Rape stain-resistant gene BnA07ERF151 and application thereof

By cloning the rapeseed waterlogging tolerance gene BnA07ERF151 and constructing an expression vector to introduce it into Arabidopsis thaliana, the problem of limited waterlogging tolerance resources in rapeseed breeding was solved, significantly improving the growth and survival rate of plants under waterlogging conditions, and promoting efficient waterlogging tolerance breeding and yield stability.

CN120829904APending Publication Date: 2025-10-24OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510989933.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

In existing rapeseed breeding, the resources of waterlogging-resistant genes are limited and the traditional breeding cycle is long, making it difficult to effectively mitigate the impact of waterlogging on rapeseed production, thus affecting yield stability and planting area.

Method used

The rapeseed waterlogging tolerance gene BnA07ERF151 was cloned and introduced into Arabidopsis thaliana by constructing the expression vector pCAMBIA1301-BnA07ERF151 to achieve gene overexpression and improve the plant's waterlogging tolerance.

Benefits of technology

It significantly improved the growth status and survival rate of plants under waterlogging conditions, with normal bolting development and a survival rate increase from 12.5% ​​to 43.75%. It provided core gene resources for efficient waterlogging-resistant breeding and ensured yield stability under extreme climate conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120829904A_ABST
    Figure CN120829904A_ABST
Patent Text Reader

Abstract

The invention discloses a rape waterlogging-resistant gene BnA07ERF151 and an application thereof. The nucleotide sequence of the gene BnA07ERF151 is as shown in SEQ ID NO. 1. The invention also discloses a method for preparing the rape waterlogging-resistant gene BnA07ERF151. According to the invention, a brand new stain-resistant gene BnA07ERF151 is cloned from rape for the first time, and is transferred into arabidopsis thaliana to construct a pure line plant and complete stain resistance identification. Experimental results show that the growth state of a transgenic BnA07ERF151 gene strain in a waterlogging environment is remarkably superior to that of a wild type, bolting development is normal, the survival rate is increased to 43.75% from 12.5%, and the key effect of the gene on enhancing the waterlogging resistance of plants is clearly confirmed; successful cloning of the waterlogging-resistant gene provides a core gene resource for cultivation of new crop varieties, a variety of crops can be endowed with stronger waterlogging tolerance through a transgenic assisted breeding means, and the yield stability under extreme climate is effectively guaranteed, which has great strategic significance in improvement of global agricultural disaster resistance and guarantee of grain safety, and has a wide application prospect. And the method has remarkable social and economic benefits and industrial application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to a rapeseed submergence tolerance gene BnA07ERF151 and application thereof. BACKGROUND

[0002] Rapeseed (Brassica napus L.) belongs to the Brassica genus of the Brassicaceae family. Double-low rapeseed oil has a high content of unsaturated fatty acids, up to 90%, and is the healthiest major plant edible oil with the highest content of unsaturated fatty acids and the lowest content of saturated fatty acids. It is widely planted in Asia, Europe and America. In China, rapeseed is the largest self-produced plant oil source and is widely planted in the Yangtze River Basin. Although the rapeseed yield in China has increased in recent years, the rapeseed production in China still faces many severe challenges. Due to the limitations of arable land area and production technology, rapeseed and rapeseed oil are heavily dependent on imports.

[0003] In recent years, global climate change has caused weather changes in rapeseed production areas, and submergence damage has become a key factor restricting rapeseed production. In the rice-rapeseed rotation mode in the Yangtze River Basin, the soil is heavy and the drainage capacity is insufficient after the rice harvesting period. When there is frequent rainfall in autumn and winter, submergence stress occurs frequently. Submergence damage leads to slow emergence, a sharp drop in emergence rate, poor individual development, and serious impact on yield stability and sowing area.

[0004] Due to the long breeding cycle, slow effect and narrow submergence tolerance germplasm of traditional crops, the current submergence tolerance breeding is slow. The rapidly developing biotechnology breeding, especially the transgenic technology, breaks the limitations between species and provides a new way for efficient submergence tolerance breeding, but the acquisition of submergence tolerance gene resources is the key to the new varieties of submergence tolerance transgenic crops. SUMMARY

[0005] The main purpose of the present application is to provide a rapeseed submergence tolerance gene BnA07ERF151 and application thereof, and to provide a rapeseed submergence tolerance gene BnA07ERF151 (BnaA07G0332500ZS / BnaA07g30130D) or protein. The target gene BnA07ERF151 is obtained by transcriptome analysis of submergence tolerance material ZS9 under waterlogging stress. The gene encodes an ERF transcription factor which participates in the response of rapeseed to waterlogging stress. The overexpression of the gene can effectively improve the submergence tolerance of Arabidopsis.

[0006] To achieve the above purpose, the present application provides a rapeseed submergence tolerance gene BnA07ERF151. The nucleotide sequence of the gene BnA07ERF151 is shown in SEQ ID NO. 1.

[0007] The application further provides the protein coded by the Brassica napus waterlogging tolerance gene BnA07ERF151, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

[0008] The application further provides an expression vector pCAMBIA1301-BnA07ERF151 containing the Brassica napus waterlogging tolerance gene BnA07ERF151.

[0009] The application further provides a primer pair for amplifying the Brassica napus waterlogging tolerance gene BnA07ERF151, and the base sequences of the primer pair are shown as SEQ ID NO. 3 and SEQ ID NO. 4.

[0010] The application further provides the application of the Brassica napus waterlogging tolerance gene BnA07ERF151 in improving the waterlogging tolerance of plants.

[0011] The application further provides the application of the protein in improving the waterlogging tolerance of plants.

[0012] The application further provides the application of the expression vector pCAMBIA1301-BnA07ERF151 in improving the waterlogging tolerance of plants.

[0013] The application further provides a method for improving the waterlogging tolerance of plants, comprising the following steps: constructing an expression vector containing the gene BnA07ERF151, introducing the expression vector into Agrobacterium, transforming plants by Agrobacterium to obtain T0 generation containing the gene BnA07ERF151, and obtaining a BnA07ERF151 transformed pure line through three generations of continuous screening.

[0014] Preferably, the plants are Brassica plants or Arabidopsis plants.

[0015] Compared with the prior art, the application has the beneficial effects that:

[0016] (1) The application first clones a novel waterlogging tolerance gene BnA07ERF151 from Brassica napus, constructs a pure line plant by being introduced into Arabidopsis, and completes waterlogging tolerance identification. Experimental data show that the growth state of the BnA07ERF151 gene strain in the waterlogging environment is significantly better than that of the wild type, the bolting development is normal, and the survival rate is increased from 12.5% to 43.75%, which clearly confirms the key role of the gene in enhancing the waterlogging tolerance of plants.

[0017] (2) The present application successfully clones the tolerance gene to provide core gene resources for new variety breeding of crops, and through transgenic assisted breeding, can endow various crops with stronger tolerance to waterlogging, and effectively guarantee the yield stability under extreme climate. This has great strategic significance for improving the global agricultural disaster resistance, and has significant social and economic benefits and industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other related drawings can also be obtained without creative labor.

[0019] Figure 1 It is an electrophoresis map of the amplification product of the gene BnA07ERF151; M: 2K Plus II DNA Ladder; blank control; empty vector; + is the PCR product of the gene BnA07ERF151.

[0020] Figure 2 It is a PCR identification result map of Agrobacterium into which the pCAMBIA1301-BnA07ERF151 plasmid is introduced; M: 2K Plus II DNA Ladder; blank control; empty vector; + is the bacterial liquid PCR of single clone shaking bacteria.

[0021] Figure 3 It is a RT-PCR detection result map of T3 generation positive plants of Arabidopsis thaliana transformed with the BnA07ERF151 gene; M: 2K Plus II DNA Ladder; blank control; WT is wild type; + is T3 generation positive strain.

[0022] Figure 4 It is a growth state map of T3 generation strain of Arabidopsis thaliana transformed with the BnA07ERF151 gene and wild type Arabidopsis thaliana (WT) under artificial simulated waterlogging stress.

[0023] The implementation of the present application, functional characteristics and advantages will be further described with reference to the drawings. DETAILED DESCRIPTION

[0024] In order to make the purposes, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be clearly and completely described below. The specific conditions not noted in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not noted by the manufacturers are all the conventional products which can be obtained by the market purchase. In addition, the technical solutions among the various embodiments can be combined with each other, but it must be based on that the combination of the technical solutions can be realized by the ordinary skilled in the art, when the combination of the technical solutions appears contradictory or unachievable, it should be considered that the combination of the technical solutions does not exist, and is not within the protection scope required by the present application. Based on the embodiments in the present application, all the other embodiments obtained by the ordinary skilled in the art without the premise of the creative labor belong to the protection scope of the present application.

[0025] The technical solutions of the present application will be further described in detail below in combination with the specific embodiments and the drawings. It should be understood that the following embodiments are only used to explain the present application, and are not used to limit the present application.

[0026] Embodiment 1: Discovery of the flooding tolerance gene BnA07ERF151 and the encoded protein of oilseed rape

[0027] In order to screen the flooding tolerance related genes, the transcriptome analysis under the waterlogging stress was carried out by using the flooding tolerance material ZS9, and the gene BnA07ERF151 which was induced to express under the waterlogging stress was screened by comparing the gene expression under the waterlogging stress and the normal conditions.

[0028] Taking ZS9 as the material, the total RNA was extracted by using the plant total RNA small amount extraction kit (Quangjin, ER501), the cDNA first strand was synthesized by using the cDNA kit (AT311) reverse transcription, the gene fragment was amplified, and the PCR reaction system was as follows: Green TaqMix 10 μL, 10 μM upstream primer (5’-AT GCGGAGATTCGTTATTGGC-3’, SEQ ID NO. 5) 0.5 μL, 10 μM downstream primer (5’-CGGCATAGGTCTCTGTTGCT-3’, SEQ ID NO. 6) 0.5 μL, cDNA 1 μL, dd H2O 8 μL, and the total volume was 20 μL;

[0029] The amplification procedure was as follows: 3 min of pre-denaturation at 95°C; 15 s of denaturation at 95°C, 15 s of annealing at 58°C, 1 min of extension at 72°C, for a total of 35 cycles; and finally 5 min of extension at 72°C. The PCR product was recovered using a gel recovery kit (Omega, D2500), and then the recovered product was ligated with a pCE3 Blunt Vector carrier to obtain a recombinant plasmid pCE3 Blunt Vector-BnA07ERF151, which was transformed into competent E. coli cells, and colonies were selected for PCR amplification and agarose gel electrophoresis to detect the target band (the results are shown in Figure 1) before sequencing. The nucleotide sequence of the BnA07ERF151 gene is shown in SEQ ID NO. 1, and the molecular weight is 753 bp, and the amino acid sequence encoded thereby is shown in SEQ ID NO. 2. Figure 1 ) before sequencing. The nucleotide sequence of the BnA07ERF151 gene is shown in SEQ ID NO. 1, and the molecular weight is 753 bp, and the amino acid sequence encoded thereby is shown in SEQ ID NO. 2.

[0030] The cDNA of Brassica napus with the gene BnA07ERF151 was used as a template, and the following primers were used: BnE ERF151-F (SEQ ID NO. 3): 5'-ATGTGTGGAGGAGCAGTAATTTCC-3'; and BnERF151-R (SEQ ID NO. 4): 5'-TCAAAACCAAAGATCCATGACATT-3', for PCR amplification, and the target Brassica napus salt-tolerant gene BnA07ERF151 was obtained by TA cloning.

[0031] Example 2: Method for constructing an expression vector of the Brassica napus salt-tolerant gene BnA07ERF151

[0032] Suitable homologous recombination primers (F: 5'-acgggggacgagctcggtaccATGTGTGGAGGAGCAGTAATTTCC-3', SEQ ID NO. 7; R: 5'-ttcgtcgactctagaggatccTCAAAACCAAAGATCCATGACATT-3', SEQ ID NO. 8) were designed according to the target fragment and the carrier pCAMBIA1301, and ZS9 cDNA was used as a template for amplification using Green Taq Mix. The PCR product was separated and recovered using agarose gel electrophoresis, and a BnA07ERF151 gene homologous recombination fragment was extracted.

[0033] The Omega plasmid extraction kit (catalog number: D6943) was used to extract the plant overexpression vector pCAMBIA1301-35S-NOS plasmid DNA, and the extracted plasmid was double-digested with two endonucleases, Bam HI and Kpn I, respectively. The enzyme digestion system included Bam HI 2μL, Kpn I 2μL, 10× Fly Cut Buffer, plasmid 2μg, and ddH2O to make up the total volume of 40μL. The enzyme digestion was carried out at 37℃ for 2h, and the target fragment was recovered and purified.

[0034] The purified vector and target fragment were then ligated using the ClonExpress II One Step Cloning Kit (Novozymes, C112). The ligation system consisted of the vector pCAMBIA1301-35S-NOS, 3.5 μL of the target fragment, 4 μL of 5×CE II Buffer, 2 μL of Exnase II, and ddH2O to a total volume of 20 μL. The cells were incubated at 37°C for 30 min and immediately cooled on ice to obtain the recombinant plasmid pCAMBIA1301-BnA07ERF151. Electrophoresis was performed using the BnA07ERF151 gene upstream primer and the vector downstream sequencing primer (F: 5'-ATGTGTGGAGGAGCAGTAATTTCC-3', SEQ ID NO. 9; R: 5'-TGTAAAACGACGGCCAGT-3', SEQ ID NO. 10). The ligated recombinant plasmid pCAMBIA1301-BnA07ERF151 was transformed into Escherichia coli DH5ɑ competent cells, colonies were selected for PCR amplification, and the target bands were detected by agarose gel electrophoresis before expansion culture.

[0035] Example 3 Agrobacterium Arabidopsis transformation and culture method

[0036] The recombinant plasmid pCAMBIA1301-BnA07ERF151 was transformed into competent Agrobacterium GV3101 (Beijing Quanshijin Biotechnology Co., Ltd.) (identification results are shown in Figure 2) to prepare an Agrobacterium-infected solution and infect Arabidopsis inflorescences using the floral dipping method. The infected plants were then covered with plastic film and incubated in the dark for 24 hours before being transferred to a greenhouse for conventional culture. Once the Arabidopsis matured, seeds were harvested from individual plants. Harvested Arabidopsis seeds were sterilized at 4°C and seeded on 1 / 2 MS solid medium containing the antibiotic Hyg (50 μg / ml). Positive seedlings were selected and transplanted onto a culture medium (a 1:1 volume ratio of vermiculite to nutrient soil). After the seedlings grew, leaves were excised and DNA was extracted. PCR was performed using primers specific for the BnA07ERF151 gene (F: AAGATGGGCGGCTGAGATTC, SEQ ID NO. 11; R: AGCTTTAACTCCACGGAGCC, SEQ ID NO. 12). The approximately 250-bp DNA sequence was verified. Continuously screen with antibiotic Hyg and perform target gene PCR detection until a pure line of Arabidopsis thaliana transgenic with BnA07ERF151 gene is obtained (see Figure 3 ).

[0037] Example 4 Identification of Waterlogging Resistance of Transgenic BnA07ERF151

[0038] The T3 generation transgenic Arabidopsis thaliana BnA07ERF151 gene obtained in Example 3 and wild-type Arabidopsis thaliana (WT) seeds were sown in 1 / 2MS solid culture medium. After germination, they were vernalized at 4°C for 2 days and cultured at 25°C for 7 days. Uniform seedlings were selected and transplanted into 8×8 cm square pots, with 4 plants per pot. The culture soil ratio was nutrient soil: vermiculite = 1:1. After 14 days of culture, the seeds were flooded (the water level completely covered the seedlings). Phenotypic observations were performed before treatment, 9 days after treatment, and 12 days after treatment (the results are shown in FIG). Figure 4 The survival rate was calculated 12 days after the treatment. Compared with the wild-type Arabidopsis thaliana, the transgenic Arabidopsis thaliana expressing the BnA07ERF151 gene had better growth than the wild-type. The BnA07ERF151 overexpressing lines all bolted normally, while the bolting of the surviving wild-type plants was inhibited and the survival rate was significantly improved. The survival rate of the wild-type was 12.5%, while the survival rate of the BnA07ERF151 overexpressing lines was 43.75%.

[0039] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of the present invention.

Claims

1. A waterlogging tolerance gene BnA07ERF151 of Brassica napus, characterized in that, The nucleotide sequence of the gene BnA07ERF151 is shown as SEQ ID NO.

1.

2. A protein encoded by the waterlogging tolerance gene BnA07ERF151 of Brassica napus according to claim 1, characterized in that, The amino acid sequence of the protein is shown as SEQ ID NO.

2.

3. An expression vector pCAMBIA1301-BnA07ERF151, characterized in that, The expression vector pCAMBIA1301-BnA07ERF151 contains the Brassica resistance gene BnA07ERF151 according to claim 1.

4. A primer pair for amplifying the waterlogging tolerance gene BnA07ERF151 of Brassica napus according to claim 1, characterized in that, The base sequence of the primer pair is shown as SEQ ID NO. 3 and SEQ ID NO.

4.

5. The Brassica resistance gene BnA07ERF151 according to claim 1 for use in improving the resistance of plants to waterlogging.

6. The protein according to claim 2 for use in improving the resistance of plants to waterlogging.

7. The expression vector pCAMBIA1301-BnA07ERF151 according to claim 3 for use in improving the resistance of plants to waterlogging.

8. A method for increasing the tolerance of a plant to water stress, characterized in that, The method comprises the following steps: An expression vector containing the gene BnA07ERF151 is constructed, the expression vector is introduced into Agrobacterium, and a T0 generation containing the gene BnA07ERF151 is obtained by transforming plants with Agrobacterium, and a BnA07ERF151-transferred pure line is obtained by screening for three generations in succession.

9. Use according to any one of claims 5 to 7 or method according to claim 8, characterized in that, The plant is a Brassica plant or an Arabidopsis plant.

Citation Information

Cited By

  • Application of rape stain tolerance gene BnC07ABF3 in improvement of plant stain tolerance

    CN121204142A