Use of lysophosphatidylcholine and dihydromyricetin in the preparation of a medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection

Abstract

The application belongs to the technical field of livestock and poultry antiviral drugs, and discloses application of lysophosphatidylcholine and dihydromyricetin in preparation of a medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection. The CAS number of the lysophosphatidylcholine is 17364-16-8, and the CAS number of the dihydromyricetin is 27200-12-0. The applicant carries out anti-infection research on the medicine composition at the cell level and the animal body level, finds that the medicine composition shows significant anti-PRRSV effect in vivo and in vitro, can reduce the proliferation of the virus in the pig body, reduce the damage of PRRSV infection to the lung tissue organs, effectively control the adverse effects caused by PRRSV infection on the body, and can weaken the clinical symptoms of the pig during PRRSV infection, and can be used for preventing and controlling the occurrence of porcine reproductive and respiratory syndrome.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of livestock and poultry antiviral small molecule compounds, and particularly relates to application of lysophosphatidylcholine and dihydromyricetin in preparation of a medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection. BACKGROUND

[0002] Porcine reproductive and respiratory syndrome (PRRS) is an infectious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV), which is mainly characterized by reproductive disorders in pregnant sows and respiratory difficulties in pigs of all ages. The disease is also known as "blue-ear disease" due to the bluish-ear phenomenon in infected pigs. PRRSV is an RNA virus of the Arteriviridae family, which mainly infects mononuclear macrophages, particularly porcine alveolar macrophages (PAMs). This infection affects the biological functions of the macrophages, leading to abnormal respiratory function and respiratory system disorders in infected pigs. PRRSV infection mainly manifests as premature birth, abortion, weak birth, stillbirth, and mummified fetus in pregnant sows, ultimately resulting in a significant increase in mortality rate of affected piglets and severely affecting the economic benefits of the pig breeding industry.

[0003] Despite over 30 years of research on PRRSV, its prevention and control remains a worldwide challenge. Therefore, it is imperative to explore new, cost-effective, and safe anti-PRRSV drugs. The development of new anti-PRRSV drugs is crucial for the prevention and control of PRRS outbreaks and the cost reduction and profit increase of the pig breeding industry.

[0004] Lysophosphatidylcholine is an intermediate product of lecithin metabolism in the body, and plays an important role in cell membrane composition, signal transduction, and cellular metabolism. Phosphatidylcholine is an important membrane component involved in immune regulation and has certain antiviral activity. Dihydromyricetin (DHM), also known as ampelopsin and baiyensin, is a dihydroflavonol flavonoid compound. Existing research has shown that dihydromyricetin has various pharmacological effects such as antioxidant, antitumor, anti-inflammatory, and antiviral activities. Dihydromyricetin is widely found in Ampelopsis plants, with an amount of up to 30% in tea vine. It has the advantages of low cost and easy availability. Related studies have shown that dihydromyricetin has certain antiviral activity against influenza virus and hepatitis B virus. However, the anti-PRRSV activity of lysophosphatidylcholine and dihydromyricetin has not been reported. Therefore, it is of great significance to explore the anti-PRRSV activity of lysophosphatidylcholine and dihydromyricetin and to investigate whether they have joint drug activity. SUMMARY

[0005] The present application aims at solving the problem that the porcine reproductive and respiratory syndrome virus (PRRSV) infection is difficult to prevent and treat, and provides the application of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicine for treating or preventing porcine reproductive and respiratory syndrome.

[0006] In order to achieve the above-mentioned purpose, the present application adopts the following technical measures:

[0007] The protection scope of the present application includes:

[0008] The application of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicine for treating or preventing porcine reproductive and respiratory syndrome.

[0009] The application of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection.

[0010] The above-mentioned application:

[0011] The lysophosphatidylcholine is 1-Palmitoyl-sn-glycero-3-phosphocholine (hereinafter referred to as 1-P), the molecular formula is C 24 H 50 NO7P, the molecular weight is 495.63, the CAS number is 17364-16-8, and the structural formula is as follows:

[0012]

[0013] The dihydromyricetin is Dihydromyricetin, the molecular formula is C 15 H 12 O8, the molecular weight is 320.25, the CAS number is 27200-12-0, and the structural formula is as follows:

[0014] .

[0015] The above-mentioned application, preferably, the lysophosphatidylcholine and dihydromyricetin are one of the main effective components in the composition.

[0016] The above-mentioned application, the molar ratio of the lysophosphatidylcholine and dihydromyricetin is 0.5-1:1-2.

[0017] The above-mentioned application, preferably, when the porcine reproductive and respiratory syndrome virus is PRRSV NADC30-like, the molar ratio of the lysophosphatidylcholine and dihydromyricetin is 0.5:2;

[0018] The application, preferably, when the porcine reproductive and respiratory syndrome virus is PRRSV WUH3, the molar ratio of lysophosphatidylcholine to dihydromyricetin is 1:1.

[0019] Compared with the prior art, the application has the following advantages:

[0020] 1. The use of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin in combination for preparing an agent for inhibiting PRRSV is disclosed for the first time, and the two have a synergistic inhibitory effect on PRRSV.

[0021] 2. The small molecule compounds 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin in the application can reduce the infection activity of PRRSV cells at the cell level, inhibit the infection of PRRSV on cells, and reduce the proliferation of viruses on cells, and can be used for preventing and controlling PRRSV infection.

[0022] 3. Animal experiments prove that the small molecule compounds 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin in the application can effectively protect pigs from the morbidity and death caused by PRRSV infection, the survival rate of pigs in the control group is 20%, the survival rate of pigs in the group fed with the small molecule compounds 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin reaches 100%; the small molecule compounds can significantly inhibit the excretion of PRRSV, reduce the pollution to the environment, significantly alleviate the clinical symptoms such as fever, depression and reduced feed intake caused by PRRSV infection, effectively control the adverse effects of PRRSV infection on the body, and can be used for preventing and controlling PRRSV. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 It is a schematic diagram of the cytotoxicity of 1-P and Dihydromyricetin on Marc145 and primary PAM cells.

[0024] A is the cytotoxicity detection of 1-P and Dihydromyricetin on Marc145 cells, and B is the cytotoxicity detection of 1-P and Dihydromyricetin on primary PAM cells.

[0025] Figure 2 It is the influence of 1-P and Dihydromyricetin on the proliferation of PRRSV in Marc145 cells and primary PAM cells.

[0026] Wherein A is the effect of 1-P on the proliferation of NADC30 in Marc145 cells and primary PAM cells, B is the effect of Dihydromyricetin on the proliferation of NADC30 in Marc145 cells and primary PAM.

[0027] Figure 3 HSA index of 1-P combined with Dihydromyricetin.

[0028] Figure 4 Loewe index of 1-P combined with Dihydromyricetin.

[0029] Figure 5 Bliss index of 1-P combined with Dihydromyricetin.

[0030] Figure 6 ZIP index of 1-P combined with Dihydromyricetin.

[0031] Figure 7 FIC index verification of 1-P combined with Dihydromyricetin.

[0032] Wherein: A is the effect of different drug treatment methods on the proliferation of PRRSV WUH3 in Marc145 cells, B is the effect of different drug treatment methods on the proliferation of PRRSV WUH3 in PAM cells.

[0033] Figure 8 Effect of 1-P combined with Dihydromyricetin on the clinical symptoms of PRRSV infected pigs.

[0034] Figure 9 Effect of 1-P combined with Dihydromyricetin on the survival rate of PRRSV infected pigs.

[0035] Figure 10 Effect of 1-P combined with Dihydromyricetin on the virus content in the serum of PRRSV infected pigs.

[0036] Figure 11 Effect of 1-P combined with Dihydromyricetin on the body temperature of PRRSV infected pigs.

[0037] Figure 12 Effect of 1-P combined with Dihydromyricetin on the body weight of PRRSV infected pigs.

[0038] Figure 13 Effect of 1-P and Dihydromyricetin combination on the viral load of PRRSV infected swabs.

[0039] Figure 14 Effect of 1-P and Dihydromyricetin combination on the viral load of PRRSV infected swabs.

[0040] Figure 15 Effect of 1-P and Dihydromyricetin combination on the viral load of PRRSV infected swabs.

[0041] Figure 16 Effect of 1-P and Dihydromyricetin combination on the lung lesions of PRRSV infected swabs. DETAILED DESCRIPTION

[0042] In order to better understand the content of the present application, the content of the present application is further described below in combination with specific examples, but the protection content of the present application is not limited to the following examples. The test methods and conditions in the examples of the present application are all conventional methods unless otherwise specified. The technical solutions described in the present application are all conventional solutions in the field unless otherwise specified; the reagents or materials described are all from commercial channels unless otherwise specified.

[0043] The PRRSV Wh3 virus used in the examples of the present application is a highly pathogenic strain WUH3 (i.e. the highly pathogenic PRRSV WUH3 strain involved in DOI: 10.7666 / d.Y2004267), and the PRRSV NADC30-GFP used is a PRRSV NADC30-like strain screened by the applicant plus a GFP fluorescent marker.

[0044] In the examples of the present application, the molecular formula of 1-Palmitoyl-sn-glycero-3-phosphocholin (1-P) is C 24 H 50 NO7P, the molecular weight is 495.63, the CAS number is 17364-16-8, and the structural formula is as follows:

[0045]

[0046] Dihydromyricetin (DHM) is a dihydroflavonol flavonoid compound, the molecular formula is C 15 H 12 O8, the molecular weight is 320.25, the CAS number is 27200-12-0, and the structural formula is as follows:

[0047] .

[0048] Example 1

[0049] Screening of small molecule compounds against PRRSV infection

[0050] 1. Culture of Marc-145 cells

[0051] Marc145 cells stored in liquid nitrogen were taken out from the liquid nitrogen tank, quickly placed in a 37°C water bath to heat and quickly dissolve the cells, then the cell suspension was centrifuged at 1000 r / min for 7 min, after centrifugation the supernatant was discarded, resuspended with 1640 culture medium (10% serum + 1% double antibody), the cell suspension was transferred to a T25 cell bottle and cultured in a constant temperature cell incubator at 37°C with 5% CO2. After the cells grew into a uniform monolayer, the cells were passaged, first washed with PBS for 3 times, then trypsin was added for 37°C digestion for 3-5 min, the digestion was terminated with 1640 culture medium (10% serum + 1% double antibody), the cell suspension was centrifuged at 1000 r / min for 7 min, then the supernatant was discarded, fresh 1640 culture medium (10% serum + 1% double antibody) was added to resuspend the cells, then the cells were inoculated into new cell culture bottles or plates for standby.

[0052] 2. Preparation and culture of alveolar macrophage (PAM) cells

[0053] Primary PAM cells were taken from 30-day-old piglets. First, the piglets were killed and the chest cavity was slowly opened, the trachea was separated and closed with sterile hemostatic forceps to prevent external gas from entering the lungs. Then the lungs, heart and trachea (to the throat) of the piglets were taken out, quickly put into a high-pressure sterilized plastic bag and stored on ice, and the storage time should not exceed 4 h. Then, the surface and bag opening of the plastic bag were disinfected with 75% alcohol, transferred to a biological safety cabinet, and the lungs were taken out and placed in a disinfected tray. The entire lung surface was washed with sterile PBS to completely remove blood and other substances, and the excess tissue around the throat trachea was cut off with sterile scissors, and the throat was trimmed to avoid contamination of the cell liquid by excess tissue. Then the lung lavage work began. First, the trachea was lifted with sterile hemostatic forceps, and 1640 culture medium (10% serum + 1% double antibody) was continuously injected into the lungs through the throat with a pipette, and each lobe was rubbed to promote the culture medium to fully enter the alveoli. When the lungs were filled, the liquid in the lungs was poured into a 50 mL centrifuge tube, and the lavage was repeated several times until the lavage fluid was clear and transparent, then centrifuged at 4°C, 1500 r / min for 7 min, the supernatant was discarded, 20 mL of RPMI 1640 medium was added to resuspend the cells, and centrifuged again. Centrifuge for 3 times, the fourth time, centrifuge at 4°C, 1500 r / min for 5 min, discard the supernatant, add a small amount of RPMI 1640 medium to resuspend the cells, and collect the liquid in all centrifuge tubes into one centrifuge tube. Filter with a 70 μm filter to remove mucus and other substances, transfer to a new 50 mL centrifuge tube, take 20 μl of cell liquid and add to the counting plate for automatic cell counting. After counting, supplement 1640 culture medium (10% serum + 1% double antibody) to 5x10 6 cells per well of a 24-well plate, and incubate in a 37°C, 5% CO2 incubator.

[0054] 3. Anti-PRRSV treatment of small molecule compounds in Marc 145 cells and alveolar macrophages (PAM)

[0055] Marc145 cells were evenly inoculated in 24-well cell plates and placed in a constant temperature cell incubator for culture. After the cells grew into a uniform monolayer, the supernatant was discarded, and the cells were washed with sterile PBS for 3 times, and then 1640 medium containing 0 μM, 5 μM, 10 μM, 20 μM, 40 μM 1-P compound was added, and a blank control group without 1-P compound was set. After 6 h, the supernatant was discarded, and the cells were washed with PBS for 3 times, and then 1640 medium containing 0 μM, 5 μM, 10 μM, 20 μM, 40 μM 1-P compound (0% serum + 1% double antibody) and PRRSV WUH3 virus (0.1 MOI) were added, and the cells were cultured in a cell incubator for 2 h, then the supernatant was discarded, and the cells were washed with PBS for 3 times, and then new medium containing different concentrations of compounds was added, and the 24-well cell plates were placed in a constant temperature cell incubator for culture for 24-36 h; the concentration of compound Dihydromyricetin for cell treatment was 0 μM, 25 μM, 50 μM, 100 μM, and the rest of the treatment was the same as compound 1-P. The method of treating PAM cells with compounds was the same as that of Marc145.

[0056] 4. Determination of PRRS virus load in cells and virus solution

[0057] The above treated 24-well cell plates were placed in a -80°C refrigerator and repeatedly frozen and thawed for 3 times to fully release the virus particles in the cells, and then the supernatant was centrifuged for virus load detection. The detection method was detected according to the real-time fluorescent quantitative PCR method recommended by the People's Republic of China National Standard Blue Ear Detection Method (GB / T18090-2023), primer sequence F: 5'-GCACTGATTGACAYTGTGCC-3'; R: 5'-CGCATGGTTCTCGCCAAT-3'; probe primer: 5'-(FAM)AGTCACCTATTCAATTAGGGCGACCG(TAMRA)-3'.

[0058] 5. Small molecule compound cytotoxicity detection (CCK-8)

[0059] First, Marc145 cells and PAM cells in good condition were taken, and 100 μL of each was inoculated in a 96-well cell plate, wherein the density of Marc145 cells was 1×10 6 / ml, and the density of PAM cells was 1×10 6 / mL, and placed in a constant temperature cell incubator for 24 h; 24 h later, the medium was changed, and fresh medium containing the corresponding concentration of 1-P compound was added, and a cell-free control group was set up, and placed in a constant temperature cell incubator for 48 h, and then the medium was discarded, 100 μL of 1640 medium containing 10 μL of CCK-8 reagent was added to each well, and incubated at 37°C in the dark for 2 h, and the OD450nm reading was detected by an enzyme-labeled instrument, and the cell survival rate was calculated. Cell survival rate (%) = (drug treatment group OD450nm - cell-free control group OD450nm) / no drug control group OD450nm x 100%. The results are shown in Figure 1 Fig. 6, 40 μM of 1-P compound had no toxic side effects on Marc145 cells and primary PAM cells, and 50 μM of DHM had no toxic side effects on Marc145 cells and primary PAM cells.

[0060] The 24-well cell plate cultured for 24 h was placed in a -80°C refrigerator and repeatedly frozen and thawed for 3 times to fully release the virus particles, and then the virus liquid was collected in a 1.5 mL centrifuge tube, centrifuged at 3000 r / min for 10 min, the precipitate was discarded after centrifugation, and the supernatant virus liquid was stored in a -80°C refrigerator for TCID 50 detection. First, a 96-well plate with Mar145 cells was taken, and then the collected virus liquid was diluted by 10 times by gradient dilution to 10 -8 , and then 6 repeats of each concentration gradient were inoculated in the 96-well plate, 100 μL per well, and then the 96-well plate was placed in a cell incubator at 37°C containing 5% CO2 for culture, and after 72 h, the cytopathic effect was observed and the number of cytopathic wells was recorded, and the virus titer was calculated according to the Reed Mueneh method. The results are shown in Figure 2 Fig. 7, 1-P and DHM can significantly inhibit the proliferation of PRRSV WUH3 in Marc145 and PAM cells, and show a dose-dependent effect.

[0061] 7.1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin combined drug chessboard experiment

[0062] The cultured Marc145 cells were digested and evenly spread on 3 pieces of 96-well black transparent cell plates, and then placed in a constant temperature cell incubator for 24 h; 24 h later, 1-P and DHM were mixed according to different concentrations and inoculated into different wells of the 96-well plate for drug pretreatment, and after 6 h of pretreatment, the cell supernatant was discarded and the different concentrations of small molecule compounds were re-inoculated for drug pretreatment; 6 h later, the supernatant was discarded and new different concentrations of small molecule compounds containing PRRSV NADC30-GFP or PRRSV WUH3 were inoculated, and the cell plate was placed in a 37°C incubator for culture, and after 2 h of culture, the supernatant was discarded and washed with sterile PBS for 3 times, and different concentrations of small molecule compounds were re-inoculated and the cell plate was placed in a 37°C incubator for culture for 24 h, and after 24 h, the samples were collected to detect the inhibition rate of different concentrations of drugs on PRRSV-GFP in Marc145 cells, and the calculation formula was: inhibition rate = (viral load of control group-viral load of drug group) / viral load of control group x 100%.

[0063] 8. Evaluation of the synergistic effect of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin on NADC30-GFP strain

[0064] The different concentrations of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin obtained by the above checkerboard experiment were combined to analyze the proliferation of NADC30-GFP in Marc145 cells, and the inhibition rate shown in Table 1 was obtained, and Table 1~table3 in Table 1 were the results of three repeats per well. Then the data in Table 1 were further analyzed by SynergyFinder to explore the synergy index of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin, and the results are shown in Figure 3 、 4 , 5, 6, and the HSA score, Bliss score, ZPI score and Loewe score of SynergyFinder analysis index all showed that 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin showed strong synergistic effect, among which the Bliss score-0.25<0 met the synergistic effect condition, and the HSA score 12.36 showed strong synergistic effect of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin.

[0065] Table 1. Inhibition rate (%) of PRRSV NADC30-GFP in Marc145 cells after 1-P combined with DHM

[0066]

[0067] 9.1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin combined drug effect evaluation on PRRSV WUH3

[0068] After determining the synergistic effect of 1-P and DHM, Figure 7 , in order to further evaluate the specific situation of 1-P and DHM combined drug, further chessboard experiment inoculates PRRSV WUH3 sample for fluorescence quantitative detection, the detection results are shown in Table 2, Table 1~table3 in Table 1 are the results of three repeats per well.

[0069] Table 2. Detection of PRRSV Wh3 viral load (CT) in Marc145 cells after 1-P combined with DHM

[0070]

[0071] The synergistic effect is shown in Table 3:

[0072] According to Table 1, the minimum concentration of 1-P against NADC30-GFP is 4 μM, and the minimum concentration of DHM against NADC30-GFP is 5 μM. When 1-P and DHM are combined, 1-P is 1 μM and DHM is 1 μM, which has an inhibitory effect on NADC30-GFP, and the graded antiviral index is 0.45.

[0073] According to Table 2, the minimum concentration of 1-P against PRRSV WUH3 is 5 μM, and the minimum concentration of DHM against PRRSV WUH3 is 7 μM. When 1-P and DHM are combined, 1-P is 0.5 μM and DHM is 2 μM, which has an inhibitory effect on PRRSV, and the graded antiviral index is 0.386.

[0074] FICI calculation formula: FICI = MIC of A drug when combined / MIC of A drug when used alone + MIC of B drug when combined / MIC of B drug when used alone, synergistic antiviral effect, FICI≤0.5; additive effect, 0.5<FICI≤1; irrelevant effect, 1<FICI≤2; antagonistic effect, FICI>2.

[0075] Table 3. Minimum antiviral concentration of 1-P and DHM on PRRSV and graded antiviral concentration index

[0076]

[0077] Example 2

[0078] Effects of 1-P combined with DHM on PRRSV infection in pigs

[0079] 1. Preparation of animal room and experimental animals

[0080] Preparation of experimental animal room:

[0081] The experimental animal room was thoroughly cleaned 5-7 days before the start of the animal experiment, including wall and floor hygiene and disinfection of the feeding pen, followed by closed fumigation disinfection, and then standby after disinfection.

[0082] Preparation of experimental animals:

[0083] The test animals were tested for common pathogens one week before the experiment to ensure that the test pigs were healthy piglets, and the experimental piglets were transported to the general animal room two days before the experiment and tested for PRRSV serology to ensure that the experimental animals were PRRSV-negative pigs. Ten PRRSV-negative piglets of about 35 days of age were randomly grouped and transferred to a specific PRRSV test animal room for feeding for 2-3 days, and the piglets were observed for feeding status to ensure that each piglet could normally eat and drink water.

[0084] 2. Animal experiment design

[0085] Ten PRRSV-negative pigs (35-day-old weaned piglets) were randomly divided into two groups, a control group and a test group, with 5 pigs in each group. The numbers of the 5 pigs in the control group were 61, 62, 63, 64, and 65, and the numbers of the 5 pigs in the test group were 66, 67, 68, 69, and 70. All animals were raised in an animal room that met the GMP animal experiment specifications. The test group was administered sterile water containing the appropriate dose of compound, and each pig was ensured to ingest 5 mg / kg of 1-P and 20 mg / kg of DHM compound per day. The control group was administered the same amount of sterile water without compound every day. After 10 days of feeding, the animals were infected with 10 3.5 TCID50 of PRRSV highly pathogenic strain WUH3, and the test groups are shown in Table 4.

[0086] Table 4. Test group of 1-P combined with DHM for PRRSV infection

[0087]

[0088] 3. Effects of 1-P combined with DHM on the clinical incidence of PRRSV-infected pigs

[0089] The body temperature (rectal temperature) and body weight of the infected pigs were regularly detected and recorded since the 0th day of PRRSV infection, and the clinical symptoms of the infected pigs were observed and recorded, including the feeding condition, mental state, body surface state, respiratory symptoms and neurological symptoms of the experimental animals, and scored according to the clinical symptom evaluation standard shown in Table 5, wherein the score of the death case = total clinical score + 5 points = 20 points. The results are shown in Table 5 and Figure 8 The clinical incidence of the infected pigs in the control group was significantly higher than that of the infected pigs in the experimental group.

[0090] Table 5. PRRSV infected piglet total clinical symptom evaluation standard

[0091]

[0092] Table 6. PRRSV infected piglet clinical symptom score

[0093]

[0094] 4. The effect of 1-P combined with DHM on the mortality of PRRSV infected pigs

[0095] The health status of the pigs was observed and recorded every day after PRRSV infection, and the results are shown in Table 8. Figure 9 The control group had 2 deaths on the 14th day and 1 death on the 18th day, with a survival rate of 40%; the experimental group with 1-P and DHM compound had no deaths, with a survival rate of 100%.

[0096] 5. The effect of 1-P combined with DHM on the body temperature of PRRSV infected pigs

[0097] The body temperature of the infected pigs was detected and recorded since the 0th day of PRRSV infection, and the results are shown in Table 7 and

[0098] The results are shown in Table 7 and Figure 10 The body temperature of the control group reached above 40℃ on the 4th day of infection, and the body temperature of pigs No. 61, No. 62 and No. 64 reached 41℃ and continued to have high fever, among which pigs No. 61 and No. 64 died on the 14th day of infection, and pig No. 62 died on the 18th day of infection; the pigs in the experimental group had a short-term high temperature of 41℃ and quickly decreased to below 41℃, and no deaths occurred during the period.

[0099] Table 7. The effect of 1-P combined with DHM on the body temperature of PRRSV infected pigs

[0100]

[0101] 6. The effect of 1-P combined with DHM on the body weight of PRRSV infected pigs

[0102] The weight changes of the infected pigs were detected and recorded at 0th day, 2nd day, 4th day, 6th day and until 22nd day after infection.

[0103] The results are shown in Table 8 and Figure 11 The control group was in a state of weight stagnation or negative growth after infection, among which the weight of pigs No. 62 and No. 64 decreased most obviously, and pigs No. 62 and No. 64 died on the 16th day and the 14th day after infection, respectively, and pig No. 61 died on the 14th day after infection; the test group showed a small weight loss trend and then slowly increased, and no death occurred during the whole period.

[0104] Table 8. Effect of 1-P combined with DHM on the weight of PRRSV infected pigs

[0105]

[0106] 7. Effect of 1-P combined with DHM on the serum viral load of PRRSV infected pigs

[0107] From the 0th day of PRRSV infection, blood samples were collected from the anterior vena cava at 0th day, 7th day, 14th day and 21st day after infection, and the viral load in serum was detected.

[0108] The results are shown in Table 9 and Figure 12 The serum CT value of the control group pigs was below 20 at 7th day after infection, and the viral load was high; the serum CT value of the test group pigs remained above 20 and continuously increased throughout the infection period.

[0109] Table 9. Effect of 1-P combined with DHM on the viral load in serum of PRRSV infected pigs

[0110]

[0111] 8. Effect of 1-P combined with DHM on the viral load of anal swabs of PRRSV infected pigs

[0112] From the 0th day of PRRSV infection, anal swabs of infected pigs were collected at 0th day, 2nd day, 4th day, 6th day and until 22nd day after infection, and the PRRS viral load in the anal swabs was detected using the real-time fluorescent quantitative PCR method recommended in the National Standard Blue Ear Detection Method (GB / T 18090-2023) of the People's Republic of China.

[0113] The results are shown in Table 10 and Figure 13 The control group pigs showed anal swab positive at 2nd day after infection, and the test group showed anal swab positive at 8th day after infection, and the viral load in anal swabs of the control group was slightly higher than that of the test group.

[0114] Table 10.1-P and DHM combined drug use on the impact of PRRSV infected pigs in anal swabs viral load

[0115]

[0116] 9. 1-P and DHM combined drug use on the impact of PRRSV infected pigs in throat swabs viral load

[0117] From the 0th day of PRRSV infection, throat swabs of infected pigs were collected on the 0th day, 2nd day, 4th day, 6th day, and until the 22nd day of infection, and the PRRS virus load in the throat swabs was detected using the real-time fluorescent quantitative PCR method recommended in the Blue Ear Detection Method of the People's Republic of China National Standard (GB / T18090-2023).

[0118] As shown in Table 11 and Figure 14 , the viral load of the control group throat swabs was significantly higher than that of the test group.

[0119] Table 11.1-P and DHM combined drug use on the impact of PRRSV infected pigs in throat swabs viral load

[0120]

[0121] 10.1-P and DHM combined drug use on the impact of PRRSV infected pigs in nasal swabs viral load

[0122] From the 0th day of PRRSV infection, nasal swabs of infected pigs were collected on the 0th day, 2nd day, 4th day, 6th day, and until the 22nd day of infection, and the PRRS virus load in the nasal swabs was detected using the real-time fluorescent quantitative PCR method recommended in the Blue Ear Detection Method of the People's Republic of China National Standard (GB / T18090-2023).

[0123] As shown in Table 12 and Figure 15 , the viral load of the test group pigs in the nasal swabs after infection was significantly lower than that of the control group pigs, and the test group pigs No. 41 and No. 42 appeared negative in the nasal swabs from the 28th day after infection.

[0124] Table 12.1-P and DHM combined drug use on the impact of PRRSV infected pigs in nasal swabs viral load

[0125]

[0126] 11. 1-P and DHM combined drug use on the impact of PRRSV infected pigs in lung tissue lesions

[0127] The control group pigs were dissected immediately after death due to infection with PRRSV; the pigs in the test group that were administered the 1-P and DHM compound were dissected on the 22nd day after infection, and normal pigs of the same age that were not infected with PRRSV were dissected on the same day. The lung lesions of the pigs in each group were observed, as shown in Table 1, and the results were as follows: Figure 16 As shown in Table 1, the lungs of the pigs in the control group that were infected with PRRSV had obvious parenchymal lesions and hemorrhagic spots, while the lungs of the pigs in the test group that were administered the 1-P and DHM compound and the normal PRRSV-negative control pigs had no obvious abnormalities; the other organs had no obvious lesions. In summary, the 1-P and DHM compound can significantly reduce the tissue and organ damage caused by PRRSV.

Claims

1. Use of a composition comprising lysophosphatidylcholine and dihydromyricetin in the manufacture of a medicament for the treatment or prevention of porcine reproductive and respiratory syndrome, said lysophosphatidylcholine having CAS number 17364-16-8 and said dihydromyricetin having CAS number 27200-12-0.

2. Use of a composition comprising lysophosphatidylcholine and dihydromyricetin in the manufacture of a medicament for the treatment or prevention of porcine reproductive and respiratory syndrome virus infection, said lysophosphatidylcholine having CAS number 17364-16-8 and said dihydromyricetin having CAS number 27200-12-0.

3. Use according to claim 1 or 2, characterized in that, Said lysophosphatidylcholine and dihydromyricetin are one of the main effective components in the composition.

4. Use according to claim 1 or 2, characterized in that, The molar ratio of said lysophosphatidylcholine and dihydromyricetin is 0.5-1:1-2.

5. Use according to claim 2, characterized in that, When the porcine reproductive and respiratory syndrome virus is PRRSV NADC30-like, the molar ratio of lysophosphatidylcholine and dihydromyricetin is 0.5:

2.

6. Use according to claim 2, characterized in that, When the porcine reproductive and respiratory syndrome virus is PRRSV WUH3, the molar ratio of lysophosphatidylcholine and dihydromyricetin is 1:1.

Images