Propionibacterium acnes targeting repair patch capable of improving acne skin and preparation method of repair patch
By preparing a repair patch containing pullulan polysaccharide, sugar alcohol, royal jelly acid liposomes, and fig extract, the problem of existing acne treatment products being unable to target and inhibit Propionibacterium acnes and perform targeted repair was solved. This achieved targeted inhibition of Propionibacterium acnes growth and enhancement of skin barrier function, significantly improving acne-prone skin.
Patent Information
- Application Number
- CN202510893716.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-10-21
AI Technical Summary
Most existing acne treatment products are designed for use on the entire face. Their liquid state makes it difficult for bioactive ingredients to work effectively, and they lack targeted and spot-repairing functions.
A repair patch is prepared by combining pullulan polysaccharide, sugar alcohol, and royal jelly acid liposomes with fig extract and drying. This patch targets and inhibits Propionibacterium acnes, thereby enhancing the skin barrier function.
The repair patch can target and inhibit the growth of acne-causing Propionibacterium acnes, promote the expression of skin barrier proteins, and significantly improve acne-prone skin. It is suitable for targeted and precise care of acne-prone and sensitive skin, and has the effects of gentle acne removal and barrier repair.
Smart Images

Figure CN120815014A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a repair patch targeting Propionibacterium acnes and improving acne-prone skin and a preparation method thereof, belonging to the technical field of cosmetics. Background Art
[0002] At present, the occurrence of acne involves multiple factors, including endocrine changes, microbial infection, immune response, etc. Its clinical manifestations are diverse, mainly affecting adolescents and some adults. The skin characteristics of acne include polymorphic skin lesions such as comedones, papules, pustules, nodules, etc., and in severe cases, scars may form. In acne skin, Propionibacterium acnes ( C. acnes ) plays a key role in the development of acne. It can overproliferate within hair follicles, breaking down sebum to produce fatty acids, stimulating follicular inflammatory responses and leading to the development of acne. Propionibacterium acnes contributes to follicular epithelial hyperkeratosis, keratin plug formation, and comedonal formation. It induces comedonal formation by affecting integrin expression and promoting the production of free fatty acids. The biofilm formed by P. acnes colonization promotes keratinocyte aggregation, leading to the development of antibiotic resistance. P. acnes directly or indirectly activates the inflammatory cascade by activating both innate and adaptive immunity, including immune components such as Toll-like receptors (TLRs), antimicrobial peptides, protease-activated receptors (PARs), and matrix metalloproteinases. By activating antimicrobial peptides, protease-activated receptors, and matrix metalloproteinases, P. acnes produces inflammatory mediators, such as cytokines of the IL-1 family, promoting the intensification of the inflammatory response. P. acnes participates in the activation of the inflammasome, of which NOD-like receptors (NLRs) are key components, participating in the initiation of the inflammatory response. P. acnes interacts with the host immune system, impacting skin barrier function. Therefore, starting from inhibiting the growth of Propionibacterium acnes and the formation of biofilm, and combining this with the enhancement of the barrier function of the acne skin, it is possible to effectively alleviate the aggravation of acne and solve the acne problem.
[0003] Pullulan is a polysaccharide produced by Aureobasidium pullulans. Aureobasidium pullulans ) The extracellular polysaccharide produced by fermentation has good water solubility and film-forming properties. Its molecular formula is (C 37 H 62 O 30)n, CAS number 9057-02-7, is primarily composed of repeating maltotriose units linked by α-1,6 glycosidic bonds. In the food industry, it is used as a thickener, quality improver, and sweetener, and is widely used in surface coatings and thickeners for products such as candy, chocolate coatings, and fruit and vegetable juice beverages. In the pharmaceutical field, pullulan is used in capsules, coatings, and sustained-release formulations, and is favored for its plant-based origin, non-GMO properties, extremely low oxygen permeability, and chemical stability. Fig extract, particularly its rich dietary fiber and antioxidant content, has a certain scientific basis and traditional application in promoting digestive health and anti-oxidation. However, much of the efficacy research is still in the laboratory (in vitro) or animal model stage, and human clinical trial evidence is relatively limited and inadequate. Polyvinyl pyrrolidone (PVP) is a non-ionic polymer compound with colloidal protective, film-forming, adhesive, hygroscopic, solubilizing, or coagulating properties, and is often used as a film-forming agent. Sugar alcohols can be used as excipients in the freeze-drying (lyophilization) process. They play an important role in freeze-dried preparations (especially biopharmaceuticals, vaccines, diagnostic reagents and some foods). Their main purpose is to protect the active ingredients from damage during the freezing, drying and reconstitution processes and to provide a stable solid skeleton.
[0004] Most existing acne-removing products are intended for full-face application. Some high-performance products are designed for spot application. However, due to the liquid nature of these formulations, some bioactive ingredients are easily inactivated and struggle to exert their effective effects. Therefore, developing products that deliver high-efficiency, localized effects holds great promise. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention provides a repair patch that targets Propionibacterium acnes and improves acne-prone skin, and its preparation method. The patch, formulated with royal jelly acid liposomes and fig extract, is produced using a high-molecular-weight polysaccharide complex with sugar alcohols and then dried. In vitro and human evaluations have shown that it can inhibit the growth of acne-causing Propionibacterium acnes and improve the skin's barrier function.
[0006] The technical solutions of the present invention are as follows: The first aspect of the present invention provides a repair composition comprising the following components in parts by weight: 3.0-6.0 parts of pullulan, 1.0-3.0 parts of sugar alcohol, 8.0-12.0 parts of royal jelly acid liposomes, and 0.5-2.5 parts of fig extract.
[0007] Preferably, the sugar alcohol is erythritol.
[0008] The royal jelly acid liposomes were purchased from Shanghai Zhina Biotechnology Co., Ltd., and the actual content of royal jelly acid in the royal jelly acid liposomes was 5%.
[0009] Preferably, the fig extract is an extract of unripe fig fruit, and can be prepared according to the following steps: taking 100g of fresh unripe fig fruit, washing it with 4°C distilled water, and then high-speed homogenizing it with 300mL of 0.1M phosphate buffer with a pH of 7.0-7.5 for 2-4 minutes to form a homogenate; after continuing to extract the homogenate in an ice-water bath for 1-2 hours, centrifuging it at 4°C and 10,000-18,000 r / min for 15-25 minutes, and collecting the supernatant; charging the supernatant into a dialysis bag with a molecular weight cutoff of 10-14 kDa and dialyzing it at 4°C with a 0.01M phosphate buffer with a pH of 7.0-7.5, replacing the dialysis buffer every 4-8 hours for 3-5 times to obtain a fig extract; and vacuum freeze-drying the fig extract to obtain the fig extract.
[0010] The second aspect of the present invention provides the use of the above-mentioned repair composition in preparing a product that targets Propionibacterium acnes and improves acne-prone skin.
[0011] Preferably, the product comprises a repair patch.
[0012] The third aspect of the present invention provides a repair patch comprising the above-mentioned repair composition.
[0013] A fourth aspect of the present invention provides a method for preparing the above-mentioned repair patch, which specifically comprises the following steps: S1: Add pullulan and sugar alcohol to purified water, heat to 75-85°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 20-30°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: dilute the S2 solution to 100 parts by weight with purified water, and adjust the concentration to 0.05-0.2 g / cm 2 Lay flat and dry at a constant temperature of 28-35℃ until the moisture content is ≤3% to obtain the repair patch.
[0014] The above-mentioned repair patch can be cut according to actual needs to obtain repair patches of different areas.
[0015] The above-mentioned repair patch has the function of inhibiting the growth of acne-causing Propionibacterium acnes, and the fig extract and royal jelly liposomes synergistically enhance the skin barrier function in acne areas.
[0016] Beneficial effects: 1. The present invention discloses a repair composition that targets Propionibacterium acnes and improves acne-prone skin. A repair patch prepared with this repair composition as the main component can be cut at will to obtain a repair patch that targets and inhibits Propionibacterium acnes and has a fixed-point repair effect. The repair patch is prepared by mixing royal jelly acid liposomes and fig extract, and then mixing and drying pullulan and sugar alcohol. In vitro evaluation has shown that the repair patch can inhibit the growth of acne-causing Propionibacterium acnes; the repair patch, which is loaded with royal jelly acid liposomes and fig extract, can promote the expression of keratinocyte filaggrin and loricrin, synergistically strengthening the skin barrier; and human evaluation tests have shown that the repair patch can significantly improve acne-prone skin and reduce the area of red areas caused by acne.
[0017] 2. The main ingredients of the repair patch of the present invention are of natural origin, can be quickly adhered to moistened skin, and gradually dissolve to release active ingredients to exert their effects. It is suitable for targeted and precise care of acne skin, especially for acne-prone skin with damaged barrier, and has the effect of gently removing acne and repairing the barrier. In addition, the repair patch prepared by the present invention can also be used in conjunction with a variety of dosage forms, and can be used together with essences, aqueous solutions or emulsions with different functions to achieve a synergistic effect. In summary, the present invention is a new skin care method for removing acne and repairing acne-sensitive skin, and the effect is significant, and it has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 OD of Propionibacterium acnes suspension under different repair patches 600 Bar chart.
[0019] Figure 2 This is a bar graph showing the relative expression levels of the filaggrin gene FLG and the loricrin gene LOR in HaCaT cells under the action of different repair patches.
[0020] Figure 3 This is the improvement of subject No. 2 acne and red area.
[0021] Figure 4 This is the improvement of the acne and red area on subject No. 5.
[0022] Figure 5 This is the improvement of the acne and red area on subject No. 17. DETAILED DESCRIPTION
[0023] The present invention is further illustrated by the following examples, but the invention is not limited to the scope of the examples. Experimental methods in the following examples, where specific conditions are not specified, were performed according to conventional methods and conditions, or according to the product specifications. It should be understood that the specific examples described herein are intended only to illustrate the present invention and are not intended to limit the present invention.
[0024] Pullulan was purchased from Shandong Freda Biological Co., Ltd. with a molecular weight of 200-300 kDa.
[0025] Polyvinyl pyrrolidone was purchased from Beijing Kangtailong Technology Development Co., Ltd. with a molecular weight of 40-80 kDa.
[0026] Royal jelly acid liposomes were purchased from Shanghai Zhina Biotechnology Co., Ltd. The actual content of royal jelly acid in the royal jelly acid liposomes was 5%.
[0027] Fig extract is an extract of unripe fig fruit. The specific preparation method is as follows: 100 g of fresh unripe fig fruit is taken, washed with 4°C distilled water, placed in a pre-cooled homogenizer, and homogenized at high speed with 300 mL of 0.1 M, pH 7.0 phosphate buffer for 3 minutes to form a homogenate; the beaker containing the homogenate is placed in an ice-water mixture to maintain low temperature, and the beaker is manually shaken every 10 minutes for 1.5 hours. After that, the beaker is centrifuged at 4°C and 15,000 rpm for 20 minutes, and the supernatant is collected; the supernatant is placed in a dialysis bag (molecular weight cutoff of 12 kDa) and placed in 0.01 M, pH 7.0 phosphate buffer. The dialysis buffer is continuously stirred at 4°C, and is replaced every 6 hours for at least 4 times to obtain a fig extract; the fig extract is quickly placed in a -80°C ultra-low temperature freezer for pre-freezing, transferred to a freeze dryer, and vacuum freeze-dried to obtain the fig extract.
[0028] Example 1-3: Examples 1-3 provide a repair patch, respectively. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch comprises the following steps: S1: Add pullulan and erythritol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0029] Table 1. Raw material composition of repair patches of Examples 1-3 and Comparative Examples 1-8, unit: g
[0030] Comparative Example 1: Comparative Example 1 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan, erythritol, and PVP to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0031] Comparative Example 2: Comparative Example 2 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan and erythritol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0032] Comparative Example 3: Comparative Example 3 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan and sorbitol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0033] Comparative Example 4: Comparative Example 4 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan, sorbitol, and xylitol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0034] Comparative Example 5: Comparative Example 5 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan and xylitol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0035] Comparative Example 6: Comparative Example 6 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan and erythritol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0036] Comparative Example 7: Comparative Example 7 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan and erythritol to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0037] Comparative Example 8: Comparative Example 8 provides a repair patch. The raw material composition of the repair patch is shown in Table 1. The preparation method of the repair patch includes the following steps: S1: Add pullulan to partially purified water, heat to 80°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 25°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: Add the remaining purified water to the volume of S2 solution to 100 g, take 10 g of the mixture solution and pour it into a sterilized square dish (10 cm × 10 cm), spread it evenly, and place it in a constant temperature air box at 30°C to dry it until the water content is ≤3% to obtain a sheet product; S4: Cut the sheet product of S3 into an area of 2 cm × 2 cm to obtain a repair patch.
[0038] Experimental Example 1: Inhibitory effects of different repair patches on Propionibacterium acnes: The activated Propionibacterium acnes ATCC6919 (purchased from ATCC) bacterial collection was centrifuged at 12000 r / min to collect the cells, which were then resuspended in TSB liquid medium and diluted to a cell concentration of 1.0×10 6 CFU / mL. Add 5 mL of the diluted bacterial suspension to a culture tube. Add one repair patch prepared in the example and comparative example to the bacterial suspension, respectively. Set up a blank control group without the repair patch. After culturing at 37°C under anaerobic conditions for 72 hours, measure the absorbance of the bacterial suspension at a wavelength of 600 nm.
[0039] The experimental results are shown in Table 2 and Figure 1 As shown, it can be seen that different repair patches can inhibit the growth of Propionibacterium acnes. According to the records of Example 1, Example 2 and Comparative Example 6, when the addition amount of fig extract is gradually reduced from 1g to 0, the OD of the bacterial suspension is 600 The change was not obvious, indicating that the fig extract was not the key component to exert the antibacterial effect; according to the records of Example 1, Comparative Example 2 and Comparative Example 7, when the addition amount of royal jelly acid liposomes was gradually reduced from 10 g to 0, the OD of the bacterial suspension was 600 The change was significant, indicating that the antibacterial effect increased significantly with the increase in the amount of royal jelly acid liposomes added. Royal jelly acid liposomes are the key component to exert the antibacterial effect. According to the records of Example 1, Comparative Example 3, Comparative Example 4 and Comparative Example 5, when erythritol was used, the OD of the bacterial suspension was 600 It is lower, indicating that erythritol has better antibacterial effect than sorbitol and xylitol; according to the records of Example 1, Comparative Example 7 and Comparative Example 8, it can be seen that royal jelly acid liposomes and erythritol can synergistically inhibit the growth of Propionibacterium acnes.
[0040] King's formula was used to evaluate the combined effect of the components: Q=E(a+b) / (Ea+Eb-Ea×Eb), where Ea and Eb are the effects of the two drugs when acting alone, and E(a+b) is the effect of the two drugs when acting in combination. If Q < 0.55, it is obvious antagonism; 0.55≤q<0.85, it is antagonism; 0.85≤q<1.15, it is simple addition; 1.15≤q<20, it is synergistic enhancement; q≥20, it is significantly enhanced.
[0041] When the combined effect of royal jelly acid liposomes and fig extract was tested, E(a+b), Ea, and Eb were the inhibition rates of Example 1, Comparative Example 6, and Comparative Example 7, respectively, and Q = 0.95 was obtained, indicating that there was no synergistic effect between royal jelly acid liposomes and fig extract, and it was just a simple addition of the effects of the two components. When the combined effect of royal jelly acid liposomes and erythritol was tested, E(a+b), Ea, and Eb were the inhibition rates of Example 1, Comparative Example 7, and Comparative Example 8, respectively, and Q=1.37 was obtained, indicating that there is indeed a synergistic effect between royal jelly acid liposomes and erythritol.
[0042] Table 2. OD values of Propionibacterium acnes suspension under different repair patches 600
[0043] Experimental Example 2: Dissolution time of different repair patches: The repair patches prepared in the examples and comparative examples, cut into 2 cm × 2 cm pieces, were placed in separate petri dishes, and 0.8 mL of purified water was added. The dissolution time of the different repair patch samples was recorded. The results are shown in Table 3. It can be seen that although the existing film-forming agent PVP can shape the repair patch, it will result in a longer dissolution time.
[0044] Table 3. Dissolution time of different repair patches in purified water, unit: s
[0045] Experimental Example 3: Effects of different repair patches on skin barrier protein gene expression Human keratinocytes HaCaT (purchased from Wuhan Boster Bioengineering Co., Ltd.) were cultured at 2.0 × 10 5 The cells were inoculated into 6-well plates at a seeding density of 100 μg / well, with an inoculation volume of 2 mL per well. The cell culture medium used in the blank control group was high-glucose DMEM medium, supplemented with 10% fetal bovine serum (purchased from Lanzhou Rongye) and 1% penicillin-streptomycin double antibody solution (purchased from Gibco). The cell culture medium used in the experimental group was high-glucose DMEM medium dissolved with a different repair patch, supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin double antibody solution. The cell culture medium used in the positive control group was high-glucose DMEM medium containing 50 μM WY14643 (purchased from Sigma), supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin double antibody solution. The above-mentioned HaCaT cells were incubated at 37°C and 5% CO2 for 24 hours, and then real-time fluorescence quantitative PCR experiments were performed using TAKARA's RNA extraction kit, RNA reverse transcriptase kit, and TBGreen fluorescence quantitative kit. β-Actin As an internal reference gene, the filaggrin gene was determined FLG , loricrin gene LOR The relative expression level.
[0046] The primer sequences used for real-time fluorescence quantitative PCR are as follows: FLG F: 5'-GCCAGGGACAATCAGAGG-3', FLG R: 5'-TGGAAGCAGACCCAGACC-3'; LOR F: 5'-TCATGATGCTACCCGAGGTTTG-3'; LOR R: 5'-TGCAAATTTATTGACTGAGGCACTG-3'; β-Actin F: GTTGGAGCAAACATCCCCCA; β-Actin R: AGGGGAGCATCCTCCTCTTA.
[0047] The amplification procedure of real-time fluorescence quantitative PCR is as follows: Table 4. Real-time fluorescence quantitative PCR amplification program
[0048] The results are shown in Table 5 and Figure 2 As shown, the results show that different repair patches have a significant promoting effect on the expression of the two genes. According to the records of Example 1, Example 2 and Comparative Example 6, when the addition amount of fig extract is gradually reduced from 1g to 0, FLG and LOR The gene expression level was significantly reduced, indicating that fig extract has the effect of promoting FLG and LOR According to Example 1, Comparative Example 2 and Comparative Example 7, when the amount of royal jelly acid liposomes added was gradually reduced from 10g to 0, FLG and LOR The gene expression level was also significantly reduced, indicating that royal jelly acid liposomes also promote FLG and LOR Functional components of gene expression.
[0049] King's formula was used to evaluate the combined effect of royal jelly acid liposomes and fig extract. King's formula: Q=E(a+b) / (Ea+Eb-Ea×Eb), where Ea and Eb are the effects of the two drugs when acting alone, and E(a+b) is the effect of the two drugs when acting in combination. If Q<0.55, it is obvious antagonism; 0.55≤q<0.85, it is antagonism; 0.85≤q<1.15, it is simple addition; 1.15≤q<20, it is synergistic enhancement; q≥20, it is significantly enhanced.
[0050] When the royal jelly acid liposomes and fig extract were tested LOR When the combined action of genes, E (a + b), Ea, Eb are respectively LOR The gene expression improvement rate was Q = 1.21, indicating that royal jelly acid liposomes and fig extract had an LOR There is a synergistic effect in gene expression; When the royal jelly acid liposomes and fig extract were tested FLG When the combined action of genes, E (a + b), Ea, Eb are respectively FLG The gene expression improvement rate was Q = 1.32, indicating that royal jelly acid liposomes and fig extract had an FLG There is a synergistic effect in gene expression.
[0051] Table 5. Filaggrin gene expression in HaCaT cells under the action of different repair patches FLG , loricrin gene LOR The relative expression level
[0052] Experimental Example 4: Repair patch for local acne treatment: human evaluation Volunteers aged 18-25 with acne-prone skin were used as the test subjects. The test subjects were asked to continuously use the repair patch prepared in Example 1 on fixed points with a regular lotion, once every other day for 7 consecutive times. After 14 days, the improvement in acne and redness of the volunteers before and after use was measured to evaluate the improvement effect of the product on acne.
[0053] The results of human evaluation are as follows Figure 3 、 Figure 4 and Figure 5 As shown, the results show that the repair patch of Example 1 combined with ordinary aqueous products can significantly achieve the effect of removing acne after use by the test subjects, while improving the redness of the skin around the acne, and quickly repairing the acne skin while removing acne.
Claims
1. A repair composition comprising the following components in parts by weight: 3.0-6.0 parts of pullulan, 1.0-3.0 parts of sugar alcohol, 8.0-12.0 parts of royal jelly acid liposomes, and 0.5-2.5 parts of fig extract.
2. The repair composition according to claim 1, wherein The sugar alcohol is erythritol.
3. The repair composition according to claim 1, wherein The royal jelly acid content in the royal jelly acid liposome is 5%.
4. The repair composition according to claim 1, wherein The fig extract is an extract of unripe fig fruit and is prepared according to the following steps: taking 100 g of fresh unripe fig fruit, washing it with 4° C. distilled water, and then homogenizing it at high speed for 2-4 minutes with 300 mL of 0.1 M phosphate buffer with a pH of 7.0-7.5 to form a homogenate; after further extracting the homogenate in an ice-water bath for 1-2 hours, centrifuging it at 4° C. and 10,000-18,000 r / min for 15-25 minutes, and collecting the supernatant; placing the supernatant into a dialysis bag with a molecular weight cutoff of 10-14 kDa and dialyzing it at 4° C. with a 0.01 M phosphate buffer with a pH of 7.0-7.5, replacing the dialysis buffer every 4-8 hours for 3-5 times to obtain a fig extract; and vacuum freeze-drying the fig extract to obtain the fig extract.
5. Use of the repair composition according to claim 1 in preparing a product that targets Propionibacterium acnes and improves acne-prone skin.
6. The use according to claim 5, characterized in that The product includes a repair patch.
7. A repair patch comprising the repair composition according to claim 1.
8. The method for preparing the repair patch according to claim 7, characterized in that: The specific steps include: S1: Add pullulan and sugar alcohol to purified water, heat to 75-85°C, and stir until completely dissolved; S2: Cool the solution formed in S1 to 20-30°C, add royal jelly acid liposomes and fig extract, stir to dissolve, and mix evenly; S3: dilute the S2 solution to 100 parts by weight with purified water, and adjust the concentration to 0.05-0.2 g / cm 2 Lay flat and dry at a constant temperature of 28-35℃ until the moisture content is ≤3% to obtain the repair patch.