Primer, probe, kit and method for detecting cospora maydis RPA-LFD (recombinase polymerase amplification-lateral flow dipstick)

Abstract

The invention discloses an RPA-LFD (Recombinase Polymerase Amplification-Lateral Flow Dipstick) detection primer, a probe, a kit and a detection method thereof, and belongs to the field of molecular detection. The detection primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2; the nucleotide sequence of the probe is as shown in SEQ ID No. 3. According to the invention, the special primer and probe are designed for the DNA template of the corn grey leaf spot pathogenic bacteria maize caudal spores, so that the corn grey leaf spot pathogenic bacteria maize caudal spores can be rapidly, simply, specifically and sensitively detected, and the problems that the existing detection is relatively tedious and time-consuming and labor-consuming are effectively solved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular detection, and particularly relates to a zea tail rot RPA-LFD detection primer and probe, a kit and a detection method thereof. BACKGROUND

[0002] Corn gray leaf spot (GLS) is a leaf disease that seriously harms corn production and is widely distributed in major corn-producing regions (the Americas, Asia, Africa, etc.) around the world. The disease mainly invades leaves, and at the early stage of the disease, it shows small yellow-brown spots, and with the development of the disease, it expands into a long rectangular or fusiform gray-brown spot limited by leaf veins. When the disease occurs seriously, the leaf spots can cause leaf death, significantly reduce photosynthetic efficiency, and cause 20%-50% yield loss. Influenced by global climate change, changes in farming systems, and factors such as introduction of varieties, the disease has become one of the most threatening epidemic diseases in China's corn production, and has occurred in at least 17 provinces (autonomous regions and municipalities), posing a serious threat to corn yield and quality.

[0003] At present, four types of corn gray leaf spot pathogens have been identified in the world: Cercospora zeae-maydis, C. zeina, C. sorghivar., and an undetermined species (Cercospora sp.). Cercospora zeae-maydis was first discovered in Liaoning in 1991, and then rapidly spread to Jilin, Heilongjiang, and Inner Mongolia, and has now spread to North China's Shanxi, Shandong, Beijing, Tianjin, and Anhui provinces. C. zeina was first detected in Yunnan in 2001, and in 2003, it broke out and became the dominant pathogen in the local high-altitude mountainous areas. Driven by factors such as monsoon climate, the species has continued to spread northward to Guizhou, Chongqing, and Sichuan, and has gradually replaced Cercospora zeae-maydis as the dominant pathogen in Southwest China. It is worth noting that both species have recently been detected in northern provinces such as Liaoning, Hebei, and Shaanxi, indicating that C. zeina is expanding towards the main production areas in the north.

[0004] The main epidemic species in China is Cercospora zeae-maydis and Cercospora zeina, which are highly similar in morphological characteristics and pathogenicity, but have significant differences in growth characteristics, ecological adaptability and molecular genetic characteristics. The current identification method of corn gray leaf spot pathogen is mainly the morphological observation of spore culture of pathogen separated from leaves or PCR molecular detection means. These detections are after the occurrence of disease, which is not conducive to early screening and prevention and control. At the same time, the PCR detection method has high requirements for site, detection instrument and professional ability of personnel operation, and is not suitable for rapid detection in the field. Therefore, the development and establishment of a precise and rapid pathogen molecular detection technology system can not only accurately master the geographical distribution and population dynamics of pathogenic bacteria, help to analyze the genetic variation rules of pathogen population, but also provide technical support for disease epidemic early warning system and help to develop targeted comprehensive prevention and control strategy. SUMMARY

[0005] The purpose of the present application is to provide a Cercospora zeae-maydis RPA-LFD detection primer and probe, a kit and a detection method thereof, a special primer and probe are designed for the DNA template of the corn gray leaf spot pathogen Cercospora zeae-maydis, which can quickly, simply, specifically and sensitively detect the corn gray leaf spot pathogen Cercospora zeae-maydis, and effectively solve the problems of complicated detection, time-consuming and labor-consuming.

[0006] In order to achieve the above purpose, the present application provides the following technical solutions. In a first aspect, the present application provides a Cercospora zeae-maydis RPA-LFD detection primer and probe, the primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2; the nucleotide sequence of the probe is shown as SEQ ID No. 3.

[0007] Further, the 5' end of the downstream primer is modified with a biotin group.

[0008] Further, the 5' end of the probe is connected with a fluorescent group, and the 3' end is connected with a modification group which inhibits polymerase extension or amplification.

[0009] Further, the fluorescent group is FAM, and the modification group which inhibits polymerase extension or amplification is C3 spacer.

[0010] Further, the cytosine 15 bases away from the 3' end in the probe is replaced with tetrahydrofuran.

[0011] In a second aspect, the present application provides a Cercospora zeae-maydis RPA-LFD detection kit, comprising the Cercospora zeae-maydis RPA-LFD detection primer and probe.

[0012] Further, the kit further comprises a lateral flow test strip.

[0013] In a third aspect, the method for detecting the maize tail rot RPA-LFD comprises the following steps: (1) extracting DNA of a sample to be detected; (2) establishing a recombinase polymerase amplification system with the DNA of the sample to be detected as a template, and performing RPA amplification reaction with the maize tail rot RPA-LFD detection primer and probe to obtain an RPA amplification product; (3) adding the RPA amplification product to a lateral flow test strip, observing the color reaction of the control line and the detection line, and determining the detection result.

[0014] Further, the recombinase polymerase amplification system comprises: 0.84 μL of an upstream primer, 0.84 μL of a downstream primer, 0.6 μL of a probe, 10 μL of Rehydration Buffer, 1 μL of a DNA template, 2 μL of Starter, and 4.72 μL of ddH2O.

[0015] Further, when observing the color reaction of the control line and the detection line to determine the detection result: If two purple-red bands appear on the test strip, one is the quality control line and the other is the detection line, then the result is positive, indicating that the amplification product is positive; if only one purple-red band appears in the quality control area of the test strip and no band appears in the detection area, then the result is negative.

[0016] Based on the above technical solutions, the embodiments of the present application can at least produce the following technical effects: The present application uses the recombinase-mediated isothermal amplification (PRA) technology to develop a new type of rapid visual molecular detection method for maize leaf spot disease by combining the nfo probe with the lateral flow chromatographic analysis diagnosis method. Finally, a new type of visual detection method is applied in the field to establish an efficient and rapid detection and prevention system for maize gray spot disease. At the same time, the detection method of the present application has the advantages of short detection time, high sensitivity and simple operation, and is especially suitable for rapid detection at the grassroots or on-site, and has important practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from the structures shown in the drawings without creative labor.

[0018] Figure 1RPA-LFD detection results of the present application, in which, a is RPA-LFD reaction result; b is PCR reaction result; C is quality control line; T is detection line; M is DNA Marker; 1 is corn gray leaf spot pathogen Helminthosporium maydis; 2 is negative control; Figure 2 RPA-LFD sensitivity detection results of the present application, in which, a is RPA-LFD reaction result; b is PCR reaction result; C is quality control line; T is detection line; M is DNA Marker; 1 is 20 ng.μL -1 ; 2 is 2 ng.μL -1 ; 3 is 200 pg.μL -1 ; 4 is 20 pg.μL -1 ; 5 is 2 pg.μL -1 ; 6 is 200 fg.μL -1 ; 7 is 20 fg.μL -1 ; 8 is 2 fg.μL -1 ; Figure 3 RPA-LFD specificity detection results of the present application, in which, a is RPA-LFD reaction result; b is PCR reaction result; C is quality control line; T is detection line; M is DNA Marker; 1 is corn gray leaf spot pathogen Helminthosporium maydis; 2 is corn gray leaf spot pathogen Cercospora zeina; 3 is corn large spot pathogen Exserohilum turcicum; 4 is corn small spot pathogen Bipolaris sorokiniana; 5 is corn anthracnose pathogen Glomerella cingulata; 6 is corn Fusarium graminearum; 7 is corn white leaf spot pathogen Pseudomonas cichorii; 8 is control group; Figure 4 RPA-LFD leaf infection detection results of the present application, in which, a is RPA-LFD reaction result; b is PCR reaction result; C is quality control line; T is detection line; M is DNA Marker; 1 is positive control; 2 is negative control; 3 is healthy leaf; 4 is Helminthosporium maydis infected leaf ZM-1; 5 is Helminthosporium maydis infected leaf ZM-2; 6 is Helminthosporium maydis infected leaf ZM-3; 7 is Helminthosporium maydis infected leaf ZM-4; 8 is Helminthosporium maydis infected leaf ZM-5; 9 is Cercospora zeina infected leaf Zei-1; 10 is Cercospora zeina infected leaf Zei-2. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative work are within the protection scope of the present application. In addition, the technical solutions of various embodiments can be combined with each other, but it must be based on that a person of ordinary skill in the art can realize. When the combined technical solutions are contradictory or cannot be realized, it should be considered that the combined technical solutions do not exist and are not within the protection scope of the present application.

[0020] 1. Material 1.1 Experimental material The test strains were isolated and preserved by Sichuan Academy of Agricultural Sciences, and the specific information is shown in Table 1. The leaf blades with bacteria were collected in Henan, Yunnan and Guizhou in 2024. The main reagents: DNA extraction kit (NuClean Plant Genomic DNA Kit) was purchased from Kangwei Century, Taq enzyme was purchased from Novozyme Company. RPA-LFD isothermal amplification kit was purchased from Shenzhen Yizhi Biological Technology DNA constant temperature amplification reagent kit (test paper type).

[0021] 1.2. Experimental instrument NanaDrop2000 ultramicro UV spectrophotometer, Eppendorf ThermoMixer® C-shaking instrument, agarose electrophoresis instrument.

[0022] 1.3. DNA extraction of test strains All test strains were inoculated on PDA solid medium plates and cultured at 26°C for 5-7 days. The plant genomic DNA extraction kit was used to extract the genomic DNA of each test strain and dissolved in 80 μL ddH2O. The DNA concentration was determined by spectrophotometer (NanaDrop2000), and stored at -20°C for standby.

[0023] Table 1 Information of test strains

[0024] Table 2 Information of leaf blades with bacteria

[0025] 2. Experimental method and result Example 1: Specific sequence selection and primer probe design of corn gray leaf spot pathogen Cercospora soemii The whole genome sequence of Cercospora zeae-maydis published on NCBI, Cercospora zeae-maydis AY170476, was selected. The following specific genomic sequence fragments were selected as target amplification fragments by whole genome homologous sequence alignment. The upstream primer was designed on the amplification fragment, and the nfo detection probe position was between the upstream and downstream primers. The upstream and downstream primers were used for fragment amplification, and the nfo probe and the downstream primer with Biotin were used for LFD detection together. The primer and probe sequences are shown in Table 3.

[0026] The sequence of Cercospora zeae-maydis is as follows: TATATTATAGCGATTAGCTATATCTTCCTAAGGACTACGTACTACGGACGTAGGTAATCCGTATATACTACGATAATCTACTCGCTAGTTACTTTAGTAAGGATAAAACTACCGAGTTAGTATAGCGGAAGTATTACTAGCTAGGCATATCTACGGATATTAGCTAGTACGTCTAATCCTATTAGGAGTATTAAGTATCGAAGGCGAGACGCTATCGACTATATAGCGAGCTATTAGCATTACCGTAGCTAGAGCTTCTATAGAAGGAGCTAACTATAGACTTTATTACGGACCTACCGCTTAGTAAGCGAGATATATACGTATATAATGCGGTCCTAGTAATTATCGACCGGTACTTAAAGATAAACCTCTTTATACTAACTACTAAGAAATATATAAGCGTAGATCTCGTATAGATCCTAATTAATAGGGTAATTTGCCGATTCGGAATGCTATATAGAATTATAAGCAATAGAGGCACTAT.

[0027] Table 3 Primer and probe sequences

[0028] Example 2: Establishment and detection of RPA-LFD reaction system RPA-LFD reaction system: 20 μL reaction system, add to each reaction (note: operate on ice): upstream primer ZM1-F (10 μM) 0.84 μL, downstream primer ZM3-R-biotin (10 μM) 0.84 μL, probe ZM-nfo (4 μM) 0.6 μL, Rehydration Buffer (2X) 10 μL, DNA template 1 μL, Starter (10X) 2 μL, ddH2O 4.72 μL. Deionized water was used instead of DNA template in the negative control group.

[0029] RPA reaction conditions and lateral flow dipstick (LFD) detection: Incubate the prepared RPA reaction solution in a ThermoMixer® C at 41°C for 30 minutes. After the incubation, take 10μL of amplified product, add 80μL of diluent (Diluent Buffer), mix well, add the test strip for detection, and detect the results within five minutes. Observe the results with the naked eye on the test strip: if two purple-red bands appear on the test strip, one is the quality control line and the other is the detection line, the result is positive, indicating that the amplified product is positive; if only one purple-red band appears in the quality control area of ​​the test strip and there is no band in the detection area, the result is negative. Figure 1 The strip containing pathogenic bacterial genomic DNA showed two bands, indicating a positive test result, while the negative control (sterile ddH2O) showed only one band in the quality control area, indicating no amplification. This is the same result as the PCR reaction using only F2 / R3 primers for amplification.

[0030] Example 3: RPA-LFD sensitivity detection The Cercospora zeae-maydis genomic DNA was diluted 10-fold with sterile ddH2O, and 20 ng.μL -1 ,2ng.μL -1 ,0.2ng.μL -1 ,20pg.μL -1 ,2pg.μL -1 ,0.2pg.μL -1 ,20fg.μL -1 and 2fg.μL -1 The genomic DNA of 8 different concentrations was used as the template for RPA-LFD reaction to perform sensitivity detection of Cercospora zeae-maydis genomic DNA, and the sensitivity of the detection was evaluated based on the test results. Figure 2 As shown, the results showed that the concentration of Cercosporazeae-maydis genomic DNA was higher than 20fg.μL -1The detection results of the above treatment were all positive, i.e. the LFD test strip had clear visible quality control line and detection line, indicating that the RPA-LFD method established had a detection sensitivity of 20 fg. μL for Cercospora zeae-maydis genomic DNA -1 And the detection sensitivity of the same primer PCR reaction was basically equivalent, indicating that the RPA-LFD method had very high detection sensitivity.

[0031] Example 4: Specific detection of RPA-LFD To verify the specificity of RPA-LFD for Cercospora zeae-maydis, the genomes of other common corn leaf spot pathogens (Table 1) were used as templates, and RPA-LFD was used for specificity verification, with Cercospora zeae-maydis genomic DNA as a positive control and sterile ddH2O as a negative control. The RPA amplification products were detected by LFD test strip. As shown in Figure 3 the detection results showed that only Cercospora zeae-maydis genomic DNA had positive amplification results, and the LFD test strip had obvious quality control line and detection line, while the other pathogens and sterile water had no amplification products and were all negative, especially for another pathogen of corn gray leaf spot Cercospora Zeina, which also had no non-specific detection, thus the results showed that the established RPA-LFD had strong specificity for Cercospora zeae-maydis.

[0032] Example 5: Leaf tissue detection Leaf detection: Different locations of corn gray leaf spot leaf tissues (Table 2) were collected, and plant genomic DNA extraction kit was used to extract genomic DNA, and RPA-LFD method was used for detection, with Cercospora zeae-maydis purified bacteria genomic DNA as a positive control, sterile ddH2O and healthy leaves as negative controls, and the PCR detection results were compared, as shown in Figure 4 all the infected leaves (PCR positive samples) had positive RPA-LFD detection results, while the PCR negative corn leaves (healthy leaves) had negative RPA-LFD detection, indicating that the established RPA-LFD could specifically detect Cercospora zeae-maydis in plant leaves, and would not produce non-specific detection on leaves infected with Cercospora zeae-maydis.

[0033] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Primers and probes for RPA-LFD detection of Cercosporium maydis, characterized in that: The primers include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2; the nucleotide sequence of the probe is shown in SEQ ID No.

3.

2. The RPA-LFD detection primer and probe for Cercosporium maydis according to claim 1, wherein The 5' end of the downstream primer is modified with a biotin group.

3. The RPA-LFD detection primer and probe for Cercosporium maydis according to claim 1, wherein The 5' end of the probe is connected to a fluorescent group, and the 3' end is connected to a modification group that inhibits polymerase extension or amplification.

4. The RPA-LFD detection primer and probe for Cercosporium maydis according to claim 3, wherein The fluorescent group is FAM, and the modification group that inhibits polymerase extension or amplification is C3 spacer.

5. The RPA-LFD detection primer and probe for Cercosporium maydis according to claim 1, wherein The cytosine at 15 bases from the 3' end of the probe was replaced with tetrahydrofuran.

6. RPA-LFD detection kit for Cercosporium maydis, characterized in that The invention comprises the primers and probes for detecting Cercosporium maydis RPA-LFD according to any one of claims 1 to 5.

7. The RPA-LFD detection kit for Cercosporium maydis according to claim 6, wherein The kit also includes a lateral flow test strip.

8. The RPA-LFD detection method for Cercosporium maydis is characterized by: The following steps are involved: (1) Extract DNA from the sample to be tested; (2) Using the DNA of the sample to be detected as a template, a recombinase polymerase amplification system is established using the RPA-LFD detection primers and probes for Cercosporium maydis according to any one of claims 1 to 5, and an RPA amplification reaction is performed to obtain an RPA amplification product; (3) Load the RPA amplified product onto the lateral flow test strip, observe the color reaction of the control line and the test line, and determine the test result.

9. The RPA-LFD detection method for Cercosporium maydis according to claim 8, wherein The recombinase polymerase amplification system includes: 0.84 μL of upstream primer, 0.84 μL of downstream primer, 0.6 μL of probe, 10 μL of rehydration buffer, 1 μL of DNA template, 2 μL of starter, and 4.72 μL of ddH2O.

10. The RPA-LFD detection method for Cercosporium maydis according to claim 8, wherein When observing the color reactions of the control line and the test line and determining the test results: If two purple-red bands appear on the test strip, one is the quality control line and the other is the detection line, the result is positive, indicating that the amplification product is positive; if only one purple-red band appears in the quality control area of ​​the test strip and there is no band in the detection area, the result is negative.

Images