Early diagnosis reagent and kit based on haptoglobin and African swine fever virus dual fluorescent quantitative PCR and application of early diagnosis reagent and kit

Abstract

The invention provides a double qPCR method, a reagent and a kit for realizing ultra-early diagnosis of African swine fever by jointly detecting nucleic acids of host biomarkers HP and ASFV. According to the present invention, the HP and B646L genes are adopted to establish the dual fluorescence PCR method, the biomarker HP and ASFV nucleic acid detection are innovatively combined for use, the ASFV infection is diagnosed, the potential ASFV early stage infected pigs in the pig farm can be screened, the diagnosis blank period before the occurrence of the viremia after the ASFV infection is filled, and the kit can be used for the diagnosis of the ASFV early stage. Especially, a new technical tool is provided for coping with challenges of African swine fever virus variation and recombinant strains. According to the method, the efficiency of biological safety measures can be improved, the implementation precision of a'detection-killing 'strategy is optimized, the method is suitable for precise removal when ASF epidemic outbreak occurs in a pig farm or ASF epidemic outbreak occurs in the periphery, and an early monitoring and early warning means is provided for epidemic prevention and control.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of animal disease detection, and is a double qPCR method for realizing super-early diagnosis of African swine fever by jointly detecting host biomarker HP and ASFV nucleic acid, a reagent and a kit. BACKGROUND

[0002] African swine fever virus (ASFV) is the only member of the Asfarviridae family of Asfivirus, and is an animal pathogen with significant economic impact. African swine fever (ASF) caused by the virus is characterized by high morbidity and mortality, and the clinical manifestations of infected pig populations include persistent high fever (40-42℃), loss of appetite, hemorrhagic lesions on the skin, multiple organ failure, and can lead to 100% mortality in susceptible pig populations. Due to its high infectivity and destructive power, it is listed as a class A animal disease for key prevention and control in China.

[0003] Haptoglobin (Hp) is an important member of serum alpha2 globulin components, and is an acute phase reactant synthesized and secreted by the liver. This acid glycoprotein exists not only in serum, but also in various body fluids. In a physiological state, Hp is mainly involved in the clearance of hemoglobin and iron metabolism; under pathological conditions, its serum concentration increases significantly with inflammatory response, tissue damage, infection and other stress states. Notably, the dynamic changes of Hp have a significant correlation with disease severity and prognosis evaluation, which makes it an important inflammatory marker in clinical diagnosis.

[0004] With the continuous prevalence of ASFV, the genetic variation of virus strains presents new epidemiological characteristics. Recent monitoring data shows that the virulence of some epidemic strains presents a weakening trend, but this change brings more difficult problems for prevention and control: the incubation period is prolonged, and the clinical symptoms are atypical. This "mild" infection causes pigs to have the ability to expel viruses before obvious symptoms appear, greatly increasing the difficulty of early diagnosis and epidemic control.

[0005] Currently, no commercial African swine fever vaccine has been approved for marketing worldwide. In the face of this serious situation, it is particularly important to establish a sensitive and specific early diagnosis method. Especially in the subclinical infection stage, it is of decisive significance to block the transmission chain of the epidemic and reduce economic losses by timely detecting infected pigs through reliable laboratory detection means and implementing precise removal. Therefore, developing new diagnostic techniques with high sensitivity and perfecting existing detection schemes have become the key research direction of the current ASF prevention and control system construction. SUMMARY

[0006] The purpose of the present application is to solve the key technical problems in the prevention and control of African swine fever (ASF), and to provide a duplex fluorescent quantitative PCR detection system that can achieve rapid and accurate diagnosis in the early stage (subclinical stage) of infection. The present application creatively develops a dual-target detection system for African swine fever virus (ASFV) and haptoglobin (Hp), including specific primer pairs, fluorescent probes and supporting detection methods, providing an innovative technical solution for early warning and accurate prevention and control of ASF.

[0007] To achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0008] Two pairs of specific primers and two specific probes are designed for porcine haptoglobin CDS region gene and African swine fever virus B646L gene, and the lengths of the amplified target fragments are 122bp and 113bp respectively, and the nucleotide sequences of the two groups of primers and probes are as follows:

[0009] Porcine haptoglobin CDS region gene:

[0010] Upstream primer HP-F (5'-3') GAAACGCCAACCTCAACTTTAC (SEQ ID NO. 1)

[0011] Downstream primer HP-R (5'-3') GCTCTTGGGTGTCTTCTTCTC (SEQ ID NO. 2)

[0012] Probe HP-P (5'-3') FAM-CAGTACTACGAAGGCAGCACCGTG-BHQ1 (SEQ ID NO. 3)

[0013] African swine fever virus B646L gene:

[0014] Upstream primer ASFV-F (5'-3') GCTATTCCCTCAGTATCCATTCC (SEQ ID NO. 4)

[0015] Downstream primer ASFV-R (5'-3') AAACGTGACTGGCGTACAA (SEQ ID NO. 5)

[0016] Probe ASFV-P (5'-3') HEX-TCGGCGAGCGCTTTATCACCATAA-BHQ1 (SEQ ID NO. 6)

[0017] The probe HP-P and the probe ASFV-P are respectively labeled with different fluorescent reporter groups at the 5' end, and the probe HP-P and the probe ASFV-P are labeled with the same fluorescent quenching group at the 3' end.

[0018] Further, the fluorescent reporter group is FAM or HEX, and the quenching group is BHQ1.

[0019] Further, the probe HP-P is labeled with FAM at the 5' end and BHQ1 at the 3' end; and the probe ASFV-P is labeled with HEX at the 5' end and BHQ1 at the 3' end.

[0020] The early diagnosis kit and detection method based on double fluorescent quantitative PCR of Haptoglobin (HP) and African swine fever virus (ASFV) comprise two pairs of specific primers and two specific probes.

[0021] Further, the kit further comprises an enzyme, a positive control and a negative control.

[0022] Further, the enzyme is Master Mix THUNDERBIRD Probe qPCR Mix; the positive control is an in vitro recombinant plasmid of a synthetic fragment of Haptoglobin and African swine fever virus; and the negative control is sterilized deionized water.

[0023] The early diagnosis kit and detection method based on double fluorescent quantitative PCR of Haptoglobin (HP) and African swine fever virus (ASFV) comprise the following steps:

[0024] Step one, extracting nucleic acid of the sample to be tested and reverse transcribing the RNA into cDNA;

[0025] Step two, using the kit of claim 4 to perform double fluorescent PCR amplification with the cDNA of step one as the template;

[0026] Step three, analyzing the qPCR product and determining whether the sample to be tested contains African swine fever virus and whether the content of Haptoglobin has changed significantly according to the amplification reaction result.

[0027] Further, in step two, the final concentration of the optimal upstream primer HP-F and the downstream primer HP-R for detecting the CDS region gene of Haptoglobin is 0.25 μmol / L, and the final concentration of the optimal probe HP-P is 0.3 μmol / L; and the final concentration of the optimal upstream primer ASFV-F and the downstream primer ASFV-R for detecting the B646L gene of African swine fever virus is 0.25 μmol / L, and the final concentration of the optimal probe ASFV-P is 0.35 μmol / L.

[0028] Further, in step two, the reaction program of double fluorescent PCR amplification is: 95℃ for 30s; (95℃ for 5s; 60℃ for 30s) × 40 cycles.

[0029] The core value of the application is embodied in:

[0030] 1. Breakthrough to establish the combined detection system of ASFV and inflammation marker Hp, through the cooperative interpretation of double indicators, the detection rate of subclinical infection period is significantly improved;

[0031] 2. The innovative design of the primer probe combination has high specificity, which can effectively distinguish ASFV epidemic strains from other pig-derived pathogens;

[0032] 3. Establish a standardized operation process and interpretation standard, which is suitable for the rapid screening needs of primary laboratories.

[0033] The popularization and application of this technology will effectively solve the key problems of "hidden infection difficult to find" and "early diagnosis not accurate" in the current ASF prevention and control, and provide important technical support for timely prevention and control measures and blocking of epidemic transmission.

[0034] Beneficial effects

[0035] The application relates to the field of animal disease detection technology, and is a double qPCR method, reagent and kit for realizing super-early diagnosis of African swine fever by jointly detecting host biomarker HP and ASFV nucleic acid. HP, as a leading biomarker, can be detected in serum 1 day after ASFV infection, which is much earlier than the detection time of ASFV nucleic acid, and can be used as an early warning means for ASFV infection. The B646L gene of African swine fever virus is one of the most commonly used target genes in African swine fever diagnosis, and is also the recommended genotyping target of the World Organization for Animal Health. The application establishes a double fluorescence PCR method by using HP and B646L gene, and innovatively combines the biomarker HP and ASFV nucleic acid detection, which can screen potential early ASFV infected pigs in pig farms while diagnosing ASFV infection, fills the diagnostic gap before the appearance of viremia after ASFV infection, and especially provides a new technical tool for coping with the challenge of African swine fever virus variation and recombinant strains. The method can improve the efficiency of biological safety measures, optimize the implementation accuracy of the "detection-eradication" strategy, and is suitable for precise removal in the case of ASF outbreak in pig farms or surrounding ASF outbreak, and provides an early monitoring and early warning means for epidemic prevention and control.

[0036] (1) This study innovatively combines the biomarker HP with ASFV nucleic acid detection to provide a new strategy for early identification of infection. This method provides a new technical tool for ASF prevention and control, especially for responding to the challenges of viral mutation and recombinant strains. By filling the diagnostic window before viremia, early warning of ASFV infection in high-risk pig herds can be provided, thereby blocking latent transmission before viremia. This method can improve the effectiveness of biosafety measures, optimize the implementation accuracy of the "detection-culling" strategy, and provide an adaptive strategy for responding to constantly mutating strains. This is the main innovation of this invention.

[0037] (2) (2) The qPCR detection method of the present invention has high sensitivity: the sensitivity of haptoglobin is 1.42×10 1 copies / μL, and the sensitivity of African swine fever was 2.23×10 1 The dual fluorescence quantitative PCR established in this invention exhibits excellent reproducibility. The intra-batch coefficient of variation (HP) for the eight gradients ranged from 0.08% to 1%, and for ASFV from 0.43% to 0.87%, both less than 2%, demonstrating extremely high reproducibility. The inter-batch coefficient of variation (HP) for the eight gradients ranged from 0.72% to 3.99%, and for ASFV from 0.15% to 2.38%, both less than 5%, demonstrating extremely high reproducibility.

[0038] (3) Multiplexity and high throughput: This dual fluorescence PCR system can simultaneously detect and identify African swine fever virus and haptoglobin in one reaction, saving detection time and cost. It can meet the requirements of large-scale testing, facilitate the timely diagnosis of disease infection, and gain valuable time for disease prevention and control.

[0039] (4) Strong specificity: The possible interference between pathogens was fully considered when designing primers and probes. Experiments have shown that this dual fluorescence PCR is effective against other important infectious diseases commonly found in pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Figure 1 is a graph showing the specific results of the haptoglobin probe, where 1 is the amplification curve of the haptoglobin positive control, and 3-5 are the amplification curves of the negative control, C-reactive protein (CRP), and transthyretin (TTR);

[0041] Figure 2 The figure shows the single-plex specificity result of the African swine fever virus probe, where 1 is the amplification curve of the positive control of African swine fever virus, and 4-9 are the amplification curves of the negative control, porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 virus (PCV2), classical swine fever virus (CSFV), Mycoplasma hyopneumoniae (MHP), and Actinobacillus pleuropneumoniae (APP);

[0042] Figure 3 Figure 1 is a result chart of double specific amplification curve of African swine fever virus and binding globulin, wherein 1 is binding globulin positive control amplification curve, 2 is African swine fever virus positive control amplification curve, 3-10 are negative control, porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 virus (PCV2), classical swine fever virus (CSFV), Mycoplasma hyopneumoniae (MHP), Actinobacillus pleuropneumoniae (APP), C-reactive protein (CRP), transthyretin (TTR) amplification curves;

[0043] Figure 4 Figure 2 is a binding globulin standard amplification curve chart;

[0044] Figure 5 Figure 3 is a binding globulin standard curve chart, Y = -3.3638X + 37.152 R2= 0.9993, wherein the abscissa LogQuantity is the gradient concentration of copy number, and the ordinate is the CT value;

[0045] Figure 6 Figure 4 is an African swine fever standard amplification curve chart;

[0046] Figure 7 Figure 5 is an African swine fever standard curve chart, Y = -3.2905X + 37.4 R2= 0.9835, wherein the abscissa LogQuantity is the gradient concentration of copy number, and the ordinate is the CT value;

[0047] Figure 8 Figure 6 is a double amplification curve result chart of binding globulin and African swine fever, wherein the solid line is the binding globulin amplification curve, and the dotted line is the African swine fever virus amplification curve;

[0048] Figure 9 Figure 7 is a double standard curve chart of African swine fever virus and binding globulin, wherein the binding globulin is Y = -3.657X + 40.52 R2= 0.999 from top to bottom, and the African swine fever virus is Y = -3.2642X + 38.64 R2= 0.998; 2 2 DETAILED DESCRIPTION

[0049] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0050] Example 1 Design and synthesis of binding globulin and African swine fever primers and probes:

[0051] ​​Based on NCBI sequence alignment, two pairs of specific primers and two specific probes were designed for porcine haptoglobin CDS region gene and African swine fever B646L gene, the length of the amplified target fragments was 122 bp and 113 bp, respectively, and the nucleotide sequences of the primers and probes were as follows:

[0052] Porcine haptoglobin CDS region gene:

[0053] Upstream primer HP-F (5'-3') GAAACGCCAACCTCAACTTTAC (SEQ ID NO. 1);

[0054] Downstream primer HP-R (5'-3') GCTCTTGGGTGTCTTCTTCTC (SEQ ID NO. 2);

[0055] Probe HP-P (5'-3') FAM-CAGTACTACGAAGGCAGCACCGTG-BHQ1 (SEQ ID NO. 3);

[0056] The probe was labeled with FAM at the 5' end and BHQ1 at the 3' end;

[0057] African swine fever virus B646L gene:

[0058] Upstream primer ASFV-F (5'-3') GCTATTCCCTCAGTATCCATTCC (SEQ ID NO. 4);

[0059] Downstream primer ASFV-R (5'-3') AAACGTGACTGGCGTACAA (SEQ ID NO. 5);

[0060] Probe ASFV-P (5'-3') HEX-TCGGCGAGCGCTTTATCACCATAA-BHQ1 (SEQ ID NO. 6);

[0061] The probe was labeled with HEX at the 5' end and BHQ1 at the 3' end. Preparation of positive controls for haptoglobin gene and African swine fever virus gene: synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. Among them, the sequence of haptoglobin CDS region is shown in SEQ ID NO. 7, and the sequence of African swine fever virus B646L gene is shown in SEQ ID NO. 8:

[0062] Optimization of double fluorescence PCR reaction system and amplification conditions for detecting porcine haptoglobin CDS region gene and African swine fever B646L gene:

[0063] (1) For the determined concentrations of primers and labeled probes, different primer and probe concentrations were designed to be 0.2 μmol / L, 0.25 μmol / L, 0.3 μmol / L, 0.35 μmol / L, and 0.4 μmol / L, with corresponding volumes of 0.4 μL, 0.5 μL, 0.6 μL, 0.7 μL, and 0.8 μL, respectively.

[0064] (2) Using Master Mix THUNDERBIRD Probe qPCR Mix reagents and recommended reaction amplification conditions, Fluorescent RT-PCR matrix screening experiments were performed on a 96Instrument quantitative PCR instrument using different combinations of primers and labeled probes.

[0065] (3) Based on the minimum Ct value, the higher fluorescence intensity increase value (ΔRn) and the typical S-shaped amplification curve, it was finally determined that the final concentrations of the optimal upstream primer and downstream primer for detecting the CDS region of porcine haptoglobin were both 0.25 μmol / L, and the final concentration of the optimal probe was 0.30 μmol / L; the final concentrations of the optimal upstream primer and downstream primer for detecting the African swine fever virus B646L gene were both 0.25 μmol / L, and the final concentration of the optimal probe was 0.35 μmol / L.

[0066] (4) Under the conditions of the optimal primer probe concentration and universal fluorescent RT-PCR reaction amplification reagent, a screening test was conducted on the annealing extension temperature in the range of 55℃-62℃, and the annealing extension temperature was finally determined to be 60℃.

[0067] (5) In the optimized 20 μL PCR reaction system, the final concentrations of the haptoglobin upstream and downstream primers were 0.25 μmol / L, the final concentration of the probe was 0.30 μmol / L, the final concentrations of the African swine fever virus upstream and downstream primers were 0.25 μmol / L, and the final concentration of the probe was 0.35 μmol / L. The amount of enzyme added was 10 μL, the amount of template added was 2.0 μL, and the total volume was made up to 20 μL with deionized water. The PCR amplification conditions were: 95°C for 30 s; (95°C for 5 s; 60°C for 30 s) × 40 cycles.

[0068] (6) Result determination

[0069] 1) Quality control standards:

[0070] The positive control shows a specific S-shaped amplification curve with a CT value of approximately 15-35; the negative control has no amplification curve and no CT value. If these conditions are met, the test result is considered valid.

[0071] 2) Result determination:

[0072] A, the sample to be tested only appears a specific amplification curve in the FAM channel, and has a CT value, then it is determined that the African swine fever nucleic acid does not exist in the sample to be tested, which is an HP single positive sample, and the copy number is calculated from the CT value and compared with the negative nucleic acid sample;

[0073] B, the sample to be tested appears specific amplification curves in both HEX and FAM channels, if the CT value of the HEX channel amplification curve is < 35, it is determined to be positive for African swine fever, if the CT value of the HEX channel amplification curve is 35 < Ct value ≤ 40, repeated testing is performed, and if the CT value of the repeated result is < 35, it is determined to be positive, if the CT value is 35 < Ct value ≤ 40, it is determined to be suspicious, and if there is no CT value, it is determined to be negative;

[0074] C: If no specific amplification curve appears in the FAM channel, it is determined whether the sample to be tested contains binding globulin or has quality problems.

[0075] Example 2 Specificity experiment of African swine fever virus and binding globulin single and double fluorescent PCR:

[0076] (1) Porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 virus (PCV2), classical swine fever virus (CSFV), Mycoplasma hyopneumoniae (MHP), Actinobacillus pleuropneumoniae (APP), C-reactive protein (CRP), and transthyretin (TTR) are all positive recombinant plasmids.

[0077] Single fluorescent PCR amplification was performed with the optimal reaction system and amplification conditions determined in the third step, and the results showed that only binding globulin and African swine fever virus positive controls had fluorescent signals, and other viruses, bacteria, mycoplasma and protein genomes had no fluorescent signals. The experimental results are shown in Figure 1 and Figure 2

[0078] Double fluorescent PCR amplification was performed with the optimal reaction system and amplification conditions determined in the third step, and the results showed that only binding globulin and African swine fever virus positive controls had fluorescent signals, and other viruses, bacteria, mycoplasma and protein genomes had no fluorescent signals. The experimental results are shown in Figure 3 .

[0079] The fifth step is to establish the sensitivity and standard curve of African swine fever virus and binding globulin double fluorescent PCR:

[0080] (1) The binding globulin CDS region gene positive control was serially diluted by 10 times, and fluorescent PCR amplification was performed with the optimal reaction system and amplification conditions determined in the third step, and the kinetic curve of fluorescent PCR amplification is shown in Figure 4 ;

[0081] (2) Draw a standard curve based on the amplification curve results, and the obtained standard curve regression equation is: y = -3.3638x + 37.152R 2 =0.9993, see Figure 5 The results showed that the designed primers and probes had high amplification efficiency and binding rate, strong sensitivity, and the optimized reaction conditions were suitable, which could detect 1.42*10 1 The positive control molecule of the haptoglobin CDS region gene can be used for the qualitative and quantitative detection of haptoglobin nucleic acid.

[0082] (3) The African swine fever virus B646L gene positive control was serially diluted 10 times and amplified by fluorescence PCR using the optimal reaction system and amplification conditions determined in the third step. The kinetic curve of fluorescence PCR amplification is shown in Figure 2. Figure 6 ;

[0083] (4) Draw a standard curve based on the amplification curve results, and the obtained standard curve regression equation is: y = -3.2905x + 37.4R 2 =0.9835, see Figure 7 ; Indicates that the designed primers and probes amplify

[0084] The efficiency and binding rate are high, the sensitivity is strong, the optimized reaction conditions are suitable, and 2.23*10 1 A copy of the African swine fever virus B646L gene positive control molecule can be used for the qualitative and quantitative detection of African swine fever virus nucleic acid;

[0085] (5) The CDS region gene of the haptoglobin and the positive control of the African swine fever virus B646L gene were serially diluted 10 times, and dual fluorescence PCR amplification was performed using the optimal reaction system and amplification conditions determined in the third step. The kinetic curve of the dual fluorescence PCR amplification is shown in FIG. Figure 8 ;

[0086] (6) Based on the amplification curve results, standard curves were drawn. The regression equation of the obtained standard curve was: haptoglobin: y = -3.657x + 40.52R 2 =0.999, African swine fever: y = -3.2642x + 38.64R 2 =0.998 Figure 9 ; Indicates that the designed primers and probes amplify

[0087] The efficiency and binding rate are high, the sensitivity is strong, the optimized reaction conditions are suitable, and the haptoglobin group can detect 1.42*10 1 The positive control molecule of the haptoglobin CDS region gene was detected in the African swine fever group, and 2.23*10 1One copy of the African swine fever virus B646L gene positive control molecule can be used for qualitative and quantitative detection of double nucleic acid.

[0088] Example 3 Reproducibility of African swine fever and haptoglobin duplex fluorescent PCR

[0089] Take 10 8 -10 1 8 gradient templates, each gradient 3 repeats, calculate the within-run coefficient of variation and between-run coefficient of variation of the concentration logarithmic value, the results are shown in Table 1-1, 1-2

[0090] Coefficient of variation (CV) = standard deviation SD / average number*100%

[0091] Intra-run reproducibility: the reproducibility of multiple duplicate tubes of the same sample in one test, CV less than 2%.

[0092] Between-run reproducibility: the reproducibility of the same sample between multiple batches of tests, CV less than 5%.

[0093] It is shown that the duplex fluorescent RT-PCR established has good reproducibility.

[0094] Table 1-1 Intra-run reproducibility test of duplex fluorescent PCR system

[0095]

[0096] The within-run coefficient of variation of 8 gradients HP is between 0.08% and 1%, and the within-run coefficient of variation of ASFV is between 0.43% and 0.87%, less than 2%, with very high reproducibility.

[0097] Table 1-2 Between-run reproducibility test of duplex fluorescent PCR system

[0098]

[0099] The between-run coefficient of variation of 8 gradients HP is between 0.72% and 3.99%, and the between-run coefficient of variation of ASFV is between 0.15% and 2.38%, less than 5%, with very high reproducibility.

[0100] The above description of the embodiments is to facilitate those of ordinary skill in the art to understand and use the present application. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments, without having to go through creative labor. Therefore, the present application is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present application, without departing from the scope of the present application, should be within the scope of protection of the present application.

Claims

1. An early diagnosis kit based on haptoglobin (HP) and African swine fever virus (ASFV) dual fluorescence quantitative PCR, characterized in that: The detection targets of the kit are the porcine haptoglobin CDS region gene and the African swine fever virus B646L gene. The lengths of the amplified target fragments are 122 bp and 113 bp, respectively. The kit contains two sets of primers and probes. The nucleotide sequences of the primers and probes are: Porcine haptoglobin CDS region gene: Upstream primer HP-F(5'-3')GAAACGCCAACCTCAACTTTAC Downstream primer HP-R (5'-3') GCTCTTTGGGTGTCTTCTTCTC probe HP-P(5′-3′)FAM-CAGTACTACGAAGGCAGCACCGTG-BHQ1; African swine fever virus B646L gene: Upstream primer ASFV-F (5'-3') GCTATTCCCTCAGTATCCATTCC Downstream primer ASFV-R (5'-3') AAACGTGACTGGCGTACAA Probe ASFV-P(5'-3')HEX-TCGGCGAGCGCTTTATCACCATAA-BHQ1.

2. The early diagnosis kit according to claim 1, characterized in that: The probe HP-P and the probe ASFV-P are respectively labeled with different fluorescent reporter groups at the 5' end, and the probe HP-P and the probe ASFV-P are labeled with the same fluorescent quencher group at the 3' end. Furthermore, the fluorescent reporter group is FAM or HEX, and the quencher groups are both BHQ1.

3. The early diagnosis kit according to claim 1 or 2, characterized in that: The probe HP-P is labeled with FAM at the 5' end and with BHQ1 at the 3' end; the probe ASFV-P is labeled with HEX at the 5' end and with BHQ1 at the 3' end.

4. The early diagnosis kit according to claim 3, characterized in that The kit also includes an enzyme, a positive control and a negative control. Further, the enzyme is Master Mix THUNDERBIRD Probe qPCR Mix; the positive control is an in vitro recombinant plasmid of haptoglobin and a synthetic fragment of African swine fever virus; and the negative control is sterilized deionized water.

5. A non-diagnostic method for detecting African swine fever virus (ASFV) based on dual fluorescence quantitative PCR of haptoglobin (HP), characterized in that: The following steps are involved: Step 1: Extract nucleic acid from the sample to be tested and reverse transcribe the RNA into cDNA; Step 2: Using the cDNA described in step 1 as a template, perform dual fluorescence PCR amplification using the kit described in claim 1; Step 3: Analyze the qPCR product and determine whether the sample to be tested contains African swine fever virus and whether the content of haptoglobin has changed significantly based on the amplification reaction results.

6. The detection method according to claim 5, characterized in that: In step 2, the final concentrations of the optimal upstream primer HP-F and downstream primer HP-R for detecting the CDS region gene of haptoglobin are both 0.25 μmol / L, and the final concentration of the optimal probe HP-P is 0.3 μmol / L; the final concentrations of the optimal upstream primer ASFV-F and downstream primer ASFV-R for detecting the African swine fever virus B646L gene are both 0.25 μmol / L, and the final concentration of the optimal probe ASFV-P is 0.35 μmol / L.

7. The detection method according to claim 5, wherein: In step 2, the reaction program of dual fluorescence PCR amplification is: 95° C. for 30 s; (95° C. for 5 s; 60° C. for 30 s)×40 cycles.

8. A primer and probe based on dual fluorescence quantitative PCR of haptoglobin (HP) and African swine fever virus (ASFV), characterized in that The nucleotide sequences of the primers and probes are: Porcine haptoglobin CDS region gene: Upstream primer HP-F(5'-3')GAAACGCCAACCTCAACTTTAC Downstream primer HP-R (5'-3') GCTCTTTGGGTGTCTTCTTCTC probe HP-P(5′-3′)FAM-CAGTACTACGAAGGCAGCACCGTG-BHQ1; African swine fever virus B646L gene: Upstream primer ASFV-F (5'-3') GCTATTCCCTCAGTATCCATTCC Downstream primer ASFV-R (5'-3') AAACGTGACTGGCGTACAA Probe ASFV-P(5'-3')HEX-TCGGCGAGCGCTTTATCACCATAA-BHQ1.

9. The primer and probe according to claim 8, characterized in that: The probe HP-P and the probe ASFV-P are respectively labeled with different fluorescent reporter groups at the 5' end, and the probe HP-P and the probe ASFV-P are labeled with the same fluorescent quencher group at the 3' end. Furthermore, the fluorescent reporter group is FAM or HEX, and the quencher groups are both BHQ1.

10. Use of the kit according to any one of claims 1 to 5, and the primers and probes according to claim 8 or 9 in the preparation of a reagent for detecting African swine fever virus.

Images