish HER2+ and Luminal subtype in the prior art through the OR / AND logic combination of miR-587 and miR-210.
[0024] (3) Sequence-specific design of logic operation module: The present application realizes the YES logic operation of miR-21, the OR / AND logic operation of miR-587 and miR-210 through the sequence design in the computing element (CE1-3) and the DNAzyme module, and generates subtype-specific output. DNAzyme / 21-B is activated by miR-21, CE1 / CE2 is activated by miR-587 or miR-210 (OR gate), and CE3 needs both inputs (AND gate), and strict base complementary pairing ensures the strictness of logic operation, so that the detection has good target specificity. BRIEF DESCRIPTION OF DRAWINGS
[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor. Among them:
[0026] Figure 1 It is a schematic diagram of the modular DNA logic fluorescence encoding platform.
[0027] Figure 2 It is a PAGE analysis result diagram of the function of the DNAzyme (Dz) cutting module, the EDR circuit and the logic computing module integrated with the EDR circuit.
[0028] Figure 3 It is a system sodium ion concentration optimization result diagram.
[0029] Figure 4 It is a 21-B and DNAzyme ratio optimization result diagram.
[0030] Figure 5 It is a fluorescence verification result diagram of two kinds of cascade logic gates.
[0031] Figure 6 It is a linear detection and selective detection result diagram of miR-21.
[0032] Figure 7 Graphs of linear and selective detection results for miR-587.
[0033] Figure 8 Graphs of linear and selective detection results for miR-210.
[0034] Figure 9 Subtype-specific imaging analysis of breast cancer cell lines using a cascade logic gate.
[0035] Figure 10 Fluorescence analysis of clinical samples from healthy donors and patients with different subtypes of breast cancer using a cascade logic gate. DETAILED DESCRIPTION
[0036] In order to make the above objectives, features and advantages of the present application more apparent, the specific embodiments of the present application will be described in detail below with reference to the embodiments of the present application.
[0037] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that the present application can be practiced without the specific details presented herein. In other instances, well-known methods have not been described in detail in order to avoid obscuring aspects of the present application. Therefore, the present application is not limited to the specific embodiments disclosed herein.
[0038] Secondly, the "one embodiment" or "embodiment" referred to herein means that the specific features, structures or characteristics can be included in at least one implementation of the present application. The "in one embodiment" appearing in different places in the specification does not mean the same embodiment, nor is it an independent or alternative embodiment mutually exclusive with other embodiments.
[0039] The raw materials used in the present application: chloroform, isopropyl alcohol and magnesium chloride were purchased from Beijing Chemical Plant (Beijing, China); Tris-HCl was purchased from Beijing Biotopped Technology Co., Ltd. (Beijing, China); hydrochloric acid and sodium chloride were purchased from Xilong Scientific (Guangzhou, China); TRIzol reagent was from Invitrogen (USA); SafeBlue was purchased from TransGen Biotech Co., Ltd. (Wuhan, China); The oligonucleotides used in the present study were custom synthesized and purified by Shanghai Biotechnology Service Co., Ltd. (Shanghai, China).
[0040] The concentration of DNA was measured using Nanodrop OneC (Thermo Fisher Scientific, Inc., Wilmington, DE, U.S.A.); the absorbance of the samples was measured at 450 nm using a SparkTM multi-function microplate reader (Tecan, Mannedorf, Switzerland). Fluorescence values were measured on a microscope (Thermo Fisher Scientific, Inc., Wilmington, DE, USA); gels were imaged using an iBrightFL1000 imaging system (Thermo Fisher Scientific, Inc., Wilmington, DE, USA); and cell images were acquired using a confocal laser fluorescence scanning microscope (CLSM, Leica TCS SP2, Leica Microsystems, Mannheim, Germany).
[0041] Example 1
[0042] like Figure 1 Figure 1 shows a first embodiment of the present invention, providing a breast cancer subtype diagnosis platform based on modular DNA logic calculation and fluorescence coding. The platform includes a deoxyribozyme (Dz) catalytic module, a logic operation module (AND / OR gate), and a fluorescence coding output module. The breast cancer subtype diagnosis platform is driven by three miRNAs and is used to identify breast cancer (BC) subtypes. The platform integrates Dz cleavage, logic calculation, and fluorescence coding to generate a subtype-specific 3-bit binary code.
[0043] Among them, the deoxyribozyme (Dz) catalytic module includes a 10-23 type DNAzyme chain (Dz: GACTGCTACATTGAGGCTAGCTACAACGACTCGGTAC), a DNAzyme blocking chain (21-B: AGCCTCAACATCAGTCTGATAAGCTA) for responding to miR-21 (UAGCUUAUCAGACUGAUGUUGA) and a DNAzyme-cleaved substrate chain (Fuel: CTGATTTCCATAGGTGATGCCCTTCCAACTAGTACCGAGrAUCAACATCAG ATTAAGGAAGGGCA).
[0044] The binding of the substrate-binding arm of the DNAzyme (Dz) to the 21-B chain inhibits the substrate cleavage activity of the DNAzyme. The complete complementarity between miR-21 and the 21-B chain releases the DNAzyme, activating it to cleave the substrate Fuel chain. The Fuel chain has a hairpin structure and cannot stably maintain its own structure after being cleaved at the RNA site, resulting in two single-stranded Fuel1 and Fuel2. The sequences of Fuel1 and Fuel2 are shown below:
[0045] Fuel1: CTGATTTCCATAGGTGATGCCCTTCCAACTAGTACCGAGrA;
[0046] Fuel2: UCAACATCAGATTAAGGAAGGGCA.
[0047] The function of the deoxyribozyme catalytic module is to specifically recognize miR-21 and trigger DNAzyme catalytic cleavage of the substrate to generate two fuel chains (Fuel 1 and Fuel 2) to provide input signals for the downstream reaction.
[0048] The logic operation module (OR / AND logic gate) comprises 3 computing elements (CE1, CE2 and CE3),
[0049] Among them, the computing element 1 (CE1) is a double-stranded chain formed by the combination of the entropy-driven initiation catalytic chain (ST: GTGTGACAGCGGCTGATTTCCATAGGTGATG) and the closed chain (587-B: GTGACTCATCACCTATGGAAATCA) responsive to miR-587 (UUUCCAUAGGUGAUGAGUCAC);
[0050] The computing element 2 (CE2) is a double-stranded chain formed by the combination of the entropy-driven initiation catalytic chain ST and the closed chain (210-B: TCAGCCGCTGTCACACGCACAG) responsive to miR-210 (CUGUGCGUGUGACAGCGGCUGA);
[0051] The computing element 3 (CE3) is a triple-stranded chain formed by the combination of the entropy-driven initiation catalytic chain ST, the closed chain responsive to miR-587, and the closed chain responsive to miR-210.
[0052] The computing element 1 (CE1) and the computing element 2 (CE2) perform OR logic gate operation; and the computing element 3 (CE3) performs AND logic gate operation.
[0053] In the OR logic gate system, the computing element 1 (CE1) and miR-587 release the ST chain through the toehold-mediated strand displacement reaction (TMSD), and the computing element 2 (CE2) and miR-210 release the ST chain through the toehold-mediated strand displacement reaction (TMSD), so as to produce the output of the ST chain as long as any of miR-587 or miR-210 is input; and in the AND logic gate system, the computing element 3 (CE3) can output the ST chain only when miR-587 and miR-210 are simultaneously input through the toehold-mediated strand displacement reaction (TMSD).
[0054] The function of the logic operation module is to specifically recognize miR-587 and miR-210 and trigger the toehold-mediated strand displacement reaction (TMSD), and different downstream signals are generated under different input conditions according to the design of the two logic gates.
[0055] The fluorescent encoding module comprises two signal output modules of Cy3 fluorescent signal and FAM fluorescent signal,
[0056] The Cy3 fluorescent signal comprises double strands of a Cy3 fluorescent group chain (SP1: Cy3-CAACATCAGATTAAGG) and a quenching group BHQ2 chain (SP2: GCCCTTCCTTAATCTGATGTTG-BHQ2);
[0057] The FAM fluorescent signal comprises three strands of a FAM fluorescent group chain (SP3: TCCAACTAGTACCGAGTTT-FAM), a quenching group BHQ1 chain (SP4: BHQ1-CTCGGTACTAGTTGGAAGGGCATCACCTATGGAAATCAGCCGCTG) and an entropy-driven substrate chain (SP5: CTGATTTCCATAGGTGATGCCCT).
[0058] In which, the SP1 strand is released by a toehold-mediated strand displacement reaction (TMSD) due to the Fuel2 produced by the SP2 and the deoxyribozyme (DNAzyme) catalytic module, and the Cy3 fluorescent signal is generated without the influence of the quenching group BHQ2;
[0059] The FAM fluorescent signal is generated by the deoxyribozyme (DNAzyme) catalytic module and the logic operation module (OR / AND logic gate) acting on the entropy-driven reaction (EDR), and the SP3 / 4 / 5 acts as the substrate strand of the entropy-driven reaction (EDR) and can release the SP3 strand under the joint action of the Fuel1 strand produced by the deoxyribozyme (DNAzyme) catalytic module and the ST strand produced by the logic operation module (OR / AND logic gate) (in line with the conditions of the AND logic gate design), and the FAM fluorescent signal is amplified without the influence of the quenching group BHQ1.
[0060] Therefore, the cascade logic operation platforms of “YES, OR-AND” and “YES, AND-AND” are constructed to respond to the three miRNAs, and according to the expression contents of the three miRNAs in the four breast cancer cells, two cascade logic operations are performed to obtain four different fluorescent output results and encode the results of “no” and “yes” by binary “0” and “1” respectively: MCF-10A (0, 0, 0), BT-474 (1, 0, 0), MCF-7 (1, 1, 0) and MDA-MB-231 (1, 1, 1).
[0061] The function of the fluorescent encoding module is to cascade different logic operations, convert the expression of different miRNAs into different fluorescent signals, and realize the differentiation of breast cancer subtypes through signal encoding.
[0062] The breast cancer subtype diagnosis platform based on modular DNA logic computation and fluorescence coding provided by the embodiment realizes precise diagnosis of breast cancer subtypes by inter-module cascade, system logic operation on three target microRNAs (miRNA: miR-21, miR-587, miR-210), and generation of binary fluorescence coding.
[0063] The expression of miR-21, miR-587 and miR-210 in different breast cancer cells was verified by reverse transcription quantitative polymerase chain reaction (RT-qPCR): miR-21 was lowly expressed in normal (Health) phenotype human normal breast epithelial cells (MCF-10A) and overexpressed in estrogen receptor positive / progesterone receptor positive (ER+ / PR+, Lmuninal) phenotype human breast cancer cells (MCF-7), human epidermal growth factor receptor 2 positive (HER2+) phenotype human breast ductal carcinoma cells (BT-474) and triple negative (TNBC) phenotype human breast invasive ductal carcinoma cells (MDA-MB-231); miR-587 was lowly expressed in MCF-10A cells and BT-474 cells and overexpressed in MCF-7 cells and MDA-MB-231 cells; miR-210 was lowly expressed in MCF-10A cells, BT-474 cells and MCF-7 cells and overexpressed in MDA-MB-231 cells.
[0064] Embodiment 2
[0065] The embodiment is a construction method of the breast cancer subtype diagnosis platform based on modular DNA logic computation and fluorescence coding described in embodiment 1, and specifically comprises the following steps:
[0066] (1) Sequence design using NUPACL website (https: / / www.nupack.org / partition / new): in the webpage, reaction conditions are inputted, including DNA design, sodium ion concentration 0.6M, magnesium ion concentration 50mM, reaction temperature 37℃; after inputting the target sequence, the calculation result shows that Fuel can form a stable hairpin structure, all DNA double strands and triple strands can stably exist under the condition (formation efficiency is greater than 99%), and the reaction efficiency of strand displacement process is greater than 95%.
[0067] (2) Non-denaturing polyacrylamide gel electrophoresis:
[0068] a. Preparation of non-denaturing polyacrylamide gel: 40% polyacrylamide 4.5mL, 5×TBE solution 750μL, glycerol 750μL, 10% ammonium persulfate (AP) 50μL, tetramethyl ethylenediamine (TEMED) 16μL, ultrapure water to 15mL, and 12% non-denaturing polyacrylamide gel is prepared.
[0069] b. Mix each 10 μL sample with 2 μL 6x DNA Loading Buffer and load the mixture into the wells. Perform 120V constant voltage electrophoresis in 1x TBE for 90 min at 4 °C in a refrigerator using an electrophoresis system. After electrophoresis, the non-denaturing polyacrylamide gel is placed in 50 mL 1x TBE containing 13 μL Safe Red nucleic acid dye for 15 min for staining, and imaging is performed using an iBright FL1000 gel imager to verify the feasibility of the sequence design, and the target sequence bands generated in the reacted lanes can be one-to-one corresponding to the reference lane bands in the same gel image.
[0070] Figure 2 To analyze the functions of DNAzyme (Dz) cleavage module, EDR circuit, and logic computation module integrated with EDR circuit by PAGE;
[0071] wherein, Figure 2 (A) is a miR-21-responsive Dz module; Figure 2 (B) is an EDR circuit triggered by ST and Fuel1 together; Figure 2 (C) is an OR logic computation module integrated with EDR circuit; Figure 2 (D) is an AND logic computation module integrated with EDR circuit.
[0072] It can be seen that, in Figure 2 (A), the substrate binding arm of Dz is blocked by strand 21-B (lane 3), which makes Dz / 21-B coexist with substrate Fuel (lane 6). After introducing miR-21 into the mixture of Dz / 21-B and Fuel (lane 7), the disappearance of Fuel band and the simultaneous appearance of Fuel 1 band indicate that Dz has been successfully activated. For Figure 2 (B), the addition of Fuel1 to EDR substrate SP 3* / 4 / 5 (lane 6) produces a small signal leakage (lane 9). In contrast, the addition of ST strand produces an intermediate product strand (lane 8), and the presence of Fuel1 further converts to waste strand 1 / SP 4 (lane 10), thus allowing the recycling of ST. In Figure 2 (C), the ST strand is obtained from CE1 or CE2 in the presence of miR-587 (lane 5) or miR-210 (lane 4), which in turn drives the EDR circuit (lanes 7 to 11). In Figure 2 (D), when both miR-587 and miR-210 are present (lane 5), CE 3 is converted to ST through a strand displacement reaction, thus realizing the AND-gated EDR circuit amplification (lanes 7 to 11).
[0073] (3) Condition optimization:
[0074] a. Sodium ion concentration optimization:
[0075] Tris-HCl buffer solution (10 mM Tris, 50 mM MgCl2, pH 7.5) with concentrations of 0.2 mol / L, 0.6 mol / L and 1 mol / L respectively were configured, 1 μΜ of Fuel, SP1 / SP2, SP3 / SP4 / SP5, 200 nM of miR-21, miR-587, miR-210, CE1, CE2, CE3, DNAzyme / 210-B were prepared in three kinds of buffer respectively, the above solutions were heated at 95 ℃ for 5 min, and then gradually cooled to room temperature to promote the formation of stem loop and hybrid structure.
[0076] 1 μL of CE1, DNAzyme / 210-B and 2 μL of Fuel, SP3 / SP4 / SP5 were taken in 10 μL system, 4 μL of buffer was added to the blank group, 1 μL of 200 nM miR-21 and miR-587 solution was added to the control group, the reaction solution was configured in parallel in three groups, reacted at 37 ℃ for 2 h, the fluorescence intensity of the solution was detected by enzyme label instrument, and the optimal concentration of sodium ion was screened by the maximum signal-to-noise ratio.
[0077] The sodium ion concentration optimization of the system is shown in Figure 3 It can be seen that 0.6 M sodium ion in the buffer solution can achieve the maximum signal-to-noise ratio.
[0078] b. 21-B and DNAzyme ratio optimization:
[0079] Under the condition of 0.6 M sodium ion concentration, 200 nM:200 nM, 220 nM:200 nM, 240 nM:200 nM of 21-B:DNAzyme solution were configured respectively, 1 μL of CE1, DNAzyme / 210-B and 2 μL of Fuel, SP3 / SP4 / SP5 were taken in 10 μL system, 4 μL of buffer was added to the blank group, 1 μL of 200 nM miR-21 and miR-587 solution was added to the control group, the reaction solution was configured in parallel in three groups, reacted at 37 ℃ for 2 h, the fluorescence intensity of the solution was detected by enzyme label instrument, and the optimal ratio of 21-B / DNAzyme was screened by the maximum signal-to-noise ratio.
[0080] The 21-B and DNAzyme ratio optimization is shown in Figure 4 It can be seen that the concentration ratio of 1.1:1 of Dz and 21-B can achieve the maximum signal-to-noise ratio.
[0081] (4) Verification of cascade logic system:
[0082] Fuel, SP1 / SP2, SP3 / SP4 / SP5, 200 nM of miR-21, miR-587, miR-210, CE1, CE2, CE3, DNAzyme / 210-B were prepared in Tris-HCl buffer (10 mM Tris, 0.6 M NaCl, 50 mM MgCl2, pH 7.5) at 1 μM, and the above solutions were heated at 95 °C for 5 min, then gradually cooled to room temperature to promote the formation of stem-loop and hybrid structure. All modules were reacted in Tris-HCl buffer (10 mM Tris, 0.6 M NaCl, 50 mM MgCl2, pH 7.5) at 37 °C for 2 h.
[0083] To detect multiple miRNAs, 10 μL of reaction mixture was prepared, containing 1 μL of 200 nM miRNAs (miR-21, miR-587 and miR-210), Dz / 21-B, computational elements (CE1 and CE2 for OR logic gate operation, CE3 for AND logic gate operation), 2 μL of 1 μM Fuel, SP1 / 2 or SP3 / 4 / 5. Spark TM FAM (460 nm excitation, 520 nm emission) and Cy3 (520 nm excitation, 570 nm emission) fluorescence measurements were performed using Spark 10M microplate reader. Normalized fluorescence and 0.4 threshold were chosen as the judgment of logic gate signal output.
[0084] Fluorescence change was used to evaluate the logic sensor performance, calculated as follows: ΔF = F - F0; where F represents the final fluorescence intensity, and F0 represents the initial fluorescence intensity. Normalized fluorescence intensity (ΔF / F0) represents the ratio of fluorescence change to initial fluorescence.
[0085] Figure 5 Fluorescence verification for two cascade logic gates. Figure 5 A~C are "YES, OR-AND" cascade logic gates, Figure 5 D~F are "YES, AND-AND" cascade logic gates, it can be seen that in the "YES, OR-AND" cascade logic gate, the presence of miR-21 and miR-587 or miR-210 [(1, 0, 1), (0, 1, 1), (1, 1, 1)] successfully activated the circuit, resulting in a significant increase in fluorescence intensity (output 1), while other input combinations produced minimal fluorescence change (output 0); in the "YES, AND-AND" cascade logic gate, only when all three inputs of miR-21, miR-587 and miR-210 (1, 1, 1) are present, can an enhanced fluorescence signal be obtained (output 1).
[0086] Example 3
[0087] This example is for the quantitative detection of three miRNAs using the breast cancer subtype diagnosis platform based on modular DNA logic computation and fluorescence encoding described in Example 1, specifically including the following steps:
[0088] (1) miR-21: 1 μL of 200 nM Dz / 21-B, 2 μL of 1 μM SP1 / 2, Fuel, and 5 μL of buffer solution were added to the system. 1 μL of 500 nM, 200 nM, 50 nM, 4 nM, 1 nM, 0.5 nM, and 0 nM miR-21 solution was added respectively, and the reaction was carried out at 37°C for 2 hours. The Cy3 fluorescence intensity was measured by a microplate reader.
[0089] The results are shown in FIG. 21A, which shows that the miR-21 mediated YES gate exhibits sensitive detection in the dynamic range of 50 pM to 20 nM, with a LOD of 23.3 pM. Figure 6 A, it can be seen that the miR-587 mediated OR gate exhibits sensitive detection in the dynamic range of 20 pM to 5 nM, with a LOD of 10.8 pM.
[0090] (2) miR-587: 1 μL of 200 nM miR-21, Dz / 21-B, CE1, 2 μL of 1 μM SP3 / 4 / 5, Fuel, and 2 μL of buffer solution were added to the system. 1 μL of 200 nM, 50 nM, 10 nM, 5 nM, 0.5 nM, and 0.2 nM miR-21 solution was added respectively, and the reaction was carried out at 37°C for 2 hours. The FAM fluorescence intensity was measured by a microplate reader.
[0091] The results are shown in FIG. 21A, which shows that the miR-587 mediated OR gate exhibits sensitive detection in the dynamic range of 20 pM to 5 nM, with a LOD of 10.8 pM. Figure 7 A, it can be seen that the miR-210 mediated OR gate exhibits sensitive detection in the dynamic range of 20 pM to 20 nM, with a LOD of 16.6 pM.
[0092] (3) miR-210: 1 μL of 200 nM miR-21, Dz / 21-B, CE2, 2 μL of 1 μM SP3 / 4 / 5, Fuel, and 2 μL of buffer solution were added to the system. 1 μL of 500 nM, 200 nM, 50 nM, 10 nM, 4 nM, 1 nM, 0.5 nM, and 0.2 nM miR-21 solution was added respectively, and the reaction was carried out at 37°C for 2 hours. The FAM fluorescence intensity was measured by a microplate reader.
[0093] The results are shown in FIG. 21A, which shows that the miR-210 mediated OR gate exhibits sensitive detection in the dynamic range of 20 pM to 20 nM, with a LOD of 16.6 pM. Figure 8 A, it can be seen that the miR-210 mediated OR gate exhibits sensitive detection in the dynamic range of 20 pM to 20 nM, with a LOD of 16.6 pM.
[0094] Example 4
[0095] This example is for the fluorescence imaging distinction of four breast cancer subtype cells using the breast cancer subtype diagnosis platform based on modular DNA logic computation and fluorescence encoding described in Example 1, specifically including the following steps:
[0096] (1) MCF-10A, MCF-7, BT-474 and MDA-MB-231 were cultured in a 37 °C incubator with 5% CO2. MCF-10A cells were grown in complete growth medium, BT-474 cells were cultured in RPMI 1640 supplemented with 10% FBS, and MCF-7 and MDA-MB-231 cells were cultured in DMEM supplemented with 10% FBS.
[0097] (2) Four cells were cultured to a cell density of 1 x 105cells / m in 35 mm dishes. 3 μL of "YES, OR-AND" and "YES, AND-AND" systems were incubated with 200 μL of Opti-MEM, 3 μL of 1 mg / mL polyethylenimine (PEI) for 10 min, and then added with 1 mL of Opti-MEM. Cells were incubated with the mixture at 37 °C for 3 h, followed by washing with 1 x PBS buffer. 6
[0098] (3) Before imaging, the nuclei were stained with 4', 6-diamidino-2-phenylindole dilactate (DAPI) for 20 min and washed with 1 x PBS buffer for three times. The excitation wavelengths of DAPI, FAM and Cy3 were 405 nm, 488 nm and 561 nm, respectively. Fluorescent images of cells were acquired using a confocal laser scanning microscope (CLSM, Leica TCS SP2, Leica Microsystems, Mannheim, Germany).
[0099] The results are shown in Figure 9 It can be seen that the Cy3 signal was significantly increased in cancer cells (b-d) for "YES, OR-AND" cascade logic gate, and the signal detected in MCF-10A control cells (a) was negligible, which indicated that miR-21 was up-regulated in all BC cell lines, distinguishing normal breast cells (MCF-10A) and breast cancer cells. Weak FAM signal was detected in MCF-10A (a) and BT-474 (b) cells, while significant FAM signal was observed in MCF-7 (c) and MDA-MB-231 (d) cells, further distinguishing HER2+ cells (BT-474). Cy3 and FAM signals in "YES, AND-AND" cascade logic gate were negligible in MCF-10A cells, and almost no FAM signal was detected in BT-474 and MCF-7 cells, only MDA-MB-231 cells (a) produced FAM signal, achieving the distinction of Luminal cells (MCF-7) and TNBC cells (MDA-MB-231).
[0100] Example 5
[0101] This embodiment is a breast cancer subtype diagnosis platform based on modular DNA logic computing and fluorescence coding described in Example 1, which is used to detect RNA in serum of four clinical samples to distinguish breast cancer subtypes. The platform specifically includes the following steps:
[0102] In this example, plasma samples from healthy volunteers, HER2+, Luminal, and TNBC patients were collected from the Genetic Diagnosis Center of the Key Laboratory of Organ Regeneration and Transplantation of the Ministry of Education, The First Hospital of Jilin University. Informed consent was obtained from anonymous patients and approved by the Ethics Committee of the First Hospital of Jilin University, Changchun, Jilin Province, China (No. 2018-467).
[0103] 500 μL of TRIzol reagent was added to 500 μL of plasma samples collected from healthy volunteers, HER2+, Luminal, and TNBC patients. The mixture was incubated at 4°C for 5 minutes to facilitate RNA isolation.
[0104] Transfer the lysate to a 1.5 mL centrifuge tube, add 200 μL of chloroform, and shake vigorously. Incubate the mixture at room temperature for 3 minutes and then centrifuge at 10,000 g for 15 minutes at 4°C to promote phase separation.
[0105] Carefully collect the supernatant and mix with 500 μL of isopropanol, then incubate for 10 minutes. After centrifugation at 10,000 g for 15 minutes at 4°C, carefully discard the supernatant and add 1 mL of 75% ethanol to precipitate the RNA.
[0106] Centrifuge at 7500 g for 5 min at 4 °C and disperse the RNA pellet in 20 μL of DEPC-treated water.
[0107] Total RNA concentration was quantified using a Nanodrop One spectrophotometer, and the total amount of RNA in each assay was normalized. 1 μL of the extracted total RNA was added to the "YES, OR-AND" and "YES, AND-AND" systems, respectively, for logical operations. Different Cy3 and FAM fluorescence signals were generated, which were encoded and output based on threshold settings to distinguish different breast cancer subtypes.
[0108] The results are as follows Figure 10 As shown, it can be seen that the Cy3 output from healthy people is classified as binary "0", while the output from BC patient samples is classified as binary "1" ( Figure 10B, C). Second, for HER2+ patient samples, the FAM signal remains close to background levels, and thus is assigned a binary "0" in the OR gate of the "YES, OR-AND" logic gate Figure 10 D, E). In contrast, significantly higher FAM signals are observed in Luminal and TNBC (HER2-) patient samples, confirming their output as binary "1". Using the "YES, AND-AND" gate further verifies that the FAM signal in TNBC samples is significantly higher than the FAM signal in Luminal samples Figure 10 F, G). By combining the binary signal codes from the "YES, OR-AND" and "YES, AND-AND" gates, we successfully represent each BC subtype and healthy donor sample with a different 3-bit binary code Figure 10 A).
[0109] It should be noted that the above examples are only used to illustrate the technical solutions of the present application but not limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the present application, and they should be covered in the scope of the present application.
Claims
1. A breast cancer subtype diagnosis platform based on modular DNA logic computing and fluorescence coding, characterized by: The breast cancer subtype diagnosis platform includes a DNAzyme catalysis module, a logic operation module, and a fluorescence coding output module; The deoxyribozyme catalytic module includes a 10-23 type DNAzyme chain, a DNAzyme blocking chain, and a DNAzyme-cleaved substrate chain; The logic operation module includes three computing elements, CE1, CE2 and CE3; The fluorescence encoding module includes two signal output modules: Cy3 fluorescence signal and FAM fluorescence signal.
2. The breast cancer subtype diagnostic platform according to claim 1, wherein: The DNAzyme closed chain is used to respond to miR-21. The binding of the substrate binding arm of the DNAzyme to the 21-B chain inhibits the substrate cleavage activity of the DNAzyme. The complete complementarity between miR-21 and the 21-B chain releases the DNAzyme and activates it to cleave the substrate Fuel chain.
3. The breast cancer subtype diagnostic platform according to claim 2, wherein: The Fuel chain has a hairpin structure, and after being cut at the RNA site, two single-stranded Fuel1 and Fuel2 are produced.
4. The breast cancer subtype diagnostic platform according to claim 1, wherein: The CE1 is a double chain formed by the combination of the entropy-driven catalytic chain and the miR-587-responsive closed chain, performing an OR logic gate operation. CE1 and miR-587 release the ST chain through a toehold-mediated chain displacement reaction.
5. The breast cancer subtype diagnostic platform according to claim 1, wherein: The CE2 is a double chain formed by the entropy-driven combination of the catalytic chain ST and the closed chain of miR-210 response, performing an OR logic gate operation. CE2 and miR-210 release the ST chain through a toehold-mediated chain displacement reaction.
6. The breast cancer subtype diagnostic platform according to claim 1, wherein: The CE3 is a triple chain formed by the entropy-driven catalytic chain ST, the miR-587-responsive closed chain, and the miR-210-responsive closed chain, performing an AND logic gate operation. CE3, miR-587, and miR-210 output the ST chain through a toehold-mediated chain displacement reaction.
7. The breast cancer subtype diagnostic platform according to claim 1, wherein: The Cy3 fluorescent signal comprises a double chain having a Cy3 fluorescent group chain and a BHQ2 chain having a quencher group.
8. The breast cancer subtype diagnostic platform according to claim 1, wherein: The FAM fluorescent signal comprises three chains including a chain with a FAM fluorescent group, a chain with a quencher group BHQ1, and an entropy-driven substrate chain.
9. Use of the breast cancer subtype diagnostic platform as claimed in claim 1 in disease detection.
10. The use according to claim 9, characterized in that: The breast cancer subtype diagnosis platform uses logical operations to distinguish between healthy, luminal, HER2+ and TNBC subtypes.