Molecular marker located in chromosome 9 and related to soybean crude oil content and application of molecular marker

By locating the SNP site Gm_Chr09_5332672 on soybean chromosome 9 and developing the KASP marker, the problem of traditional breeding methods being difficult to select high-oil soybean lines was solved, and rapid and accurate oil content identification and efficient breeding were achieved.

CN120818633AActive Publication Date: 2025-10-21SHANDONG AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511339872.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2025-10-21
Estimated Expiration
2045-09-19

AI Technical Summary

Technical Problem

Traditional breeding methods make it difficult to quickly and accurately select high-oil soybean varieties. Oil content is controlled by multiple genes and affected by environmental factors. Existing molecular marker technology is not stable and universal enough in the application of soybean oil content.

Method used

Through QTL positioning analysis, the SNP site Gm_Chr09_5332672 was discovered on soybean chromosome 9, and a molecular marker based on the KASP marker was developed. The crude oil content of soybean materials was detected by fluorescent quantitative PCR, and a specific primer set was designed for genotype identification.

Benefits of technology

It achieves rapid and accurate identification of soybean crude oil content, improves breeding efficiency, simplifies molecular marker-assisted selection, and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818633A_ABST
    Figure CN120818633A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and discloses a molecular marker located in a chromosome 9 and related to the content of soybean crude oil and application. A molecular marker GmChr095332672 which is closely linked with the crude oil content and is stable and reliable is obtained through QTL positioning analysis when the crude oil content of soybean seeds is measured, the molecular marker is located at the 5332672nd site on the ninth chromosome of a soybean reference genome Glycine max Wm82. A4. V1, a marker for KASP detection is developed on the basis of the site, and a primer group for amplifying the KASP marker is designed. The invention further provides a method for rapidly identifying the content of the soybean crude oil by utilizing the primer group of the molecular marker, and the method is simple, convenient and rapid, accurate in identification result and good in popularization and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a molecular marker located on chromosome 9 and associated with soybean crude oil content, and an application thereof. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is one of the most important oil crops worldwide. Its seeds are rich in protein and oil, making them a vital source of nutrition for humans and animals. As a major source of vegetable oil, soybean oil dominates the edible oil market. The crude oil content of soybeans directly impacts their economic value and breeding objectives, and therefore increasing oil content has been a key focus of soybean genetic improvement. However, oil content is a typical quantitative trait, controlled by multiple genes and strongly influenced by environmental factors such as temperature, light, and moisture. Traditional breeding methods struggle to accurately and rapidly select high-oil-producing lines. Therefore, modern breeding methods combined with molecular marker-assisted selection have become a key breakthrough in improving breeding efficiency.

[0003] QTL (quantitative trait locus) mapping technology has played a key role in studying the genetic basis of soybean oil content. By constructing different population types (such as F2 populations, recombinant inbred line (RIL) populations, and backcross populations) and mapping genetic maps using high-throughput molecular markers, it is possible to pinpoint key regions within the soybean genome that influence oil accumulation. The discovery of these QTLs provides a theoretical foundation for understanding the genetic mechanisms underlying oil synthesis and provides guidance for subsequent fine-grained mapping and candidate gene discovery. Currently, studies have identified QTLs closely associated with oil content on multiple chromosomes, with some regions recurring across diverse genetic backgrounds and environments, demonstrating strong stability and potential for application.

[0004] To better apply QTL research results to soybean breeding practices, developing stable, reliable, and versatile molecular markers is a key step. KASP (Kompetitive Allele-Specific PCR) marker technology has been widely used in crop molecular breeding due to its advantages such as high throughput, low cost, and high specificity. KASP is a fluorescence detection technology based on allele-specific amplification that can quickly and accurately genotype target loci and is suitable for rapid screening of large-scale samples. Combining KASP markers with QTL loci related to oil content can achieve efficient detection of target alleles, thereby assisting breeders in accurately selecting high-oil materials in early generations and significantly improving breeding efficiency.

[0005] Therefore, identifying key gene regions related to oil accumulation through QTL mapping and developing KASP markers based on these regions will not only help reveal the genetic mechanisms of soybean oil content but also provide reliable technical support for molecular breeding of high-oil varieties. This technical approach is expected to accelerate the progress of soybean oil improvement and promote the cultivation and promotion of new high-oil, high-yield, and high-quality soybean varieties. Summary of the Invention

[0006] One of the purposes of the present invention is to provide a molecular marker related to soybean crude oil content.

[0007] A second object of the present invention is to provide an application of the above-mentioned molecular markers related to soybean crude oil content.

[0008] To achieve the above object, the present invention adopts the following technical solutions: The present invention discloses molecular markers related to soybean crude oil content. The inventors measured crude oil content in soybean grains and, through QTL mapping analysis, located a linkage region in soybeans containing a single nucleotide polymorphism (SNP) site, designated Gm_Chr09_5332672. This site is located at position 5332672 on chromosome 9 of the soybean reference genome, Glycine max Wm82.a4.v1. This site contains a C / T base mutation, and the nucleotide sequence of this SNP site is shown in SEQ ID NO. 1. When the base at this site is C (CC genotype, hereinafter referred to as 0 / 0 genotype), the crude oil content of the soybean material is low, while when the base at this site is T (TT genotype, hereinafter referred to as 1 / 1 genotype), the crude oil content of the soybean material is high. Population validation results show that the crude oil content of soybean materials with the 1 / 1 genotype is extremely significantly higher than that of soybeans with the 0 / 0 genotype, with the difference being extremely significant.

[0009] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a C / T base mutation at position 25 of the sequence shown in SEQ ID NO.1, and the sequence is: GGCTATTCCACACCTTTTGAAGTG C / T ACAATGGATTTTATTATGTCACCATGGAAGGCATAAGTGTAGGGGAAAAAAGGCTTGACATAGCTCCAGAAACTTTTGAAATGAAAAAGAATAGAACAGGTGGAGTCATCATTGACACAGGAAGCACTATCACCTTCCTAGTTGATAGTG. (shown in SEQ ID NO. 1, the bold and underlined elements indicate the SNP site Chr09_5332672 (C / T)).

[0010] Based on the SNP site, a primer set of KASP markers was designed to amplify a primer set of molecular markers related to soybean crude oil content. The primer set sequence of the molecular marker is: Gm_Chr09_5332672-F1: GAAGGTGACCAAGTTCATGCTGGCTATTCCACACCTTTTGAAGTGC (shown in SEQ ID NO.2); Gm_Chr09_5332672-F2: GAAGGTCGGAGTCAACGGATTGGCTATTCCACACCTTTTGAAGTGT (shown in SEQ ID NO.3); Gm_Chr09_5332672-R: TATGCCTTCCATGGTGACATAATAAAATC (shown in SEQ ID NO.4).

[0011] The two forward primers were connected to different fluorescent linker sequences; the 5' end of the forward primer Gm_Chr09_5332672-F1 was connected to the FAM fluorescent linker sequence, and the 5' end of the forward primer Gm_Chr09_5332672-F2 was connected to the VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences were: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5); VIC:GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO. 6).

[0012] The present invention also discloses the use of the aforementioned molecular marker primer set in marker-assisted breeding for soybean crude oil content. Specifically, the molecular marker primer set of the present invention can be used in future marker-assisted breeding to identify the crude oil content of soybean materials by extracting DNA from seedling leaves and detecting the presence of the molecular markers of the present invention. This detection can be performed using fluorescent quantitative PCR, specifically the aforementioned molecular marker primer set.

[0013] The present invention also discloses the use of the above molecular marker primer set in identifying the crude oil content of soybeans. Specifically, the specific steps for identifying the crude oil content of soybeans are as follows: (1) The DNA of the tested soybean germplasm was used as a template for fluorescence quantitative PCR amplification. The primer set corresponding to the molecular marker Gm_Chr09_5332672 was used for fluorescence quantitative PCR amplification. The reaction system of fluorescence quantitative PCR amplification is shown in Table 1: Table 1 PCR amplification reaction system

[0014] Pre-read fluorescence at 30°C for 1 min, initial denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 61°C for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing and extension at 55°C for 1 min, 26 cycles; final fluorescence reading at 30°C for 1 min.

[0015] Primer set Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, Gm_Chr09_5332672-R was used for fluorescence quantitative PCR amplification. If the sample PCR product only detected the FAM fluorescence signal corresponding to the primer Gm_Chr09_5332672-F1 connected to the fluorescent linker sequence, the detection site was a 0 / 0 genotype, which was determined to be a homozygous type with a low crude oil content phenotype; if the sample PCR product only detected the VIC fluorescence signal corresponding to the primer Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence, the detection site was a 1 / 1 genotype, which was determined to be a homozygous type with a high crude oil content phenotype; if the primers Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence were simultaneously detected, the detection site was a 1 / 1 genotype, which was determined to be a homozygous type with a high crude oil content phenotype. The corresponding two FAM and VIC fluorescence signals indicate that the detection site is a 0 / 1 genotype (corresponding to the CT genotype), which is determined to be a heterozygous type with a medium crude oil content phenotype.

[0016] In addition, the present invention also protects a kit for identifying the crude oil content of soybeans, comprising the primer set Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, and Gm_Chr09_5332672-R. The other components of the kit are conventional reagents, specifically including 2×PCR Mix and ROX supplement. The present invention has specific restrictions on the concentration of the primer set, and a concentration of 10 μM can be used. The present invention has no specific restrictions on the sources of the 2×PCR Mix and ROX supplement; fluorescent quantitative PCR amplification reagents well known in the art can be used.

[0017] The kit of the present invention can be used to quickly identify the crude oil content of soybeans and can also quickly identify the crude oil content genotype of soybeans. The specific method refers to the specific steps for identifying the crude oil content of soybeans. By analyzing the results of fluorescent quantitative PCR amplification, if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr09_5332672-F1 connected to the fluorescent linker sequence, the detection site is a 0 / 0 genotype, which is determined to be a homozygous type with a low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence, the detection site is a 1 / 1 genotype, which is determined to be a homozygous type with a high crude oil content phenotype; if both FAM and VIC fluorescence signals corresponding to primers Gm_Chr09_5332672-F1 and Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence are detected at the same time, the detection site is a 0 / 1 genotype, which is determined to be a heterozygous type with a medium crude oil content phenotype.

[0018] The present invention has the following advantages: (1) The inventors of the present invention screened out a molecular marker Gm_Chr09_5332672 related to the crude oil content of soybeans. The molecular marker Gm_Chr09_5332672 is located on chromosome 9. The molecular marker Gm_Chr09_5332672 of the present invention can be used to quickly identify the high or low crude oil content of soybeans.

[0019] (2) Screening using markers linked to soybean crude oil content is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0020] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be easily, quickly and high-throughput applied to soybean crude oil content-related molecular marker-assisted breeding practice and material identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 These are the results of QTL mapping analysis for soybean crude oil content.

[0022] Figure 2 This is a box plot of the crude oil content distribution corresponding to the genotype of the Gm_Chr09_5332672 locus of the soybean population in Example 1 of the present invention. 0 / 0 means that the genotype of the Gm_Chr09_5332672 locus is a homozygous low crude oil content genotype, 1 / 1 means that the genotype of the Gm_Chr09_5332672 locus is a homozygous high crude oil content genotype, the dots show the data distribution, **** represents P <0.0001.

[0023] Figure 3 This is a result analysis diagram of the amplified molecular marker of the Gm_Chr09_5332672 site of the soybean population in Example 1 of the present invention.

[0024] Figure 4 This is a box plot of the crude oil content distribution corresponding to the genotype of the Gm_Chr09_5332672 locus of the soybean germplasm resources in Example 2 of the present invention. 0 / 0 means that the genotype of the Gm_Chr09_5332672 locus is a homozygous low crude oil content genotype, 0 / 1 means that the genotype of the Gm_Chr09_5332672 locus is a heterozygous medium crude oil content genotype, and 1 / 1 means that the genotype of the Gm_Chr09_5332672 locus is a homozygous high crude oil content genotype. The dots show the data distribution, and *** represents P <0.001, ** represents P <0.01. DETAILED DESCRIPTION

[0025] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0026] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0028] Example 1 Development of molecular markers related to soybean crude oil content The present invention analyzed 135 soybean population materials, using the crude oil content (%) of the soybean kernels to measure crude oil content. A higher value indicates a higher crude oil content, while a lower value indicates a lower crude oil content. The crude oil content of soybean kernels was measured. Through QTL mapping analysis, a linkage region containing a single nucleotide polymorphism (SNP) locus, designated Gm_Chr09_5332672, was identified in soybeans. This locus is located at position 5332672 on chromosome 9 of the soybean reference genome, Glycine max Wm82.a4.v1 (download: https: / / phytozome-next.jgi.doe.gov / ). This site contains a C / T mutation. The nucleotide sequence of this SNP is shown in SEQ ID NO. 1, at position 25 (counting from the first base at the 5' end). When the base of this site is C (CC genotype, 0 / 0 genotype), the crude oil content of the soybean material is low, and when the base of this site is T (TT genotype, 1 / 1 genotype), the crude oil content of the soybean material is high. The crude oil content distribution box plot corresponding to the genotype of the Gm_Chr09_5332672 site in the population is shown in Figure 2 Among them, the crude oil content of soybean materials with genotype 0 / 0 is low, and the crude oil content of soybean materials with genotype 1 / 1 is high. Moreover, the crude oil content of soybean materials with genotype 1 / 1 is significantly higher than that of soybean materials with genotype 0 / 0, that is, the difference in crude oil content between the two is extremely significant.

[0029] Based on the SNP site and its upstream and downstream sequences, a marker for KASP detection was developed, and the following primer set was designed using SnapGene: Gm_Chr09_5332672-F1: GAAGGTGACCAAGTTCATGCTGGCTATTCCACACCTTTTGAAGTGC (shown in SEQ ID NO.2); Gm_Chr09_5332672-F2: GAAGGTCGGAGTCAACGGATTGGCTATTCCACACCTTTTGAAGTGT (shown in SEQ ID NO.3); Gm_Chr09_5332672-R: TATGCCTTCCATGGTGACATAATAAAATC (shown in SEQ ID NO.4).

[0030] Fluorescence quantitative PCR amplification of the test samples was performed using this primer set. The results showed that if only the FAM fluorescence signal corresponding to the primer Gm_Chr09_5332672-F1 connected to the fluorescent linker sequence was detected in the sample PCR product, the detection site was a 0 / 0 genotype, which was determined to be a homozygous type with a low crude oil content phenotype; if only the VIC fluorescence signal corresponding to the primer Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence was detected in the sample PCR product, the detection site was a 1 / 1 genotype, which was determined to be a homozygous type with a high crude oil content phenotype; if both FAM and VIC fluorescence signals corresponding to the primers Gm_Chr09_5332672-F1 and Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence were detected at the same time, the detection site was a 0 / 1 genotype, which was determined to be a heterozygous type with a medium crude oil content phenotype ( Figure 3 ).

[0031] In this study, marker development was conducted in 135 soybean materials. 80 soybean materials had a genotype of 0 / 0 at the Chr09_5332672 locus, and 55 soybean materials had a genotype of 1 / 1 at the Chr09_5332672 locus. T-tests showed that the difference between the 0 / 0 and 1 / 1 types was extremely significant ( P <0.0001). The test results were consistent with the genotype at the Chr09_5332672 site and the actual crude oil content determination results ( Figure 2 ).

[0032] The 135 soybean materials used for marker development were the soybean materials disclosed in the article "Lei Lei, et al. Classification of Soybean Heterotic Groups Based on SSR Molecular MarkersforYield-Related Traits[J]. Crops, 2022(4): 54–61".

[0033] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention The above molecular markers were used to identify 51 soybean germplasm resources in the germplasm resource bank. The crude oil content of the soybean germplasm materials used and the genotype corresponding to the Chr09_5332672 locus are shown in Table 2: Table 2 Crude oil content of soybean seeds and genotypes corresponding to Chr09_5332672 locus in 51 germplasm materials

[0034] Using the genomic DNA of the soybean to be identified as a template, performing fluorescent quantitative PCR amplification using the primer pair to obtain a fluorescent quantitative PCR product; The reaction system for fluorescence quantitative PCR amplification was as follows: 1 μL of genomic DNA, 5 μL of 2× PCR Mix, 0.16 μL of ROX supplement, 0.1 μL of upstream primer F1, 0.1 μL of upstream primer F2, 0.3 μL of downstream primer R, and the mixture was made up to 10 μL with sterile distilled water; The reaction procedure of the fluorescent quantitative PCR amplification is preferably: pre-reading fluorescence at 30°C for 1 minute, initial denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, annealing and extension at 61°C for 1 minute, 10 cycles; denaturation at 94°C for 20 seconds, annealing and extension at 55°C for 1 minute, 26 cycles; final reading fluorescence at 30°C for 1 minute.

[0035] Determine the crude oil content of soybeans based on the fluorescent quantitative PCR product: As shown in Table 2, among the 51 soybean germplasm resources identified in this study, 31 soybean germplasm resources had a genotype of 0 / 0 at the Chr09_5332672 locus; 3 soybean germplasm resources had a genotype of 0 / 1 at the Chr09_5332672 locus; and 17 soybean germplasm resources had a genotype of 1 / 1 at the Chr09_5332672 locus. The T-test showed that the difference between the 0 / 0 type and the 1 / 1 type was extremely significant ( P <0.001, the difference between 0 / 0 and 0 / 1 types was very significant ( P <0.01). The test results were consistent with the genotype at the Chr09_5332672 site and the actual crude oil content determination results ( Figure 4 ), so the KASP marker of the present invention can effectively identify the high and low crude oil content of soybeans and can be used for the prediction and screening of soybean materials with high crude oil content.

[0036] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 9 and associated with soybean crude oil content, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a C / T base mutation at position 25 of the sequence shown in SEQ ID NO.

1. When the base at this site is C, the crude oil content of the soybean material is low, and when the base at this site is T, the crude oil content of the soybean material is high.

2. The molecular marker located on chromosome 9 and associated with soybean crude oil content according to claim 1, characterized in that: The molecular marker is a KASP marker.

3. A primer set for detecting the molecular marker according to claim 1, characterized in that: The primer set includes: Gm_Chr09_5332672-F1: GAAGGTGACCAAGTTCATGCTGGCTATTCCACACCTTTTGAAGTGC; Gm_Chr09_5332672-F2:GAAGGTCGGAGTCAACGGATTGGCTATTCCACACCTTTTGAAGTGT; Gm_Chr09_5332672-R: TATGCCTTCCATGGTGACATAATAAAATC.

4. The molecular marker primer set according to claim 3, characterized in that: The two forward primers were connected to different fluorescent linker sequences; the 5' end of the forward primer Gm_Chr09_5332672-F1 was connected to the FAM fluorescent linker sequence, and the 5' end of the forward primer Gm_Chr09_5332672-F2 was connected to the VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences were: FAM: GAAGGTGACCAAGTTCATGCT; VIC: GAAGGTCGGAGTCAACGGATT.

5. Use of the molecular marker primer set according to claim 3 in identifying or assisting in identifying the crude oil content of soybeans.

6. The use according to claim 5, characterized in that The method for identifying the crude oil content of soybeans comprises the following steps: (1) Extracting soybean genomic DNA; (2) using the genomic DNA extracted in step (1) as a template, performing fluorescence quantitative PCR amplification using the primer set of the molecular marker described in claim 3, and analyzing the fluorescence quantitative PCR amplification results; (3) Make a judgment based on the result of step (2). The specific criteria are: The primer set Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, and Gm_Chr09_5332672-R was used for fluorescence quantitative PCR amplification. If the sample PCR product only detected the FAM fluorescence signal corresponding to the primer Gm_Chr09_5332672-F1 connected to the fluorescent linker sequence, the site was a 0 / 0 genotype and was determined to be a homozygous type with a low crude oil content phenotype; if the sample PCR product only detected the VIC fluorescence signal corresponding to the primer Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence, the site was a 1 / 1 genotype and was determined to be a homozygous type with a high crude oil content phenotype; if the primers Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence were simultaneously detected, the site was a 1 / 1 genotype and was determined to be a homozygous type with a high crude oil content phenotype. If the corresponding two FAM and VIC fluorescence signals are detected, the locus is a 0 / 1 genotype, which is determined to be a heterozygous type with a medium crude oil content phenotype.

7. A kit for identifying the content of soybean crude oil, characterized in that: A primer set comprising the molecular marker according to claim 3.

8. Use of the kit according to claim 7 in identifying the content of soybean crude oil.

9. The use according to claim 8, characterized in that The method for identifying the soybean crude oil content using the kit is as follows: (1) Extracting soybean genomic DNA; (2) using the genomic DNA extracted in step (1) as a template, performing fluorescence quantitative PCR amplification using the primer set of the molecular marker described in claim 3, and analyzing the fluorescence quantitative PCR amplification results; (3) Analyze the results of fluorescence quantitative PCR amplification. If the sample PCR product only detects the FAM fluorescence signal corresponding to the primer Gm_Chr09_5332672-F1 connected to the fluorescent linker sequence, the site is a 0 / 0 genotype, which is determined to be a homozygous type with a low crude oil content phenotype; if the sample PCR product only detects the VIC fluorescence signal corresponding to the primer Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence, the site is a 1 / 1 genotype, which is determined to be a homozygous type with a high crude oil content phenotype; if both FAM and VIC fluorescence signals corresponding to the primers Gm_Chr09_5332672-F1 and Gm_Chr09_5332672-F2 connected to the fluorescent linker sequence are detected at the same time, the site is a 0 / 1 genotype, which is determined to be a heterozygous type with a medium crude oil content phenotype.

Citation Information

Patent Citations

  • 384 SNP loci and application thereof in soybean variety resource identification

    CN105567857A

  • Molecular marker for breeding or assisted breeding of high-fat soybeans and application of molecular marker

    CN118480621A

  • Molecular marker for identifying or assisting in identifying soybean oil content and application

    CN120624705A

  • Combination of Soybean Whole Genome SNP Loci, Gene Chip and Application Thereof

    US20220205053A1